Skip Navigation



International Immunology Advance Access published online on November 20, 2007

International Immunology, doi:10.1093/intimm/dxm116
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
20/1/11    most recent
dxm116v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Caucheteux, S. M.
Right arrow Articles by Kanellopoulos-Langevin, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Caucheteux, S. M.
Right arrow Articles by Kanellopoulos-Langevin, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Japanese Society for Immunology. 2007. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Tolerance induction to self-MHC antigens in fetal and neonatal mouse B cells

Stéphane M. Caucheteux1,2,*, Cécile Vernochet1,*, Josiane Wantyghem1, Marie-Claude Gendron3 and Colette Kanellopoulos-Langevin1

1 Laboratory of Immune Regulations and Development, Department of Developmental Biology, J. Monod Institute, UMR 7592 (CNRS and Universities Paris 6 and 7), 2 place Jussieu, 75251 Paris cedex 05, France
2 Present address: Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, USA
3 Flow Cytometry Unit, J. Monod Institute, 75251 Paris cedex 05, France

Correspondence to: Correspondence to: C. Kanellopoulos-Langevin; E-mail: kanellopoulos{at}ijm.jussieu.fr


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 References
 
We have studied the mechanisms of tolerance induction to self-MHC antigens in mouse B cells during fetal development and the post-natal period. To monitor the fate of autoreactive B cell clones, we used the 3-83µ{delta} B cell receptor (BCR)-transgenic (Tg) and -knock-in (KI) mouse models. These BCR-Tg and -KI B cells recognize the MHC class I molecules H-2Kk and H-2Kb, with a high or moderate affinity, respectively. We compared the fate of BCR-Tg and -KI B cells in H-2Kb-bearing animals and H-2Kb-negative controls at various stages of their fetal development and post-natal life. Our data show that, in contrast to what occurs in adult B cells, anergy is the main component of tolerance induction in 3-83µ{delta} BCR-Tg Kb+ autoreactive fetuses, while 3-83 BCR-KI fetuses primarily use receptor editing. Interestingly, autoreactive B cell deletion is absent or merely marginal before birth. Our results indicate that tolerance induction is effective as early as embryonic day 16.5 and that in the fetus and neonate, like in the adult, the main mechanism of B cell tolerance functioning in the 3-83 KI system is receptor editing. In contrast, in the 3-83µ{delta} mice where receptor editing is hindered, adult and fetal B cells differ in their preferential use of mechanisms leading to self-tolerance (i.e. deletion versus anergy).

Keywords: B cells, MHC, tolerance/anergy, transgenic mice


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 References
 
The induction and maintenance of a state of immunological tolerance to self-antigens are essential for the good health and survival of mammalian organisms. How the immune system purges itself of autoreactive lymphocytes or prevents their harmful activation has been extensively investigated (15). Recently, studies of mice transgenic (Tg) for B or T cell antigen receptors exposed to their specific antigen in vivo have contributed to the identification and investigation of the mechanisms involved in tolerance. Thus, anergy (68), receptor editing (911) and antigen-specific cell deletion (1214) have all been described during tolerance induction in B cells.

Two B cell receptor (BCR)-Tg mouse models have greatly contributed to the description of the mechanisms leading to tolerance towards a ubiquitous membrane-bound self-antigen. In the now classic system described by Goodnow et al. (15), the Tg BCR is able to recognize hen egg lysozyme (HEL) as self. When HEL is expressed on the cell surface, clonal deletion of mature B cells induces a state of tolerance . The persistence of immature autoreactive B cells from bone marrow (BM), which display decreased levels of surface IgM (sIgM) (15) and are blocked in their maturation (16), has been demonstrated. In contrast, in the knock-in (KI) model where the anti-HEL light chain was inserted at the endogenous light chain locus, membrane-bound HEL initiates very efficient receptor editing in self-reactive B cells, without any cell death (17). Significantly different results were obtained when the conventional anti-HEL Tg BCR was expressed concomitantly with soluble HEL. In this case, the anti-HEL B cells were in an anergic state characterized by an inability to secrete anti-HEL antibodies and markedly reduced levels of sIgM with no modification of the surface IgD (sIgD) levels (6). These anergic B cells attempt to change their specificity by receptor editing in the BM, the amplitude of the sIgM down-modulation and the editing response being correlated with the strength of BCR signaling (18). They were, however, unable to efficiently edit the conventional Tg light chain. Conversely, in the anti-HEL KI model, soluble HEL initiates both anergy and efficient receptor editing (17). Two B cell populations were detected in the periphery of autoreactive animals: one was anergic with down-regulated sIgM levels and the other presented high levels of sIgM and showed evidence of receptor editing (17). The authors suggested that anergy rather than editing is responsible for tolerance to soluble HEL antigen in the BM.

In the other classic 3-83 BCR-Tg mouse model, described by Nemazee et al. (14, 19), the Tg BCR recognized the mouse MHC class I molecules H-2Kk with a high affinity and H-2Kb with an affinity at least 10-fold lower (20). Analyses of conventional 3-83 BCR-Tg mouse models have shown that, in adults, the majority of autoreactive B cells recognizing membrane-bound H-2Kk or H-2Kb antigens are clonally deleted in the periphery, whereas the B cells that have low sIgMs and are blocked in their maturation persist in the BM (11, 14). These BM autoreactive B cells have the ability to alter the specificity of their BCR by receptor editing and small numbers can gain access to the periphery (11). On the other hand, in 3-83 BCR-KI adults, B cell tolerance to the same auto-antigens results almost exclusively from receptor editing, and B cells devoid of autoreactive specificities appear in normal numbers in the periphery (21). These results were confirmed in a polyclonal B cell population from BM chimeras, where 3-83 BCR-KI cells were mixed with non-Tg B cells (22). Tolerance towards the MHC class I H-2Kb and H-2Kk expressed by the host was achieved by receptor editing with minimal cell loss. Clonal deletion was only observed when receptor editing was inhibited by a J{kappa} deletion or in a RAG-deficient background (22).

The early events of induction of tolerance to self-antigens during fetal and neonatal life have received little attention in such models, however. In the present work, we monitored the fate of 3-83µ{delta} BCR-Tg (19) and -KI (21) autoreactive B cells during fetal development and in the neonatal period. Interestingly, 3-83 BCR-KI fetuses and neonates primarily use receptor editing to achieve central tolerance to H-2Kb self-antigens. In contrast to the situation in the adult, in 3-83µ{delta} BCR-Tg fetuses, where receptor editing is hindered, B lymphocytes are not deleted in the presence of the H-2Kb self-antigen, but are anergic and show only limited receptor editing. Massive clonal deletion of self-reactive B cells is observed only after birth. Also in contrast with conventional 3-83µ{delta} BCR-Tg adults, the amplitude of deletion increases with the level of surface expression of H-2Kb and the affinity of the BCR–self-antigen interactions. Thus, although similar mechanisms appear to be active in both fetal and adult B cell tolerance induction, during fetal development they are triggered sequentially and are differentially affected by the dose of self-antigen dose and the affinity of the BCR for this latter.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 References
 
Mice
C57BL/10ScSnOlaHsd (B10, H-2b), B10.BR/OlaHsd (B10.BR, H-2k), B10.D2/nOlaHsd (B10.D2, H-2d) congenic mice were purchased from Harlan (Gannat, France). D. Nemazee and R. Pelanda kindly provided 3-83µ{delta} BCR-Tg (19) and -KI (21) mice, respectively, and maintained on the B10.D2 background. All mice were housed under specific pathogen-free conditions in the animal facilities at the Institut Jacques Monod, and cared for in accordance with institutional guidelines for animal welfare. B10.D2, B10 or B10.BR virgin females (6–10 weeks old) were mated with B10.D2, 3-83µ{delta} BCR-Tg or -KI males. B10 females were also crossed with (B10 x B10.D2) F1 3-83µ{delta} BCR-Tg males. The day of vaginal plug was considered as day 0.5 of pregnancy. Fetuses or neonates were analyzed between 14.5 days post-coïtum (dpc) and 3 days post-partum (dpp). The animals were screened by PCR on DNA samples of the tail. PCR assays were performed in a final volume of 25 µl containing 100 ng of purified genomic DNA in PCR buffer containing 1/5 of Cresol red (60% sucrose, 1 mM Cresol red), 250 nM of dinucleotidephosphates, 500 nM of each oligonucleotide primer and 1 U of Taq DNA polymerase (Applied Biosystems, Courtaboeuf, France). Oligonucleotide primers used to detect the 3-83µ{delta} transgene were 5' CAG CTT CCT GCT AAT CAG TGC C 3' and 5' TGG TCC CCC CTC CGA ACG TG 3'. PCR products were generated under the following conditions: 94°C for 4 min, 30 amplification cycles (94°C for 1 min, 60°C for 1.5 min, 72°C for 1 min) and 72°C for 10 min.

Cell preparations
Suspensions of BM cells were prepared by flushing the long bones (femurs and tibias) from both hind legs with PBS without calcium and magnesium, 4% heat-inactivated FCS, 0.1% NaN3. Fetal liver and spleen cells were prepared by gentle teasing (23, 24). Erythrocytes were eliminated by osmotic shock in lysis buffer (10% 0.17 M Tris in 8.3 g l–1 NH4Cl, pH 7.4). Aliquots of 106 nucleated cells from individual mice at various stages of development were incubated for each assay. Blood samples from fetuses and neonates were collected in heparin after decapitation and plasma was recovered by centrifugation and kept frozen at –20°C until use.

Flow cytometry analyses
Fetal liver, BM and spleen cells were stained for 40 min at 4°C, with an optimal amount of the following antibodies: polyclonal goat anti-mouse IgM antibodies labeled with FITC (Southern Biotechnology Associates, Clinisciences, Montrouge, France), biotin-coupled anti-IgDa, anti-IgDb (BD-Pharmingen, Le Pont de Claix, France) or 54.1 anti-idiotype mAbs and FITC-coupled anti-mouse {lambda}1,2,3 chain antibodies. Biotin-coupled antibodies were further revealed by incubating cells for 20 min at 4°C, with PE-labeled Streptavidin (BD-Pharmingen, Le Pont de Claix, France). After washing, cell suspensions were analyzed on an Epics Elite-ESP flow cytometer (Beckman-Coulter, Roissy, France). Non-lymphoid cells, dead cells and aggregates were excluded by gating on forward and side-scatter parameters.

Real-time quantitative reverse transcription–PCR analyses
Total RNA was extracted from fetal liver or BM cells using a QIAGEN RNeasy mini kit (Courtaboeuf, France). Each RNA sample was subjected to DNase treatment (DNA free; Applied Biosystems) to eliminate DNA contaminants. One microgram of RNA from each sample was reverse transcribed in a 20-µl reaction using 50 U of Moloney Murine Leukemia virus reverse transcriptase and 20 U of Rnuclease inhibitor (Applied Biosystems), 1 mM of dA/T/G/C, 5 mM of MgCl2 and 2.5 µM of random hexamers (Applied Biosystems). Real-time quantitative PCR was achieved using a cDNA equivalent of 50 ng of total RNA. The reaction was performed in 25 µl using SYBR green PCR core reagents (Applied Biosystems) according to the manufacturer's instructions. PCR was developed with the ABI PRISM 7000 sequence detection system (Applied Biosystems). Amplification was performed using a 2-min step at 50°C and then a 10-min denaturation step at 95°C, followed by 40 cycles of 15 s of denaturation at 95°C, 1 min of primer annealing and a polymerization step at 60°C. The CD19 gene was used as internal control and each sample was normalized on the basis of its CD19 content. The following primers were used: ACCTGGGTTCCGTTCTATTCA and TGGAGGGATTTCATTGGAGGT for RAG-2, and ACCAGTACGGGAATGTGCTC and CTTCATAGGCCTCCCCTTCTT for CD19.

ELISA assays
Microtiter plates (96 wells) were coated with 5 µg ml–1 of affinity-purified goat anti-mouse µ-chain antibodies in 50 mM Tris–HCl, pH 9.6, and saturated with 0.25% BSA in PBS (25). Duplicate serial dilutions of fetal sera were incubated for 2 h at 37°C and, after washing, the captured Igs were detected with alkaline phosphatase-conjugated purified goat Ig specific for the mouse µ chain (Serotec, Cergy-Saint Christophe, France). Dilutions of purified mouse IgM (Sigma Chemicals, Saint Quentin-Fallavier, France) were used to establish the calibration curve in each assay.

Statistical analyses
We used the Student's t-test to compare the mean values in control versus experimental groups of animals and we worked with Statview 5.0.1 software for Macintosh in all our analyses.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 References
 
Early down-modulation of BCR IgM expression in fetal liver in the absence of B cell deletion
Using the well-known 3-83µ{delta} BCR-Tg mouse model (19), we monitored the appearance of BCR+ B cell clones in mouse fetal liver from 14.5 dpc until birth. In order to examine how B cell tolerance to self-MHC antigens is induced in fetuses, we compared the fate of BCR-Tg B cells developing in control H-2d versus experimental H-2b/d fetuses expressing the self-MHC antigen H-2Kb recognized by the 3-83µ{delta} BCR. Typical results are presented in Fig. 1. In control fetal liver (Fig. 1A, upper panel), sIgM+ and sIgM+ IgD+ B cells were detected at increasing frequencies from day 14.5 until 18.5 pc. In the autoreactive H-2b/d situation (Fig. 1A, lower panel), fetal liver B cells were present at comparable frequencies, but showed a drastic down-modulation of sIgM expression as early as day 16.5 pc [mean fluorescence intensity (MFI) 14.3 versus 36.3 in controls, P < 0.05]. In contrast, sIgD expression on the same cells was not affected until birth, when a slightly lower level of expression (MFI 4 versus 6.6) was observed (P < 0.05) (Fig. 1A, compare upper and lower panels). In line with these results and as illustrated in Fig. 1(B) (upper panel), the first sIgM+ idiotype+ Tg B cells (0.1%) were clearly detectable as early as day 14.5 pc in fetal liver. A rapid increase in B cell frequency was observed until birth, and was comparable in both experimental and control groups (from 0.1% up to 9 or 7% at birth). Again, a clear down-modulation of the idiotype-bearing BCR was observed in the self-reactive animals (MFI 8.3, 16.2 and 4.3 on days 16.5, 18.5 pc and at birth, respectively) compared with the controls (MFI 82.9, 66.3 and 79.9 on the same dates, Fig. 1B).


Figure 1
View larger version (59K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Early down-modulation of self-reactive BCR IgM and idiotype expression in fetal liver B cells. Fetal liver cells were double stained with anti-IgM and anti-IgDa antibodies (A) or with anti-IgM and anti-idiotype antibodies (B) and analyzed by flow cytometry. Two-dimensional plots of the analyses from representative cell samples from H-2d or H-2b/d self-reactive 3-83µ{delta} BCR-Tg animals are shown, from 14.5 dpc until birth. Cell percentages and µ, {delta} or idiotype MFI are shown. The experiments were reproduced at least three times on each date, and included at least three animals per group.

 
The mean total numbers of B cells in control and experimental fetal livers were plotted from 14.5 dpc until birth (Fig. 2A). It is noteworthy not only that there was little cell loss in autoreactive H-2b/d fetal livers compared with controls but also that sIgM+ IgD cell numbers were significantly increased in self-reactive animals compared with controls on day 16.5 pc and at birth (P < 0.01 and P < 0.001). A significant decrease in fetal liver self-reactive IgM+ IgD+ cells was observed on day 18.5 pc (P < 0.05), but the reverse effect was observed at birth, when the same cell population had expanded in autoreactive versus control neonates (P < 0.05). We have no explanation at present for these fluctuations in the numbers of fetal B cells on the restrictive background. Nevertheless, our data clearly show that a major clonal deletion was not involved in the central B cell tolerance induction in the fetus.


Figure 2
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Compilation of B cell numbers from fetal liver, BM and spleen in H-2d or H-2b/d self-reactive 3-83µ{delta} BCR-Tg animals. Results from the series of experiments illustrated in Fig. 1 have been pooled from 14.5 dpc until 3 dpp. (A) Fetal liver and BM; (B) spleen. Mean cell numbers (±SEM) of IgM+ IgD or IgM+ IgD+ B cells are presented as histogram bars for each stage of development. *P < 0.05; **P < 0.01; ***P < 0.001.

 
Globally, our results indicate that sIgM down-modulation is the first indicator (as early as 16.5 dpc) of the recognition of a self-MHC antigen by a BCR-Tg fetal liver B cell in vivo, in the absence of auto-antigen-specific cell deletion.

Peripheral deletion of self-reactive mature B cells in fetuses at day 18.5 pc
As shown in Fig. 2(B) (upper panel), sIgM+ IgD B cell numbers are not affected in the spleen of self-reactive fetuses at 18.5 dpc, but their deletion commences at birth. In contrast, sIgM+ IgD+ autoreactive splenic B cell numbers are significantly reduced in H-2b/d fetuses compared with controls at 18.5 dpc and at birth (P < 0.001) (Fig. 2B, lower panel). One may hypothesize that self-reactive immature B cells are blocked in their development and accumulate in the periphery, whereas mature B cells, potentially capable of transducing BCR-mediated signals of higher intensity, are sensitive to deletion.

Thus, in 3-83µ{delta} self-reactive fetuses, the earliest events of cell deletion are restricted to sIgM+ IgD+ spleen cells from day 18.5 pc on.

Post-natal onset of IgM+ IgD+ B cell deletion in BM
At the time of birth, the hematopoietic capacity of fetal liver declines and is taken over by BM. Between days 1 and 3 pp, the auto-antigen-specific B cell deletion starts and increases in the BM, affecting the sIgM+ IgD+ B cell population (Figs 2A and 3, left). Moreover, in the few remaining IgM+ IgD+ B cells, the BCR almost completely disappears (Fig. 3, left).


Figure 3
View larger version (34K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. Post-natal onset of self-reactive B cell deletion. The same experiment as in Fig. 1 was performed on BM and spleen cells from H-2d or H-2b/d self-reactive 3-83µ{delta} Tg neonates at 1 and 3 days of age. Percentages of cells and µ or {delta} MFI are shown. The experiment was reproduced at least three times on each date, and included at least three animals per group.

 
Between days 1 and 3 pp in the spleen, the sIgM+ IgD+ population of B cells also presents a drastic down-modulation of IgM and, to a lesser degree, of IgD (Fig. 3, right). It is also increasingly depleted, with a nearly total disappearance of cells on day 3 pp (Figs 2B and 3, right). Conversely, at the same time, the quantities of sIgM+ IgD B cells are not significantly affected in the BM or spleen of H-2Kb+ animals (Fig. 2).

Self-reactive B cells with diminished IgM BCR expression are in a state of anergy
Using a sensitive ELISA assay (25), we measured the amount of circulating IgM in the plasma of 3-83µ{delta} BCR-Tg control or autoreactive fetuses and neonates. As can be seen in Fig. 4, while the level of circulating IgM in control animals greatly increases from 16.5 dpc until birth (from 782 to 2263 ng ml–1), the presence of H-2Kb leads to a near-total reduction in levels of circulating IgM as early as 16.5 dpc (69 ng ml–1), corresponding, on a per cell basis, to reduction factors of 1.9 on day 18.5 pc and 8.7 at birth. These results strongly suggest that 3-83µ{delta} Tg B cells with a low BCR expression present in H-2Kb+ fetuses are in a state of anergy.


Figure 4
View larger version (8K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. An ELISA determination of circulating IgM levels. IgM serum levels (ng ml–1) from individual animals were plotted against the developmental stage, 16.5 dpc, 18.5 dpc and birth. Differences between the means (±SEM) from control H-2d (black dots) versus H-2b/d self-reactive 3-83µ{delta} BCR-Tg animals (white dots) are statistically significant in each of the three tests (P < 0.001, P < 0.05 and P < 0.001, respectively). The experiments included at least three animals per group.

 
Up-regulation of RAG-2 mRNA expression during tolerance induction
Figure 5A presents a kinetic study of the levels of RAG-2 mRNAs in total RNA preparations from fetal liver (16.5 dpc to birth) or BM (3 dpp) from control and self-reactive mice. The expression of CD19 mRNA was monitored as an internal control in both sets of samples. A real-time quantitative analysis by reverse transcription–PCR revealed an increase in RAG-2 expression in autoreactive animals only, starting on day 16.5 pc. These results strongly suggest that receptor editing is taking place in self-reactive B cells from fetal liver and BM.


Figure 5
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. (A) RAG-2 transcript levels in fetal liver or BM B cells. Real-time quantitative reverse transcription–PCR analysis of RAG-2 mRNA expression in fetal liver or BM (3 dpp) B cells from H-2d or H-2b/d self-reactive 3-83µ{delta} BCR-Tg fetuses and neonates. Data are expressed as levels of RAG-2 mRNA normalized by corresponding CD19 mRNA levels. Numbers are means ± SEM (two to five animals per group). *P < 0.05; **P < 0.02. (B) Receptor editing in self-reactive neonatal spleen B cells. The frequency of {lambda}-positive cells among Tg IgDa+ B cells in the spleen of H-2d or H-2b/d self-reactive 3-83µ{delta} Tg neonates (at birth and 3 dpp) has been plotted. At least five individual animals were included in each determination. *P < 0.01.

 
Receptor editing in neonatal spleen cells
Importantly, the quantities of {lambda}-positive cells were significantly increased in the H-2Kb-bearing spleen at birth and 3 dpp, in comparison with control animals (Fig. 5B, P < 0.01), indicating that a significant percentage of autoreactive B cells undergo receptor editing.

These results suggest that autoreactive fetal B cells are anergized and initiate receptor editing, whereas in the neonate, receptor editing is at work albeit to a limited degree in this Tg model, thus leading to the deletion of self-reactive B cells (11).

The tolerance induction depends on the dose of self-antigen and the BCR affinity for the self-antigen
In order to examine how BCR–self-antigen interactions might affect the induction of tolerance to self-MHC, we studied the fate of self-reactive BCR-Tg B cells in the presence of either two gene doses of H-2Kb or the H-2Kk self-antigen recognized by the 3-83µ{delta} BCR with a higher affinity than H-2Kb. The results presented in Fig. 6(A) show that in 18.5 dpc fetal liver, the down-modulation of the BCR is positively correlated with the affinity of the interaction (MFI 1.6 in H-2k/d compared with MFI 5 in K-2b/d). The mean cell number of sIgM+ IgD cells is marginally affected in H-2b/b fetuses, and drastically reduced in H-2Kk+ fetuses (Fig. 6B). In addition, the range of IgM+ IgD+ B cell deletion is only limited with one gene dose, while it is clearly visible with two gene doses, and even more so in the presence of H-2Kk (Fig. 6B).


Figure 6
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. The amplitude of tolerance induction depends on the level of expression of the self-antigen and the affinity of the BCR for the self-antigen. (A) Fetal liver cells (18.5 dpc) from control H-2d or H-2b/d, H-2b/b and H-2k/d self-reactive 3-83µ{delta} Tg fetuses were analyzed by flow cytometry, and the results are presented as in Fig. 1. (B) Compilation of numbers of IgM+IgD or IgM+IgD+ B cells from fetal liver (18.5 dpc). Results from four experiments (as illustrated in A) were pooled. Mean cell numbers (±SEM) of IgM+ IgD or IgM+ IgD+ B cells are presented as histogram bars. *P < 0.05; **P < 0.01; ***P < 0.001.

 
Thus, in contrast to what has been reported for self-tolerance induction in 3-83 µ{delta} BCR-Tg adult B cells (20), fetal liver B cells are sensitive to the affinity of the self-antigen–BCR interaction and to the dose of self-antigen.

Editing is the main mechanism for tolerance induction in fetal and neonatal 3-83µ{delta} KI mice
Another BCR-Tg mouse model has been produced with the same specificity: the 3-83µ{delta} BCR-KI mouse where the 3-83 BCR heavy and light chain variable regions were inserted within the endogenous Ig loci by homologous recombination (21). The induction of tolerance to self-H-2Kb was monitored in 3-83 KI fetuses and neonates. As shown in Fig. 7, on day 18.5 pc, the frequency (Fig. 7A) and number (Fig. 7C) of fetal liver self-reactive IgM+ KI B cells are reduced, although these variations are not statistically significant at birth. Spleen cells, on the other hand, are significantly reduced (by about 50%) at both developmental stages (Fig. 7A and C). Moreover, they have not down-modulated their BCR. However, the majority of cells lose their idiotype in the presence of the H-2Kb auto-antigen, although they remain IgM+ (Fig. 7A). These observations are highly evocative of receptor editing and this hypothesis is confirmed by the detection of a much higher frequency of {lambda}-positive IgDa+ cells in the 18.5 dpc and neonatal spleen than in control mice (Fig. 7B, P < 0.05).


Figure 7
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7. Receptor editing in fetal and neonatal 3-83µ{delta} KI mice. (A) The same experiment as in Fig. 1(B) was performed on H-2d versus H-2b/d 3-83µ{delta} KI fetuses and neonates on fetal liver and spleen from animals on day 18.5 pc and at birth. The presentation is the same as in Fig. 1(B). (B) Spleen cells from the same animals were stained for surface {lambda}-chain and the Tg {delta}-chain IgDb. (C) Compilation of IgM+ B cell numbers from fetal liver or spleen (18.5 dpc and at birth). Results from three different experiments were pooled. Mean numbers (±SEM) of IgM+ B cells are presented as histogram bars. *P < 0.05; **P < 0.01.

 
Thus, 3-83 KI fetuses and neonates do not down-modulate but primarily edit the BCR of their self-reactive B cells.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 References
 
The BCR-Tg mouse models are a useful tool to analyze in vivo the mechanisms that govern central B cell tolerance. These mechanisms, which operate throughout adult life, include receptor editing (11, 17, 18, 21, 22), anergy (6, 1417) and antigen-specific B cell deletion (11, 14, 15, 24). Surprisingly, how B cell tolerance to self-antigens is induced during fetal and neonatal development is far less well documented (26-28). We used the now classic 3-83µ{delta} BCR-Tg (19) and -KI (21) mouse models to monitor the fate of self-reactive B lymphocytes in fetuses and neonates. We report in this paper that, similarly to the situation in the adult (21, 22), 3-83 KI B cells primarily use receptor editing as a mechanism of tolerance towards a membrane-bound self-antigen. On the other hand, in contrast to what has been described in adults (14), 3-83µ{delta} Tg B cells are not, or only marginally, deleted in fetuses expressing the H-2Kb self-antigen on the cell surface, and are instead rendered anergic. Fetal liver and spleen B cells having encountered their self-antigen primarily show a down-modulation of sIgM, which increases as the fetus develops. IgD expression starts to be affected at birth, when IgM modulation is already complete. Moreover, we show that, as early as day 16.5 pc and later during development, a major drop in the amount of circulating IgM is observed in H-2Kb+ fetuses compared with the H-2Kb– controls. Antigen-specific B cell deletion is detectable in the spleen, but from day 18.5 pc, only for IgM+IgD+ cells.

These patterns of B cell phenotype and behavior are highly reminiscent of the soluble HEL/anti-HEL system (6, 17), where the level of receptor occupancy is much lower than in the membrane-bound HEL/anti-HEL model (15). In soluble HEL/BCR anti-HEL double-Tg adult mice, B cells are not deleted but present a profound down-modulation of sIgM, leaving IgD on the cell surface (6). Such B cells are anergized and unable to secrete anti-HEL antibodies (6). Moreover, even in a KI model, where receptor editing is promoted, anergy still plays a major role during the process of tolerance induction (17). Our findings are particularly striking since the H-2Kb antigen is a cell-surface molecule, whereas the HEL is secreted. This difference had been claimed to be the source of the distinct B cell phenotypes encountered in tolerant adult animals: cell deletion for cell-borne antigens versus anergy. Our data argue that there are other factors than just the nature of the antigen that influence the B cell outcome, such as the antigen expression level, affinity and avidity of BCR–antigen interaction, cytokines and growth factors. One may hypothesize that, in the fetus, BCR signaling is not strong enough to trigger the deletion of the self-reactive B cells, possibly also because of the low expression of the membrane-bound self-antigen (29, 30). In contrast, after birth, the level of self-antigen expression may be sufficient to trigger clonal deletion after the failure of receptor editing, which is in line with observations in adults (11, 14). Clearly, there is no defect in the apoptosis pathway in fetal BCR-Tg cells since in H-2Kk animals, some clonal deletion is observed during fetal life.

This state of functional tolerance was further investigated by looking for another mechanism that does not require cell deletion, i.e. receptor editing. Repertoire analyses in human fetal liver B cells have suggested that editing mechanisms might be active before birth (31). We have found that RAG-2 gene expression is up-regulated as early as day 16.5 pc, although we failed to detect by flow cytometry any Tg B cells with an edited receptor before birth. This suggests that receptor-editing mechanisms are triggered early on, but present a lag phase before they affect the B cell repertoire. Our data indicate that before birth, anergy and receptor editing are the predominant components of mouse B cell tolerance in the conventional 3-83 BCR-Tg model.

In newborns, self-reactive Tg B cells in fetal liver, BM and spleen have completely down-modulated their sIgM, have started to decrease their sIgD level and are in a state of anergy, revealed by the near-total lack of circulating IgM in their sera. Antigen-specific B cell deletion increases from day 18.5 pc to reach near completion in spleen and BM on day 3 pp. Thus, it is only after day 3 pp that the B cell phenotype resembles the descriptions reported by Nemazee et al. in H-2Kb+ 3-83µ{delta} BCR-Tg adult mice (13, 14). Receptor editing is also easily detected after birth since a significant proportion of cells express new {lambda} chains associated with the Tg {delta} heavy chain on their cell surface. However, as reported by Nemazee et al., conventional BCR-Tg mice cannot fully edit their BCR and thus the idiotype is still expressed (4, 11, 21). It is possible, therefore, that fetal {lambda}-bearing cells are too rare to be reproducibly detected.

Another set of results that contrast with the situation in the adult concern the role of BCR affinity for the self-antigen. While it has been shown that the antigen-specific B cell deletion seen in adults occurs even with low-affinity interactions between the BCR and its ligand (20), the situation is different during fetal development since the affinity of interaction correlates positively with the amplitude of BCR down-modulation and an earlier onset of cell deletion (Fig. 6). This resembles the situation observed in the soluble HEL/anti-HEL BCR system (18). Our results also indicate that the antigen dose, i.e. the density of antigenic epitopes on self-tissues, is also an important parameter influencing the amplitude of cell deletion. The timing of tolerance induction is also affected by the BCR affinity and the self-antigen dose since B cell deletion is clearly detectable at 18.5 dpc in H-2k/d and H-2b/b fetuses, but remains marginal in H-2b/d ones. Thus, we show here that during fetal development, unlike the situation in the adult, both the affinity and the avidity of the BCR–self-antigen interaction play an important role in the timing and amplitude of subsequent tolerizing events at the B cell level.

Such qualitative and quantitative differences might result from the particular environment of B cell differentiation because fetal liver is different from adult BM in many respects, such as tissue structure, cell contacts, growth factors and cytokines (28). Another non-exclusive hypothesis is that the status or stage of maturation of B cells from fetal liver differs from that of BM. The former are at a stage of highly immature differentiation with low levels of BCR expression, and they are thus more likely to become anergic or undergo receptor editing than be deleted (18, 32, 33). Melamed et al. (34) and others have shown that the capacity of B cells to edit their receptors or trigger apoptosis is developmentally regulated. Finally, one must emphasize that the fetal H-2Kb self-antigen is expressed at less than one-tenth of its normal level in adults (29, 30). The system is remarkably dynamic since B cells progress in their developmental pathway and acquire a higher BCR density on their surface in parallel with an increasing level of expression of H-2Kb on self-tissues.

We completed our study using 3-83 KI mice in which the rearranged V portions of the 3-83 heavy and light chains had been inserted in their respective loci by homologous recombination (21). Interestingly, as soon as they are detectable, self-reactive 3-83 KI fetal B cells do not down-modulate their BCR, and show only partial deletion, although they primarily edit their antigen receptors. Consequently, fetal B cells lose their relevant idiotype and start to express new V{kappa} or {lambda} chains. These observations demonstrate (i) that receptor editing indeed occurs very early in mouse fetal B cell development and (ii) that it could be the predominant mechanism of induction of B cell tolerance at this stage. This latter mechanism would be preferable because it gives self-reactive cells a chance to alter their reactivity so that they can help to protect the organism from pathogens instead of being wasted. Interestingly, in contrast to our observations which point to a very early onset of receptor editing in the fetus, Huang et al., when using an arthritogenic Ig KI model, observed that receptor editing could only be detected from 2 weeks pp onwards (35). This discrepancy may be due to differences in the valency of the self-antigen which was soluble in their case and membrane-bound in our study. In a soluble self-antigen model, the onset of receptor editing may be delayed due to relatively weak BCR signaling, the predominant component of tolerance being anergy, as in the HEL/anti-HEL KI model, where membrane-bound HEL induces efficient receptor editing, whereas the soluble form triggers receptor editing as well as anergy (17).

The use of the 3-83 KI and conventional Tg mouse models enabled us to examine the whole range of mechanisms known to play an important role in tolerance to an MHC class I self-antigen in the fetus. The KI model mimics the physiological situation, whereas the conventional one highlights what happens when receptor editing is hindered or when the self-reactive B cell has exhausted all its potential secondary light chain gene rearrangements. Our results suggest that different tolerance mechanisms dominate in BCR-Tg fetal B cells because they become anergic, whereas BCR-KI fetal B cells edit their receptors. They also support the notion that, in fetuses and neonates, the outcome of an encounter with a self-antigen is probably drastically different from that in the adult, having a significant impact on the emerging B cell repertoire and its capacity to mount protective immune responses (26).


    Funding
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 References
 
The Fondation pour la Recherche Médicale and the Ligue Nationale contre le Cancer (to S.M.C.); the Ministère de l'Education Nationale, de la Recherche et de la Technologie and the Association pour la Recherche contre le Cancer (to C.V.).


    Acknowledgements
 
The authors gratefully acknowledge Antonia Kropfinger for revising the English language, the excellent animal care provided by Sébastien Paturance and his staff, technical support from Gérard Lefèvre and Michel Thomas and the secretarial assistance of Martine Malet and Liliane Corme.


    Abbreviations
 
BCR, B cell receptor
BM, bone marrow
dpc, days post-coïtum
dpp, days post-partum
HEL, hen egg lysozyme
KI, knock-in
MFI, mean fluorescence intensity
sIgD, surface IgD
sIgM, surface IgM
Tg, transgenic

    Notes
 
* These authors contributed equally to this work. Back

Transmitting editor: A. Radbruch

Received 6 November 2006, accepted 10 October 2007.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 References
 

  1. Goodnow CC. Transgenic mice and analysis of B-cell tolerance. Annu. Rev. Immunol. (1992) 10:489.[CrossRef][Web of Science][Medline]
  2. Goodnow CC. Balancing immunity and tolerance: deleting and tuning lymphocyte repertoires. Proc. Natl Acad. Sci. USA (1996) 93:2264.[Abstract/Free Full Text]
  3. Klinman NR. The "clonal selection hypothesis" and current concepts of B cell tolerance. Immunity (1996) 5:189.[Web of Science][Medline]
  4. Nemazee D. Receptor selection in B and T lymphocytes. Annu. Rev. Immunol. (2000) 18:19.[CrossRef][Web of Science][Medline]
  5. Nossal GJ. Negative selection of lymphocytes. Cell (1994) 76:229.[CrossRef][Web of Science][Medline]
  6. Goodnow CC, Crosbie J, Adelstein S, et al. Altered immunoglobulin expression and functional silencing of self-reactive B lymphocytes in transgenic mice. Nature (1988) 334:676.[CrossRef][Medline]
  7. Erikson J, Radic MZ, Camper SA, Hardy RR, Carmack C, Weigert M. Expression of anti-DNA immunoglobulin transgenes in non-autoimmune mice. Nature (1991) 349:331.[CrossRef][Medline]
  8. Goodnow CC, Brink R, Adams E. Breakdown of self-tolerance in anergic B lymphocytes. Nature (1991) 352:532.[CrossRef][Medline]
  9. Gay D, Saunders T, Camper S, Weigert M. Receptor editing: an approach by autoreactive B cells to escape tolerance. J. Exp. Med. (1993) 177:999.[Abstract/Free Full Text]
  10. Radic MZ, Erikson J, Litwin S, Weigert M. B lymphocytes may escape tolerance by revising their antigen receptors. J. Exp. Med. (1993) 177:1165.[Abstract/Free Full Text]
  11. Tiegs SL, Russell DM, Nemazee D. Receptor editing in self-reactive bone marrow B cells. J. Exp. Med. (1993) 177:1009.[Abstract/Free Full Text]
  12. Chen C, Nagy Z, Radic MZ, et al. The site and stage of anti-DNA B-cell deletion. Nature (1995) 373:252.[CrossRef][Medline]
  13. Nemazee D, Buerki K. Clonal deletion of autoreactive B lymphocytes in bone marrow chimeras. Proc. Natl Acad. Sci. USA (1989) 86:8039.[Abstract/Free Full Text]
  14. Nemazee DA, Burki K. Clonal deletion of B lymphocytes in a transgenic mouse bearing anti-MHC class I antibody genes. Nature (1989) 337:562.[CrossRef][Medline]
  15. Hartley SB, Crosbie J, Brink R, Kantor AB, Basten A, Goodnow CC. Elimination from peripheral lymphoid tissues of self-reactive B lymphocytes recognizing membrane-bound antigens. Nature (1991) 353:765.[CrossRef][Medline]
  16. Hartley SB, Cooke MP, Fulcher DA, et al. Elimination of self-reactive B lymphocytes proceeds in two stages: arrested development and cell death. Cell (1993) 72:325.[CrossRef][Web of Science][Medline]
  17. Hippen KL, Schram BR, Tze LE, Pape KA, Jenkins MK, Behrens TW. In vivo assessment of the relative contributions of deletion, anergy, and editing to B cell self-tolerance. J. Immunol. (2005) 175:909.[Abstract/Free Full Text]
  18. Tze LE, Baness EA, Hippen KL, Behrens TW. Ig light chain receptor editing in anergic B cells. J. Immunol. (2000) 165:6796.[Abstract/Free Full Text]
  19. Russell DM, Dembic Z, Morahan G, Miller JF, Burki K, Nemazee D. Peripheral deletion of self-reactive B cells. Nature (1991) 354:308.[CrossRef][Medline]
  20. Lang J, Jackson M, Teyton L, Brunmark A, Kane K, Nemazee D. B cells are exquisitely sensitive to central tolerance and receptor editing induced by ultralow affinity, membrane-bound antigen. J. Exp. Med. (1996) 184:1685.[Abstract/Free Full Text]
  21. Pelanda R, Schwers S, Sonoda E, Torres RM, Nemazee D, Rajewsky K. Receptor editing in a transgenic mouse model: site, efficiency, and role in B cell tolerance and antibody diversification. Immunity (1997) 7:765.[CrossRef][Web of Science][Medline]
  22. Halverson R, Torres RM, Pelanda R. Receptor editing is the main mechanism of B cell tolerance toward membrane antigens. Nat. Immunol. (2004) 5:645.[CrossRef][Web of Science][Medline]
  23. Vernochet C, Caucheteux SM, Gendron MC, Wantyghem J, Kanellopoulos-Langevin C. Affinity-dependent alterations of mouse B cell development by noninherited maternal antigen. Biol. Reprod. (2005) 72:460.[Abstract/Free Full Text]
  24. Ait-Azzouzene D, Caucheteux S, Tchang F, et al. Transgenic major histocompatibility complex class I antigen expressed in mouse trophoblast affects maternal immature B cells. Biol. Reprod. (2001) 65:337.[Abstract/Free Full Text]
  25. Ait-Azzouzene D, Gendron MC, Houdayer M, et al. Maternal B lymphocytes specific for paternal histocompatibility antigens are partially deleted during pregnancy. J. Immunol. (1998) 161:2677.[Abstract/Free Full Text]
  26. Astori M, Finke D, Karapetian O, Acha-Orbea H. Development of T-B cell collaboration in neonatal mice. Int. Immunol. (1999) 11:445.[Abstract/Free Full Text]
  27. Jones CA, Holloway JA, Warner JO. Phenotype of fetal monocytes and B lymphocytes during the third trimester of pregnancy. J. Reprod. Immunol. (2002) 56:45.[CrossRef][Web of Science][Medline]
  28. Vosshenrich CA, Cumano A, Muller W, Di Santo JP, Vieira P. Thymic stromal-derived lymphopoietin distinguishes fetal from adult B cell development. Nat. Immunol. (2003) 4:773.[CrossRef][Web of Science][Medline]
  29. Drezen JM, Nouvel P, Babinet C, Morello D. Different regulation of class I gene expression in the adult mouse and during development. J. Immunol. (1992) 149:429.[Abstract]
  30. Ozato K, Wan YJ, Orrison BM. Mouse major histocompatibility class I gene expression begins at midsomite stage and is inducible in earlier-stage embryos by interferon. Proc. Natl Acad. Sci. USA (1985) 82:2427.[Abstract/Free Full Text]
  31. Lee J, Monson NL, Lipsky PE. The V lambda J lambda repertoire in human fetal spleen: evidence for positive selection and extensive receptor editing. J. Immunol. (2000) 165:6322.[Abstract/Free Full Text]
  32. Kouskoff V, Lacaud G, Pape K, Retter M, Nemazee D. B cell receptor expression level determines the fate of developing B lymphocytes: receptor editing versus selection. Proc. Natl Acad. Sci. USA (2000) 97:7435.[Abstract/Free Full Text]
  33. Tze LE, Hippen KL, Behrens TW. Late immature B cells (IgMhighIgDneg) undergo a light chain receptor editing response to soluble self-antigen. J. Immunol. (2003) 171:678.[Abstract/Free Full Text]
  34. Melamed D, Benschop RJ, Cambier JC, Nemazee D. Developmental regulation of B lymphocyte immune tolerance compartmentalizes clonal selection from receptor selection. Cell (1998) 92:173.[CrossRef][Web of Science][Medline]
  35. Huang H, Kearney JF, Grusby MJ, Benoist C, Mathis D. Induction of tolerance in arthritogenic B cells with receptors of differing affinity for self-antigen. Proc. Natl Acad. Sci. USA (2006) 103:3734.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
20/1/11    most recent
dxm116v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Caucheteux, S. M.
Right arrow Articles by Kanellopoulos-Langevin, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Caucheteux, S. M.
Right arrow Articles by Kanellopoulos-Langevin, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?