Skip Navigation



International Immunology Advance Access published online on July 28, 2007

International Immunology, doi:10.1093/intimm/dxm076
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/9/1083    most recent
dxm076v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yang, W
Right arrow Articles by Junghans, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, W
Right arrow Articles by Junghans, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

© The Japanese Society for Immunology. 2007. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Chimeric immune receptors (CIRs) specific to JC virus for immunotherapy in progressive multifocal leukoencephalopathy (PML)

W Yang1, EL Beaudoin1, L Lu1, RA Du Pasquier2, MJ Kuroda2, RA Willemsen3, IJ Koralnik2 and RP Junghans1

1 Division of Surgical Research, Department of Surgery, Boston University School of Medicine, Roger Williams Medical Center, Providence, RI 02908, USA
2 Division of Viral Pathogenesis and Department of Neurology, Beth Israel Deaconess Medical Center, Boston, MA 02215, USA
3 Laboratory of Tumor Immunology, Department of Medical Oncology, Erasmus MC-Daniel den Hoed Cancer Center, Groene Hilledijk 301, 3075 EA Rotterdam, The Netherlands

Correspondence to: Correspondence to: R. P. Junghans; E-mail: rjunghans{at}rwmc.org


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Progressive multifocal leukoencephalopathy (PML) is a deadly brain disease caused by the polyomavirus JC (JCV). The aim of this study is to develop ‘designer T cells’ armed with anti-JCV TCR-based chimeric immune receptors (CIRs) by gene modification for PML immunotherapy. Two T cell lines specific to two dominant CTL epitopes derived from JCV VP1 protein (termed p36 and p100) from an HLA-A0201+ PML survivor were generated for TCR cloning. Two distinct dominant TCR alpha chains (V{alpha}6 and V{alpha}12) and a unique TCR beta chain (Vß5.1) were cloned from the p36-specific cell line, while only one alpha (V{alpha}8.6) and one beta (Vß2) chains were dominant in the p100-specific line. Retroviral constructs encoding CIRs were created with the extracellular domains of TCR {alpha} and ß chains fused to the transmembrane and cytoplasmic portions of CD3{zeta} (V{alpha}C{alpha}CD3{zeta} or VßCßCD3{zeta}). Cellular expression and screening for binding specific peptide-HLA-A0201 tetramer confirmed the reactivity of the p100 TCR{alpha}ß and of one of the two pairs of p36 TCR{alpha}ß (V{alpha}12 and Vß5.1). Functional tests confirmed CIR-expressing T cells secreted cytokines and expressed potent cytotoxicity on contact with A0201+ B-lymphoblastoid line loaded with peptides and/or with HLA-A0201+ cells expressing native JCV VP1 protein. In conclusion, anti-JCV designer T cells were generated.

Keywords: gene transfer, retroviral transduction, T cell, TCR


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Polyomavirus JC (JCV) is the etiologic agent of progressive multifocal leukoencephalopathy (PML), a lytic infection of oligodendrocytes associated with underlying immunosuppression or deficiency (1). JCV infects 90% of normal adults (2), but does not cause disease in healthy individuals. Viral reactivation occurs in 5% of patients with acquired immunodeficiency syndrome (AIDS), which accounts for >80% of PML cases, and occasional other individuals who are profoundly immunosuppressed. This reactivation leads to a lytic infection of oligodendrocytes and an associated demyelination of the central nervous system. There is no effective treatment for PML, with a median survival of 11 months. The disease has become a growing medical problem that continues to occur in HIV-infected individuals despite the introduction of highly active antiretroviral therapy (HAART) regimens (3). In addition, PML has recently been diagnosed in a few patients with multiple sclerosis and Crohn's disease treated with natalizumab, an immunomodulatory antibody that blocks integrin receptors (4, 5).

A humoral immune response is inadequate to prevent reactivation of JCV and development of PML. However, previous studies demonstrated that the presence of JCV-specific CD8+ CTL was associated with long-term survival in HIV+ individuals with PML (6, 7). Most of these CTL specificities have been identified with the JCV T or VP1 proteins that together account for two-thirds of the viral genome (7). For example, cytolytic activity against cells expressing VP1 capsid protein could be identified in the blood of 10/11 HIV+ PML survivors but was absent in 10/11 PML progressors (8). We (Koralnik et al.) previously characterized a panel of JCV peptides in the context of HLA A0201 (HLA A2+), the most common MHC class I allele, present in ~40% of all ethnic populations (9). Two 9mer peptides, p36 (VP1p36–44: SITEVECFL) and p100 (VP1p100–108: ILMWEAVTL), were found to be recognized by CTLs from PML survivors and the majority of healthy individuals, but not in patients with rapidly fatal outcomes (7, 1012).

Adoptive immunotherapy with ex vivo expanded autologous virus-specific CTL has been used successfully for the treatment of EBV and cytomegalovirus infections in immunosuppressed bone marrow transplant recipients (13, 14). This suggests that if JCV-specific T cells could be created and similarly expanded and supplied to PML patients lacking these specificities, then a similar therapeutic outcome might also be obtained.

Our laboratory (Junghans et al.) has focused on the development and application of chimeric immune receptors (CIRs) to create so-called ‘designer T cells’ that are redirected to targets according to the conferred designed specificities (15). Whereas most such applications have been with antibody-based CIRs, TCRs and TCR-based CIRs (TCRCIRs) and TCR-like antibody-based CIR for MHC class I-restricted antigens have been successfully created against a range of targets, both infectious [e.g. HIV gag/HLA-A3 (16), HIV pol/HLA-B35 (17), EBV LMP2/HLA-A2 (18), EBV FLR/B8 (19), and EBV IVT/A11EBNA/3A (19)] and malignant (e.g., melanoma cancer/testis antigens (MAGE-1/HLA-A1) (20, 21), melanocyte differentiation antigens [MART-1/HLA-A2 (22, 23), gp100/HLA-A2 (24, 25)]. These TCRs (1618, 2225), TCRCIRs (19, 20) and TCR-like antibody-based CIR (21) have been shown to redirect modified bulk human T cells to bind the relevant peptide/MHC ligands and also to activate normal T cell effector functions upon antigen presentation.

In the current study, we molecularly cloned two pairs of TCR{alpha}ß chains specific to the two dominant JC virus VP1-derived CTL epitopes (p36 and p100) from an HLA-A0201+ HIV+ PML survivor. TCRCIRs were created as fusion products of TCR{alpha} and TCRß with the zeta signaling chain of the CD3 complex. When the cognate {alpha}ß pairs were co-expressed in human T cells by retroviral transduction, binding was confirmed for specific peptides of JCV VP1 in HLA-A2+ context, both by soluble MHC tetramer complexes and by naturally processed peptides on VP1-expressing target cells. These TCRCIR-modified designer T cells exhibited T cell activation and signaling with cytokine secretion in an antigen-specific manner. These new anti-JC virus designer T cells hold promise as the first specific agents for PML adoptive immunotherapy.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Cell lines and antibodies
TCR-positive T cell line Jurkat, American Type Culture Collection, and an HLA-A0201+ EBV-transformed B-lymphoblastoid line (B-LCL) were cultured in RPMI 1640 plus 10% heat-inactivated FCS (R-10). The amphotropic and ecotropic retroviral packaging cell lines, Phoenix-amphotropic and Phoenix-ecotropic (gift of W. Pear, MIT, Boston), and the packaging cell line, PG13, were grown in R-10.

PE- or FITC-conjugated or unconjugated anti-human Vß2 (clone MPB2D5), Vß5.1 (clone IMMU157) and Vß20 (clone ELL1.4) antibodies were purchased from Immunotech (Beckman Coulter, Fullerton CA, USA). FITC-conjugated anti-human CD4 or CD8 antibodies were purchased from Caltag Laboratories (Invitrogen, Carlsbad CA, USA). Anti-human CD3 antibody (OKT3) was purchased from JOM Pharmaceutical (Somerset NJ, USA). JC virus-derived peptides, p36 (VP1p36–44: SITEVECFL) and p100 (VP1p100–108 ILMWEAVTL), were synthesized with over 90–98% purity and purchased from Mimotopes (Victoria, Australia) or Invitrogen. PE- or APC-conjugated p36 or p100/HLA-A0201 tetramers were either prepared in the Koralnik lab or obtained from National Institutes of Health MHC Tetramer Core Facility (Atlanta GA, USA). APC-conjugated p36 or p100/HLA-A0201 pentamers were purchased from ProImmune (Bradenton, FL, USA).

Generation of T cell populations enriched for JC virus p36 or p100 reactivity
PBMCs, obtained from an HIV+ PML patient with an inactive form of the disease, were separately stimulated with 1 µg/ml of p36 and p100 peptide for 10–14 days. The stimulated PBMCs were then stained with fluorochrome-labeled VP1 p100/A0201 tetramer and incubated with anti-fluorochrome immunomagnetic beads. Tetramer-stained cells were positively selected using an autoMACS cell sorter (Miltenyi Biotec). Sorted cells were then mixed at a ratio of 1:10 with autologous irradiated PBMC used as feeder cells in the presence of anti-CD3 antibody 12F6 at a concentration of 0.1 mg/ml. After two weeks of expansion in vitro in tissue culture medium containing 20 U IL2/ml, cells were subjected to another round of enrichment.

Molecular cloning p36 or p100/HLA-A0201-specific TCRs
To clone the {alpha} and ß chain of TCRs specific to p36 or p100 HLA A0201, two specific reverse PCR primers were applied: TCRC{alpha}R (5'-CTGTCTTACAATCTTGCAGATCTCAGCTGGACC-3') and TCRCßR (5'-TGAGGGCGGGCTGCTCCTTGAGGGGCTGCG-3'). The nucleotide sequence of primer TCRC{alpha}R exactly matches the sequence encoding the C-terminus and stop codon of {alpha} chain. The sequence of primer TCRCßR matches a sequence near the middle of the constant region of both C1 and C2 allotypes. In combination with forward primers provided by a SMART RACE cDNA Amplification Kit (Clontech, Mountain View CA, USA), the expected PCR products are full-length cDNA for TCR {alpha} chain but partial cDNAs encoding VDJ and half of C for TCR ß chain. Due to unexplained technical reasons, PCR primers designed to generate cDNA to include the full Cß did not yield valid results in PCR reactions. The full Cß was recovered during the subcloning into the retroviral expression vector (below).

Total RNA was extracted from a cell pool enriched with p36 or p100 HLA A0201 tetramer binding T cells after sorting for double Vß5.1 and JCVp36/HLA-A2 tetramer or Vß2 and JCVp100/HLA-A2 by FACS (Fig. 1). The 5' RACE first-strand cDNA was synthesized using a SMART RACE cDNA amplification kit (Clontech) and then used as template for PCR reaction to amplify the desired cDNAs encoding TCR {alpha} and ß chains in the presence of TCR{alpha}-specific primer TCRC{alpha}R and TCRCßR. The resultant specific TCR products with expected sizes were agarose gel purified and subcloned into the cloning vector. The sequences were selected for V(D)J-C usage identification using the BLAST2 algorithm and the ImMunoGeneTics database (http://imgt.cines.fr:8104/).


Figure 1
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. JCV VP1-specific T cells sorted for TCR cloning. Two T cell lines with specificity to JCV p36 (left panel) and JCV p100 (right panel) were generated from a same HIV+/PML patient. Left panel: Double-positive Vß5.1 and JCV VP1p36-specific T cells. The enriched population of JCV VP1p36-specific CTLs was stained with the HLA A0201/JCV VP1p36 tetramer complex and antibody recognizing Vß5.1. Most JCV VP1p36/HLA-A0201-positive T cells were Vß5.1 (upper right quadrant), indicating the limited diversity of TCR repertoire against this peptide. Right panel: Double-positive Vß2 and JCV VP1p100-specific T cells sorted for TCR cloning. The enriched population of JCV VP1p100-specific CTLs was stained with the HLA A0201/JCV VP1p100 tetramer complex and antibody recognizing Vß2, the most common Vß in the positive cell population. Of total cells, 28.9% that were double positive (upper quadrant) were sorted for TCR cloning. PE, FITC and APC are fluorescent dyes.

 
Construction of retroviral vectors encoding putative anti-JC virus CIRs
To identify and verify the functional binding pairs of anti-JC virus TCRs, and to study the signaling property of the CIRs, anti-JC virus TCRCIRs were created in two-chain two-vector (Tctv) format as previously described (20). The cDNAs encoding V{alpha}C{alpha} or VßCß derived from our cloned five dominant TCR {alpha} and ß chains (see Table 1) were linked as follows to the transmembrane domain (Tm) and cytoplasmic domain (Cy) of human CD3zeta ({zeta}) to generate TCRV{alpha}C{alpha}{zeta} and TCRVßCß{zeta} (Fig. 2) in MFG retrovirus (supplied by R. Mulligan, Harvard Medical School) modified to include a multi-cloning site (mcs).


View this table:
[in this window]
[in a new window]

 
Table 1. Summary of TCR clones encoding putative JCV p36- and p100/HLA-A0201-specific TCRs

 

Figure 2
View larger version (8K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Retrovirus constructs encoding TCRCIR. X, XhoI site; S, SwaI site; N, NotI site; B, BamHI site (located in the N-terminus of pEc of {zeta}).

 
To create VßCß{zeta}, vector was prepared first to encode Cß-{zeta}. A SwaI site (ATTTAAAT) was introduced in the sequence encoding amino acid residues of positions 2–4 (Asp-Leu-Asn) in the N-terminus of the C1 region by making a few nucleotide mutations without causing any substitution of amino acid sequence. A DNA encoding Cß (C1) and the Tm and Cy of CD3{zeta} generated by PCR using pSTITCH vector plasmid DNA (20) as a template in combination with a pair of primers (Cß-F_XS: GACTCTCGAGATCGATTTAAATAAGGTGTTCCCACCCGAGG and {zeta}_R_Stop_N: GTAATGCGGCCGCAACTTAGCGAGGGGGCAG) was subcloned into XhoI/NotI sites of MCS region of the MFG-based retroviral vector to create an MFG-Cß{zeta} vector for subcloning purpose. The sites for XhoI (CTCGAG), SwaI (ATTTAAAT), NotI (GCGGCCGC) and stop codon (TTA) in the two primer sequences are underlined, respectively.

DNA fragments encoding V{alpha}C{alpha}, including the signal peptide sequence, derived from the three dominant cDNAs encoding TCR V{alpha}C{alpha} (p36V{alpha}6, p36V{alpha}12.2 and p100V{alpha}8.6) were amplified by PCR using specific primers: a common reverse primer that matches C{alpha} region and 3' flanking sequence of BamHI site (GGATCC) (sequence: 5'-GTTTGGGATCCAGATCCCCACAGGAACTTTCTGGGC) and one of three specific forward primers with an XhoI site (CTCGAG) immediately upstream of the start codon (ATG) [(i) p36V{alpha}12.2_F: TCGACTCGAGAGCATGATGAAATCCTTGAGAGTTT; (ii) P36V{alpha}6_F: TCGACTCGAGAGCATGGAGTCATTCCTGGGAGG and (iii) p100V{alpha}8.6_F: TCGACTCGAGCCATGCTCCTGCTGCTCGTCC]. The PCR amplified cDNA encoding each of the 3 putative anti-JCV V{alpha}C{alpha} was subcloned into the XhoI/BamHI site, replacing the DNA encoding the Cß, in the cloning vector of MFG-Cß{zeta} to create V{alpha}C{alpha} {zeta} CIR (p36V{alpha}6{zeta}, p36V{alpha}12.2{zeta} and p100V{alpha}8.6{zeta}).

The cDNAs encoding the two dominant ß chains (p36Vß5.1 and p100Vß2) were amplified by PCR with specific primers and inserted into the XhoI/SwaI site of the vector MFG-Cß{zeta} to create VßCß{zeta} CIR (p36Vß5.1Cß{zeta} and p100Vß2.1Cß{zeta}). The two pairs of specific forward and reverse primers used to amplify the Vß of p36Vß5.1 and p100Vß2 coding regions by PCR were as follows: for the p36Vß5.1 (p36Vß5.1_F: TCGACTCGAGACCATGGGCTCCAGGCTGC and p36Vß5.1_R: AGTCCATTTAAATCCTCTAGCACGGTGAGCC); for the p100Vß2 (p100Vß2_F: TCGACTCGAGAGCATGCTGCTGCTTCTGCTGCT and p100Vß2_R: AGTCCATTTAAATCCTCTACAACTGTGAGTC). The start codon (ATG), XhoI site (CTCGAG) and SwaI site (ATTTAAAT) are underlined.

All vector inserts encoding CIRs were verified by DNA sequencing.

Vector-producer cell preparation
Phoenix cells (1:1 mixture of amphotropic and ecotropic) were transfected with 3 combinations of retroviral plasmids encoding possible pairs of putative functional anti-JCV TCR {alpha} and ß chains (i.e. p36V{alpha}6C{alpha}{zeta} + p36Vß5.1Cß{zeta}, p36V{alpha}12C{alpha}{zeta} + p36Vß5.1Cß{zeta} or p100V{alpha}C{alpha}{zeta} + p100Vß2Cß{zeta}) and retroviral plasmid encoding p36Vß5.1Cß{zeta} alone as single ß chain control. Viral supernatant of transfected Phoenix cells was used to infect helper PG13 cells to yield a Tctv vector producer cell (VPC) line. Infected PG13 cells were sorted first to enrich Vß-expressing cells by FACS sorting after staining with corresponding PE-labeled anti-Vß antibodies. The VPCs were re-infected with the same viral supernatant from Phoenix transfectants. The re-transduced PG13 cells were either directly subjected to FACS analysis for the CIR surface expression and peptide/A0201 tetramer-binding assay or further enriched for p36/A2 or p100/A2 tetramer-binding positive cells by FACS sorting for subsequent use as VPC for production of high titer retrovirus.

Cell transduction
Viral supernatant from PG13 VPCs was used to transduce Jurkat cells or primary human T cells (phTs) (PBMCs). The transduced Jurkat cells were later enriched for tetramer-binding cells by the same procedure as described for the PG13 cells (above).

Human PBMCs were activated with 50 ng/ml anti-CD3 antibodies (OKT3) in R-10 medium together with 360 IU/ml of recombinant human IL-2 (Chiron, Emeryville, CA, USA) for 2 days. The activated lymphocytes were then transduced with Tctv-p36{zeta} MFG retroviral vector using retronectin-coated plates as previously described (26), with modifications. Two runs of retroviral transduction were conducted in two consecutive days. Tissue-cultured 24-well plates were coated with recombinant retronectin (TaKaRa, Otsu, shiga Japan) at a concentration of 6 µg/cm2 overnight at 4°C, blocked with 2% FCS in PBS and washed once with PBS. The plates were then pre-coated with retrovirus by adding 1 ml of viral supernatant to each well. The plate was spun at 2500 RPM (1049 x g) in SORVALL RT-7 for 1 h at room temperature (R/T).

Post 2- to 3-day activated PBMCs (106) and 1 ml of prepared retroviral supernatant (containing 10 µg/ml protamine sulfate, 25 mM HEPES, and 36 IU/ml IL-2) were added to wells in the rectronectin-treated plate. The plates were spun at 2500 RPM for 1 h at R/T followed by incubation at 37°C 5% CO2 atmosphere for 4 h before removing 750 µl of viral supernatant from each well and replacing with 1 ml of R-10 medium containing 360 IU/ml IL-2 and 25 mM HEPES. Next day, a second transduction was conducted in the same plate under the same conditions for the first transduction except that 1 ml of media was removed from each well and replaced with 1 ml freshly prepared retroviral supernatant. The transduced cells were then maintained at cell density of approximately 0.5 x 106/ml in R-10 medium containing 360 IU/ml IL-2 and 25 mM HEPES. [In some instances, alternative but equivalent methods (26) were employed for supernatant production and modification of phTs.] These Tctv-p36{zeta}-transduced phT were used in tetramer-binding assays by FACS and cytokine secretion assays upon stimulation with JCV VP1 transduced melanoma cells.

Flow cytometry
Cells (2–5 x 105) were washed with R-10 medium and the cell pellets were re-suspended in 50 µl of R-10. Staining reagents (e.g., anti-TCR Vß antibodies, JCV peptide/A2 tetramer or pentamer) were added to the cell suspension for 20–30 min at R/T and then washed twice with PBS. The washed cell pellets were re-suspended in either PBS or PBS/2% paraformaldehyde before FACS on the same day. For experiments involving double staining with peptide/A2 tetramer or pentamer and anti-TCR Vß antibodies, the tetramer or pentamer was added to the cell samples 20 min before addition of anti-TCR Vß antibodies that were then incubated for another 20–30 min, without washing. FACS analysis was conducted with FACS Calibur or LSRII (Becton Dickinson, San Jose CA, USA). Only live cells were gated for the analysis.

Generation of JCV VP1-expressing cell line
An MFG-based polycistronic retroviral vector (MFG-IRES) was created by inserting an interual ribosome entry site (IRES) DNA sequence (derived from the pTandem-1 Vector, Novagen) into the MCS of MFG vector. The MFG-IRES vector was then used as a backbone to create a recombinant construct (VP1-IRES-GFP; VPIG) that consists of a cDNA encoding JCV VP1 protein of Mad-1 strain and a cDNA encoding an enhanced green fluorescent protein (GFP) (GenBank AN: AAB02572 [GenBank] ; Clontech) immediately upstream and downstream of the IRES by standard molecular cloning. The JCV VP1 cDNA in the plasmid termed ‘PABT4587 JCV VP1’ (7) was amplified by PCR and subcloned into the XhoI/NotI sites upstream of the IRES. A retroviral vector (IRES-GFP; IG), same as VPIG but without VP1 gene, was also constructed and used as negative control.

An HLA-A0201+ melanoma cell line (624.38, gift of M Dudley and S Rosenberg, Surgery Branch/NCI) was transduced with retroviral vectors encoding JC virus VP1 and GFP (VPIG) or GFP only (IG). The two resultant transduced melanoma cell lines, termed Mel38/VPIG (transduced with VPIG) and Mel38/IG (with IG), were selected to 90–98% GFP+ by cell sorting. The two cell lines were maintained in R-10 medium.

Cytokine secretion assays
Cytokine secretion assays were conducted by measuring IL-2 and IFN{gamma} concentrations in media harvested 24 h after co-culture of CIR-expressing Jurkat or phT with an HLA-A0201+ B-LCL or JCV VP1+ Mel38 cells as APC in the absence or presence of a variety of stimuli. B-LCLs (106) were treated with mitomycin C (27) and then incubated with untransduced or CIR-transduced Jurkat cells (106) in flat-bottom 24-well plates in total volume of 1 ml of R-10 medium containing 10 ng/ml of PMA with or without various concentrations of the relevant peptides (0.1, 1 and 10 µg/ml), anti-TCR Vß antibodies (1 µg/ml) plus protein A (100 ng/ml), or ionomycin (500 ng/ml) for 24 h. For phT, 106 untransduced or CIR-transduced phT were incubated with or without 2 x 105 of mitomycin C-treated Mel38/IG or Mel38/VPIG in wells of flat-bottom 24-well plates in total volume of 1 ml of R-10 medium with or without 2 µg/ml P36 peptide or plate-bound anti-OKT3 antibodies. (OKT3 was pre-coated to the wells by incubating 0.5 ml of 5 µg/ml in PBS overnight and then rinsing 3 times with PBS.) Supernatants from the cultures were harvested at 24 h and tested for IL-2 and IFN{gamma} concentrations using a human IL-2 ELISA kit (eBiosciences, San Diego CA, USA).

Cytotoxicity assays
For the killing assays, transduced T cells were first enriched by staining with p36/HLA-A2 or p100/HLA-A2 pentamers and then sorting on a FACS-Vantage instrument (BD). Sorted cells were then expanded in the presence of feeder cells of B-LCL with PHA (1 µg/ml). These enriched and expanded transduced T cells (90% modified) were used for cytotoxicity assays. The cytolytic activity of transduced human T lymphocytes was measured by 51Cr release assays as described previously (20). Peptide loading of B-LCL A0201 target cells was performed by adding VP1p36 or VP1p100 peptide at 10 µg/ml to the target cells 5–15 min prior to incubation with effector T lymphocytes at indicated ratios of effector to target cells. The incubation period of effector and target cells was 4 h. Percentage specific 51Cr release was calculated as follows: [(test counts – spontaneous counts)/(maximum counts – spontaneous counts)] x 100%.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
Generation of T cell lines enriched for T cells expressing anti-JCV TCRs
PBMCs were isolated from an HIV+ PML patient in recovery from PML after initiating HAART therapy. Cells were stimulated in vitro first with JCV peptide p36 and p100 individually, then with anti-CD3 antibodies and enriched twice using p36/A2 or p100/A2 tetramer-positive binding cells. Two cell lines were generated: Line p36, enriched for JCV VP1p36 specificity, and Line p100, for JCV VP1p100 specificity. The purity of each enriched JCV-specific CTL population was assessed by tetramer staining. T cells were double stained with p36 or p100/HLA-A0201 tetramer and a panel of anti-human TCRß chain antibodies and subjected to FACS analysis. The double-positive (p36 or p100/HLA-A0201 tetramer and the most common Vß) cells were sorted for molecular cloning of TCR{alpha}ß. Nearly all JCV VP1p36-HLA-A0201-reactive T cells were Vß5.1, indicating the limited diversity of TCR repertoire against this peptide (Fig. 1). In contrast, the most abundant Vß of the p100-reactive T cells, Vß2, accounted for less than one-third of the population (29%) (Fig. 1). Double-positive cells were collected by FACS-based sorting. Selection of T cells expressing the most abundant Vß among the p100/HLA-A0201 tetramer-binding cells for TCR cloning was thought to select the most favored JCV-specific TCRs for cloning. Due to the lack of availability of antibodies specific to subsets of human TCR V{alpha}, only anti-human TCR Vß antibodies were employed in the current study.

Molecular cloning of anti-JCV TCRs
cDNAs encoding TCR {alpha} and ß chains from the two enriched T cell populations with specificity to JCV p36 and p100 in the context of HLA-A0201 were amplified by PCR and cloned into TA cloning vector for subsequent DNA sequencing analysis. The cDNA sequences were subjected to analysis using the BLAST2 algorithm and the ImMunoGeneTics database (http://imgt.cines.fr:8104/) for V(D)J-C identification.

Clones for the p36-specific T cell line were examined. Among the 15 TCR {alpha} chain-related clones, 6 clones (40%) were identical with V{alpha}6J16 usage, while another 9 clones (60%) were identical with V{alpha}12.2J4 usage. In contrast, 22/22 cDNA clones (100%) for Vß were uniquely with Vß5.1J2 usage (the D usage was not clearly identified by this software) and with a type-2 constant region (C2).

From the p100-specific T cell line, 17/19 (90%) of clones encoding TCR {alpha} chain were identical with V{alpha}8.6J58 usage and 26/28 (93%) of clones encoding TCR ß chain were with Vß20.1J1.1 and a C1 constant region.

Hence, two dominant {alpha} chains (V6J16 and V12.2J4) and a unique clonal ß chain (V5.1J2) were cloned and identified from p36/HLA-A0201 selected T cells, while only one dominant {alpha} (V8.6J58) and one dominant ß (V20.1J1.1) chain were identified from p100/HLA-A0201 selected T cells. The usages of both the dominant TCR ß chains, Vß5.1 and Vß20.1, are consistent with the FACS data derived from specific anti-Vß staining for the T cell pools, from which the mRNAs were isolated. A summary of the TCR cloning results is shown in Table 1.

[It is important to address a discrepancy in nomenclature of Vß2 and Vß20.1 as determined by the specificity of the antibody used for FACS staining as specified by the provider (anti-human Vß2 antibody; clone MPB2D5; Coulter) versus its identification by ImMunoGeneTics database analysis (Vß20.1). Based on information provided by ImMunoGeneTics's website on Reagents monoclonal antibodies, anti-human TRBV (http://imgt.cines.fr/textes/IMGTrepertoire/Regulation/antibodies/human/TRB/TRBV/Hu_TRBVMab.html), anti-human Vß2 monoclonal antibody (clone MPB2D5) from Coulter specifically recognizes TCR Vß20 based on IMGT's nomenclature, while anti-human Vß20 (clone ELL1.4) reacts with TCR Vß30. Subsequent studies showed that this dominant p100-TCR ß chain was only recognized by anti-Vß2 antibody but not anti-Vß20 antibody (data not shown; also see below). For consistency, this particular TCR ß chain will henceforth be referenced as Vß2 based on its reactivity with the commercial antibody that is used throughout this study.]

Preparing TCRCIR constructs
In order to test the functional pairs of the TCR {alpha} and ß chains, chimeric TCRCIRs were created from DNA fragments encoding the dominant human TCR {alpha} and ß chains with putative specificity to JCV p36 and p100 (Table 1) in an MFG-based retroviral vector. The DNAs encoding the extracellular portion of TCRV{alpha}C{alpha} or VßCß were linked to the Tm and Cy of human CD3{zeta} to create V{alpha}C{alpha}{zeta} or VßCß{zeta} (Fig. 2). Five constructs were created.

Identification of functional pairs of native anti-JCV TCRs
Up to 30% of circulating human T cells may carry two TCR {alpha} chains of which only one is functionally reactive with peptide–MHC when paired with ß chain (28). We evaluated the TCR-binding activities to identify the functional pair of native anti-JCV TCRs derived from the p36 cell line and to confirm the functionality of sole pair of native anti-JCV TCR derived from the p100 cell line.

PG13 cells are derived from murine fibroblasts and are used to create VPC lines for retroviral production. The PG13 VPCs also serve as a cell model for identifying functional pairs of TCRs because transgene is expressed on the cell surface. PG13 cells were prepared with {alpha} and ß pairs of anti-JCV p36 or p100 TCR (two pairs for p36 and one pair for p100) to create three VPC lines.

Each of the two {alpha}/ß chain pairs for the p36TCRs of TCRV{alpha}C{alpha}{zeta} and TCRVßCß{zeta} was expressed on the PG13 cell surface as stained with anti-Vß5.1, but only the cells transduced by the combination of P36V{alpha}12 and P36Vß5.1 were able to bind p36/HLA-A2 tetramer (Fig. 3). As expected, the dominant {alpha}ß pair for the p100TCRs was functional by its ability to bind p36/HLA-A2 tetramer. Binding of JCV peptide/A0201 tetramer by the functional pairs of p36TCR (V{alpha}12 and Vß5.1) and p100TCR (V{alpha}8.6 and Vß2.1) was specific as no binding was observed with unrelated tetramer. Similar results were also obtained with APC-conjugated p36/A2 and APC-p100/A2 pentamer (data not shown). In subsequent studies involving FACS analysis for JCV VP1 pep–A2 complex binding of cells, we used either tetramer or pentamer form. Due to the lack of availability of anti-human TCR {alpha} chain antibodies for flow cytometry analysis, the surface expression of {alpha} chain-CIR was not independently determined.


Figure 3
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. Tetramer binding of anti-JCV CIRs of TCRV{alpha}C{alpha}{zeta} and TCRVßCß{zeta} on PG13 cells. PG13 cells were first transduced with retrovirus for each of three possible functional pairs of anti-JCV TCR {alpha} and ß chains. Cells were stained with FITC-conjugated anti-Vß5.1, or Vß2, or PE-conjugated JCV p36/A2 or p100/A2 tetramer followed by FACS analysis. Top row: cells transduced with p36 (V{alpha}12.2C{alpha}{zeta} and Vß5.1Cß{zeta}); middle row: cells transduced with p36 (V{alpha}6C{alpha}{zeta} and Vß5.1Cß{zeta}); bottom row: cells transduced with p100 (V{alpha}8.6C{alpha}{zeta} and Vß2Cß{zeta}). The number in each histogram indicates the percentage of cells that are positive to staining by anti-Vß antibody by tetramer based on an arbitrary cut-off.

 
Human T cell lines expressing CIRs produced cytokine upon antigen stimulation
Having demonstrated that the anti-JCV CIRs specifically bind to their cognate peptide/MHC tetramers, we investigated whether the chimeric TCRs were also functional in terms of triggering activation of T cells. Jurkat human T cells were transduced with a combination of retroviruses encoding V{alpha}C{alpha}{zeta} and VßCß{zeta} to create Tctv-TCRCIR. After sorting for relevant peptide/A2 pentamer-positive cells, 80% of the resultant p36{zeta}-Jurkat cells and 59% of the p100{zeta}-Jurkat cells specifically bound to p36/A2 and p100/A2 pentamer, respectively, by FACS analysis (data not shown). The p36{zeta}-Jurkat cells secreted IL-2 at 12 and 24% of maximal when incubated with HLA-A0201+ B-LCL in the presence of p36 peptide at 1 and 10 µg/ml, respectively, as compared with stimulation with PMA + ionomycin (100%), but not in the presence of unrelated p100 (Fig. 4). Similarly, Jurkat cells transduced with p100{zeta} produced IL-2 at 19 and 24% of maximal when incubated with HLA-A0201+ B-LCL in the presence of p100 peptide at 1 and 10 µg/ml, respectively, but not in the presence of unrelated p36 (Fig. 4). These results for secreted IL-2 were compared with stimulations of the transduced Jurkat T cells with specific anti-TCR Vß antibodies. Jurkat/p36{zeta} secreted IL-2 when stimulated with anti-Vß5.1 antibodies (29%) but not with anti-Vß2 antibody, and Jurkat/p100{zeta} secreted IL-2 with anti-Vß2 antibody (38%) but not with anti-Vß5.1 antibody. These results indicate that these two anti-JCV CIRs with distinct antigen specificity are functional in inducing T cell activation upon stimulation with cognate antigen as peptide–MHC complex on cellular targets.


Figure 4
View larger version (10K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. IL-2 secretion by Jurkat T cells expressing anti-JCV CIRs. Jurkat T cells transduced with each of the two functional pairs of anti-JCV CIRs (Tctv-p36{zeta}: V{alpha}12.2C{alpha}{zeta} + Vß5.1Cß{zeta}; Tctv-p100{zeta}: V{alpha}8.6C{alpha}{zeta} + Vß2Cß{zeta}) were sorted to 60–80% positivity by tetramer binding. Jurkat T cells (106 per well) were co-cultured with A2+ B-LCL (106 per well) in a 24-well plate in the presence of PMA (10 µg/ml) and each of various stimuli for 24 h and analysed for IL-2 production. Stimuli: JCV p36 or p100 peptide (0.1, 1 and 10 µg/ml), anti-TCR antibodies (anti-Vß5.1 antibody and anti-Vß2 antibody) (1 µg/ml) in the presence of protein A (100 ng/ml) to provide antibody cross-linking. IL-2 secretion by each cell line is expressed as percentage of maximum (100%) by PMA plus ionomycin: Tctv-p36{zeta} = 56.8 pg/ml and Tctv-p100{zeta} = 48.1 pg/ml.

 
Anti-JC virus CIRs are functionally expressed on phTs
To investigate the functionality of anti-JC virus CIRs on phTs, we examined Tctv-CIR-transduced activated human T cells for activity: peptide/MHC I binding and antigen-induced cytokine secretion and cytotoxicity.

Tetramer binding.
After two runs of Tctv-p36{zeta} retroviral transduction, 22% of T cells were shown to express CIR on cell surface based CIR on anti-Vß5.1 antibody staining by FACS (Fig. 5) after subtraction of background of endogenous untransduced T cells expressing Vß5.1 (4%). There were 13% of transduced T cells that were doubly stained with p36/A2 pentamer and anti-Vß5.1 antibodies (Fig. 5). The cells that are p36/A2 pentamer positive are inferred to co-express both {alpha} and ß chains of the Tctv-p36{zeta} CIR (i.e., Tctv-p36V{alpha}C{alpha}{zeta} and Tctv-p36VßCß{zeta}). The fact that some transduced T cells are Vß5.1 positive but p36/pentamer negative (22 – 13 = 9%) indicates that these T cells are only transduced with the ß chain CIR without co-transduction of the {alpha} chain CIR. In other phT transductions with p36 and p100 CIR, 15-60% of cells were pentamer positive (not shown).


Figure 5
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. FACS analysis of activated phT transduced with a functional pair of Tctv-p36{zeta} CIR (V{alpha}12.2C{alpha}{zeta} and Vß5.1Cß{zeta}). The phT were untransduced (NV) (A, C and E) or transduced two times with retroviral supernatant over two days (Tctv-p36{zeta}) (B, D and F). Three days after final transduction, cells were doubly stained with APC-conjugated p36/A2 pentamer plus FITC-conjugated anti-TCR Vß5.1 (A and B), or FITC-anti-CD4 (C and D) or FITC-anti-CD8 (E and F) before FACS analysis. The numbers indicate the percentage of cells in each quadrant.

 
We next investigated if co-expression of CD8 was essential to the tetramer binding on the transduced T cells. It was previously reported that CD8 was critical to stabilize this binding in other TCRs (2931) or TCRCIRs (32). In our case, transduced CD4 cells (Fig. 5F) bound tetramer in equal fraction as transduced CD8 (Fig. 5D) (12 versus 13%), confirming equal efficacy of infection across T cell subsets. Comparable intensities [mean fluorescence intensities (MFIs)] were observed (2192 versus 2758) between tetramer-bound CD8 (CD4 negative population) and CD4 cells based on analysis of cells in Fig. 5F, in which potential influence of anti-CD8 antibodies on tetramer binding was not an issue. We conclude that co-expression of CD8 is not important to the tetramer binding to our Tctv-p36{zeta}-transduced phTs.

IL-2 and IFN{gamma} release.
To confirm that the TCRCIR format was functional in normal human T cells as it was in Jurkat, we then tested cytokine secretion with the modified p36-specific phT in Fig. 5. For this test, T cells were stimulated with target cells expressing JCV VP1 protein from which p36 peptide is derived. VP1+ cell line, Mel38/VPIG and its negative control, VP1 negative Mel38/IG, were co-cultured with phT/Tctv-p36{zeta} or unmodified phT/NV, respectively. The secreted IL-2 and IFN{gamma} in the media harvested after 24-h co-culture were determined (Fig. 6). When stimulated with Mel38/VPIG and Mel38/VPIG plus p36 peptide, phT/Tctv-p36{zeta} secreted IL-2 at 26 and 43% of maximal, respectively, versus anti-CD3 antibody stimulation as positive control (100%), but less than 0.5% was detected when stimulated with Mel38/IG or when cultured in media alone. phT/NV secreted high levels of IL-2 with anti-CD3 antibody stimulation, but not with other stimuli tested. When stimulated with Mel38/VPIG in the absence or presence of 2 µg/ml p36 peptide, phT/Tctv-p36{zeta} secreted 30 and 59% of maximal IFN{gamma}, respectively, versus anti-CD3 antibody stimulation (100%). A low level of IFN{gamma} (10%) was secreted by the phT/Tctv-p36{zeta} when co-cultured with VP1-negative Mel38/IG target cells. phT/NV only secreted IFN{gamma} with anti-CD3 antibody stimulation but not with other stimuli tested. (p100 CIR phTs were not similarly tested.)


Figure 6
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. Production of IL-2 and IFN{gamma} by phTs transduced with anti-JCV Tctv-p36{zeta} CIR. phTs were transduced twice with Tctv-p36{zeta} (13% modified). Untransduced T cells (NV) were included in this assay as negative control. phTs (day 5 after final transduction) as shown in Fig. 5 were cultured for 24 h in the absence (–) or presence of various stimuli [Mel/IG, Mel/VPIG and Mel38/IG plus 2 µg/ml p36 peptide, plate-bound anti-CD3 (OKT3)]. The co-cultured media was collected for detection of IL-2 (upper panel) and IFN{gamma} (lower panel) by ELISA. Cytokine release by each cell population is expressed as percentage of maximum by immobilized anti-CD3 antibody. Hundred percent of IL-2: phT/NV = 16.1 ng/ml and phT/Tctv = 11.8 ng/ml; 100% of INF{gamma}: phT/NV = 77.7 ng/ml and phT/Tctv = 24.7 ng/ml.

 
Cytotoxicity assay.
We finally tested for cytolytic activity of phTs transduced with functional Tctv-p36{zeta} and Tctv-p100{zeta}. HLA-A0201+ B-LCL cells loaded with cognate peptide of the two anti-JCV CIRs were used as target cells. The transduced phTs enriched for p36/HLA-A2 or p100/HLA-A2 specifically lysed target cells loaded with their cognate peptide VP1p36 or VP1p100 in the 51Cr release assay (Fig. 7). More than 85% killing was observed in 4 h when T cells expressing Tctv-p36{zeta} or Tctv-p100{zeta} were incubated with target cells loaded with cognate peptide at effector-to-target (E/T) ratio of 60:1. Even at the lowest ratio of 7.5:1, 35–55% of target cells were killed. These transduced T cells did not kill target cells unloaded with peptide or loaded with irrelevant peptide (≤12% specific 51Cr release).


Figure 7
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7. Killing of target cells by phTs transduced with anti-JCV Tctv-p36{zeta} or Tctv-p36{zeta} CIR. phTs that were transduced with anti-JCV Tctv-p36{zeta} or Tctv-p36{zeta} CIR, sorted for pentamer binding and expanded with feeder cells were tested for their cytotoxicity activity. The target cells used in this assay were HLA-A0201+ B-LCL cells loaded with VP1 p36 or p100 peptide at 10 µg/ml or untreated with medium alone. E/T ratios were as shown. Killing of target cells is represented by percentages of specific 51Cr release.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
T cells genetically modified to express CIRs of desired antigen specificity (designer T cells) are a promising strategy for immunotherapy for cancer and infectious diseases (13, 14, 23). PML is a deadly brain disease caused by reactivation of JC virus in immune-depressed individuals, particularly in HIV+ subjects (1). Currently, there is no effective therapy for this disease, with the sole option being to reverse immunodepression (5). Even with HAART, half of PML patients die within 1 year after diagnosis (reviewed by Roberts) (33).

CTLs that recognize two HLA-A0201-restricted CTL epitopes, p36 and p100, derived from JC virus capsid protein VP1 are present in HLA A0201+ PML patients who survive more than 1 year, but not in HLA A0201+ patients with progressive disease who have a rapidly fatal outcome (8, 10, 11). Furthermore, JCV VP1p36- or VP1p100-specific CTL was detected in the cerebrospinal fluid of 44% of patients with an inactive form of PML. These results indicate that JCV VP1-specific CTL can cross the blood–brain barrier and suggest that control of PML is not achieved by mere containment of JCV in the peripheral blood but also by lysis of JCV-infected oligodendrocytes in the white matter of the CNS (34). Such an immune response could be also detected in 73% of healthy individuals, suggesting the CTLs specific to JCV may play an important role in preventing the development of PML in immunosuppressed individuals (12).

Whereas the primary defect in AIDS is the deficiency in CD4 T cell number and function, CD8 T cells typically are ample. Antigen-specific CD4 T cells are important in dendritic cell activation that in turn select and activate CD8+ cells into becoming antigen-specific CTLs with cytotoxic effector functions (35). CD4 cells also produce cytokines such as IL-2 that support CD8 T cell proliferation. To the extent that these CD4 functions can be substituted by gene therapy-conferred specificities and by ex vivo activation and in vivo cytokine support, the designer T cell strategy may have potential as an effective alternative therapy for PML in the absence of a functional CD4 subset. Cloning of TCRs with specificity to JC virus and engineering functional CIRs are prerequisites for preparing anti-JC virus designer T cells.

In the present study, we first generated two CTL cell populations from an HIV+ PML patient with specificity to the dominant p36 and p100 CTL epitopes derived from JC virus in the context of HLA-A2. This was accomplished by in vitro antigen stimulation and enrichment for antigen-specific TCRs and cell sorting. From the p100 CTL line, a unique TCR{alpha} and TCRß were cloned, and these were confirmed for functional binding. From the p36 specific line, however, two dominant {alpha} chains were cloned but only one ß chain. In this case, only one {alpha} chain was functional when paired with the unique ß chain. The fact that the cell population used for TCR cloning was sorted for p36/A2 tetramer-binding positive cells and nearly the same percentages of these two TCR {alpha} chains were cloned (Table 1) suggests that both {alpha} chains expressed concurrently at the single-cell level. It has previously been reported that up to 30% of human peripheral T cells express dual {alpha} chains of which only one is functional, when paired with ß chain (28).

Particular advantages are conferred by the TCR{zeta} CIR format. CD3{zeta} is considered the limiting chain for assembly and cell surface expression of the TCR–CD3 complex, in which the polymorphic TCR {alpha}ß chains associate with invariant chains (CD3{gamma}, CD3{delta}, CD3{epsilon} and CD3{zeta}) (36, 37). In contrast to native foreign TCR{alpha}ß expressed in recipient T cells, the TCR{zeta} type CIRs bypass the limitation on surface expression by not having to compete with endogenous TCR{alpha}ß for CD3{zeta} to form TCR–CD3 complex. This notion is compatible with our findings of substantially higher surface expression (MFI) of TCR{zeta} CIRs compared with native TCR on transduced phTs (based on anti-Vß5.1 antibody staining; Fig. 5A and B).

In addition, TCR{zeta} CIR avoids the problem of pairing of introduced TCR{alpha}/ß of native form with endogenous {alpha} and ß chains that will result in the dilution of the desired {alpha} pair. TCRCIR also avoids assembly of new TCR{alpha}/ß heterodimers between endogenous and introduced TCRs that could theoretically result in unknown and possibly dangerous specificities without the benefit of thymic editing. The design of Tctv-TCR{zeta} CIRs precludes such illegitimate pairing to result in exclusively native pairing between the introduced TCR {alpha} and ß chains (20).

Although ß chain in TCRCIR format can express solo on cell surfaces (data not shown), it was noted that all transduced phTs that co-express {alpha} chain (as evidenced by tetramer binding) also express higher levels of the ß chain (Fig. 5B). A similar observation of high expression in human T cells when co-transduced with a different Tctv-TCR{zeta}-based CIR specific to a melanoma antigen was previously reported by one of the authors (20). It is speculated that co-transduction of the {alpha} chain of the Tctv-p36{zeta} CIR may enhance the stability of surface expressed ß TCR{zeta} CIR in human T cells to result in the higher net expression of ß.

In addition, we found that co-expression of CD8 did not enhance the tetramer binding to our Tctv-p36{zeta}-transduced phTs as measured by FACS (comparing CD4 and CD8 T cells; Fig. 5). When TCRs bind to cognate peptide–class I MHC, the CD8 co-receptor binds non-selectively to constant region of the MHC to stabilize the specific interaction. However, there are instances in which TCRs do not require CD8 binding that correlate with high native affinities of the TCRs for peptide–MHC that compensates for the lack of CD8 engagement (23, 31, 38). One of the co-authors has reported that binding by a TCR{alpha}ß in a TCR{zeta} chimeric format to its cognate melanoma peptide–MHC complex is CD8 dependent (32), while another TCR{alpha}ß in native form specific to a different melanoma antigen is not (39). Our finding suggests that our Tctv-p36{zeta}-based TCR{alpha}ß possesses a high affinity for cognate peptide–MHC complex. Given that TCR{zeta} chimeras have either shown CD8 dependence (32) or CD8 independence (our case), it is likely that the topological effects contributed by the CIR format are not determining for the stability of the MHC–peptide-binding reaction. The same analysis was not performed for the p100 TCRCIR, but the fact that PG13 non-T cells that have no CD8 could express p100 TCRCIR and be detected for tetramer binding is compatible with this in vivo highly selected TCR also being of high affinity.

Finally, we demonstrate that phTs that were transduced with anti-JCV Tctv-p36{zeta} or Tctv-p100{zeta} could specifically lyse HLA-matched target cells presenting cognate peptide antigen (Fig. 7), a key hallmark of CIR designer T cells for cellular immunotherapy.

To date, most work on designer T cells has been focused on cancer (15). This effort extends this technology to an additional application in infectious diseases. This work shows the successful creation of TCRCIRs with specificity to JC viral antigens. When expressed in recipient human T cells, these TCRCIRs are shown to be functional in terms of redirecting phTs to recognize target cells presenting JCV antigens and to perform activation and signaling with cytokine production as well as cytotoxic activity. Products such as these may have clinical value in an immunotherapy strategy for PML.


    Funding
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 
PHS (R01AI060550 to R.P.J.; R01NS/AI041198, NS047029 and P30AI60354 to I.J.K.); Harvard Center for Regeneration and Repair (R.P.J. and I.J.K.); Harvard Medical School Center for AIDS Research (CFAR) (I.J.K.) and Ellen R Cavallo Research Fund (I.J.K.).


    Acknowledgements
 
We thank Dr. Nicola Kouttab of Roger Williams Medical Center (RWMC) for his generous support and for providing access to the RWMC FACS facility.


    Abbreviations
 
AIDS, acquired immunodeficiency syndrome
B-LCL, B-lymphoblastoid line
CIR, chimeric immune receptor
Cy, cytoplasmic domain
GFP, green fluorescent protein
HAART, highly active antiretroviral therapy
JCV, polyomavirus JC
MFI, mean fluorescence intensity
phT, primary human T cells
PML, progressive multifocal leukoencephalopathy
R/T, room temperature
RWMC, Roger Williams Medical Center
TCRCIR, TCR-based CIR
IRES, internal ribosome entry site
E/T, effector-ta-target
Tm, transmembrane domain
VPC, vector-producing cell
Tctv, two-chain two-vector
MCS, multi-cloning site

    Notes
 
Transmitting editor: G. Trinchieri

Received 22 December 2006, accepted 14 June 2007.


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 Funding
 References
 

  1. Padgett BL, Walker DL, ZuRhein GM, Eckroade RJ, Dessel BH. Cultivation of papova-like virus from human brain with progressive multifocal leucoencephalopathy. Lancet. (1971) 1:1257.[Web of Science][Medline]
  2. Weber T, Trebst C, Frye S, et al. Analysis of the systemic and intrathecal humoral immune response in progressive multifocal leukoencephalopathy. J. Infect. Dis. (1997) 176:250.[Web of Science][Medline]
  3. Tantisiriwat W, Tebas P, Clifford DB, Powderly WG, Fichtenbaum CJ. Progressive multifocal leukoencephalopathy in patients with AIDS receiving highly active antiretroviral therapy. Clin. Infect. Dis. (1999) 28:1152.[Web of Science][Medline]
  4. Berger JR, Koralnik IJ. Progressive multifocal leukoencephalopathy and natalizumab—unforeseen consequences. N. Engl. J. Med. (2005) 353:414.[Free Full Text]
  5. Koralnik IJ. Progressive multifocal leukoencephalopathy revisited: has the disease outgrown its name? Ann. Neurol. (2006) 60:162.[CrossRef][Web of Science][Medline]
  6. Du Pasquier RA, Clark KW, Smith PS, et al. JCV-specific cellular immune response correlates with a favorable clinical outcome in HIV-infected individuals with progressive multifocal leukoencephalopathy. J. Neurovirol. (2001) 7:318.[CrossRef][Web of Science][Medline]
  7. Koralnik IJ, Du Pasquier RA, Letvin NL. JC virus-specific cytotoxic T lymphocytes in individuals with progressive multifocal leukoencephalopathy. J. Virol. (2001) 75:3483.[Abstract/Free Full Text]
  8. Koralnik IJ, Du Pasquier RA, Kuroda MJ, et al. Association of prolonged survival in HLA-A2+ progressive multifocal leukoencephalopathy patients with a CTL response specific for a commonly recognized JC virus epitope. J. Immunol. (2002) 168:499.[Abstract/Free Full Text]
  9. Krausa P, Brywka M 3rd, Savage D, et al. Genetic polymorphism within HLA-A*02: significant allelic variation revealed in different populations. Tissue Antigens. (1995) 45:223.[Web of Science][Medline]
  10. Du Pasquier RA, Kuroda MJ, Schmitz JE, et al. Low frequency of cytotoxic T lymphocytes against the novel HLA-A*0201-restricted JC virus epitope VP1(p36) in patients with proven or possible progressive multifocal leukoencephalopathy. J. Virol. (2003) 77:11918.[Abstract/Free Full Text]
  11. Du Pasquier RA, Kuroda MJ, Zheng Y, Jean-Jacques J, Letvin NL, Koralnik. I.J. 2004. A prospective study demonstrates an association between JC virus-specific cytotoxic T lymphocytes and the early control of progressive multifocal leukoencephalopathy. Brain. (1970) 127.
  12. Du Pasquier RA, Schmitz JE, Jean-Jacques J, et al. Detection of JC virus-specific cytotoxic T lymphocytes in healthy individuals. J. Virol. (2004) 78:10206.[Abstract/Free Full Text]
  13. Papadopoulos EB, Ladanyi M, Emanuel D, et al. Infusions of donor leukocytes to treat Epstein-Barr virus-associated lymphoproliferative disorders after allogeneic bone marrow transplantation. N. Engl. J. Med. (1994) 330:1185.[Abstract/Free Full Text]
  14. Walter EA, Greenberg PD, Gilbert MJ, et al. Reconstitution of cellular immunity against cytomegalovirus in recipients of allogeneic bone marrow by transfer of T-cell clones from the donor. N. Engl. J. Med. (1995) 333:1038.[Abstract/Free Full Text]
  15. Ma Q, Gonzalo-Daganzo RM, Junghans RP. Genetically engineered T cells as adoptive immunotherapy of cancer. Cancer Chemother. Biol. Response Modif. (2002) 20:315.[Medline]
  16. Cooper LJ, Kalos M, Lewinsohn DA, Riddell SR, Greenberg PD. Transfer of specificity for human immunodeficiency virus type 1 into primary human T lymphocytes by introduction of T-cell receptor genes. J. Virol. (2000) 74:8207.[Abstract/Free Full Text]
  17. Ueno T, Fujiwara M, Tomiyama H, Onodera M, Takiguchi M. Reconstitution of anti-HIV effector functions of primary human CD8 T lymphocytes by transfer of HIV-specific alphabeta TCR genes. Eur. J. Immunol. (2004) 34:3379.[CrossRef][Web of Science][Medline]
  18. Orentas RJ, Roskopf SJ, Nolan GP, Nishimura MI. Retroviral transduction of a T cell receptor specific for an Epstein-Barr virus-encoded peptide. Clin. Immunol. (2001) 98:220.[CrossRef][Web of Science][Medline]
  19. Schaft N, Lankiewicz B, Drexhage J, et al. T cell re-targeting to EBV antigens following TCR gene transfer: CD28-containing receptors mediate enhanced antigen-specific IFNgamma production. Int. Immunol. (2006) 18:591.[Abstract/Free Full Text]
  20. Willemsen RA, Weijtens ME, Ronteltap C, et al. Grafting primary human T lymphocytes with cancer-specific chimeric single chain and two chain TCR. Gene Ther. (2000) 7:1369.[CrossRef][Web of Science][Medline]
  21. Willemsen RA, Debets R, Hart E, Hoogenboom HR, Bolhuis RL, Chames P. A phage display selected fab fragment with MHC class I-restricted specificity for MAGE-A1 allows for retargeting of primary human T lymphocytes. Gene Ther. (2001) 8:1601.[CrossRef][Web of Science][Medline]
  22. Clay TM, Custer MC, Sachs J, Hwu P, Rosenberg SA, Nishimura MI. Efficient transfer of a tumor antigen-reactive TCR to human peripheral blood lymphocytes confers anti-tumor reactivity. J. Immunol. (1999) 163:507.[Abstract/Free Full Text]
  23. Morgan RA, Dudley ME, Wunderlich JR, et al. Cancer regression in patients after transfer of genetically engineered lymphocytes. Science. (2006) 314:126.[Abstract/Free Full Text]
  24. Morgan RA, Dudley ME, Yu YY, et al. High efficiency TCR gene transfer into primary human lymphocytes affords avid recognition of melanoma tumor antigen glycoprotein 100 and does not alter the recognition of autologous melanoma antigens. J. Immunol. (2003) 171:3287.[Abstract/Free Full Text]
  25. Schaft N, Willemsen RA, de Vries J, et al. Peptide fine specificity of anti-glycoprotein 100 CTL is preserved following transfer of engineered TCR alpha beta genes into primary human T lymphocytes. J. Immunol. (2003) 170:2186.[Abstract/Free Full Text]
  26. Lamers CH, Willemsen RA, Luider BA, Debets R, Bolhuis RL. Protocol for gene transduction and expansion of human T lymphocytes for clinical immunogene therapy of cancer. Cancer Gene Ther. (2002) 9:613.[CrossRef][Web of Science][Medline]
  27. Yang W, Grey HM. Study of the mechanism of TCR antagonism using dual-TCR-expressing T cells. J. Immunol. (2003) 170:4532.[Abstract/Free Full Text]
  28. Padovan E, Casorati G, Dellabona P, Meyer S, Brockhaus M, Lanzavecchia A. Expression of two T cell receptor alpha chains: dual receptor T cells. Science. (1993) 262:422.[Abstract/Free Full Text]
  29. Daniels MA, Jameson SC. Critical role for CD8 in T cell receptor binding and activation by peptide/major histocompatibility complex multimers. J. Exp. Med. (2000) 191:335.[Abstract/Free Full Text]
  30. Garcia KC, Scott CA, Brunmark A, et al. CD8 enhances formation of stable T-cell receptor/MHC class I molecule complexes. Nature. (1996) 384:577.[CrossRef][Medline]
  31. Kerry SE, Buslepp J, Cramer LA, et al. Interplay between TCR affinity and necessity of coreceptor ligation: high-affinity peptide-MHC/TCR interaction overcomes lack of CD8 engagement. J. Immunol. (2003) 171:4493.[Abstract/Free Full Text]
  32. Willemsen R, Ronteltap C, Heuveling M, Debets R, Bolhuis R. Redirecting human CD4+ T lymphocytes to the MHC class I-restricted melanoma antigen MAGE-A1 by TCR alphabeta gene transfer requires CD8alpha. Gene Ther. (2005) 12:140.[CrossRef][Web of Science][Medline]
  33. Roberts MT. AIDS-associated progressive multifocal leukoencephalopathy: current management strategies. CNS Drugs. (2005) 19:671.[CrossRef][Web of Science][Medline]
  34. Du Pasquier RA, Autissier P, Zheng Y, Jean-Jacques J, Koralnik IJ. Presence of JC virus-specific CTL in the cerebrospinal fluid of PML patients: rationale for immune-based therapeutic strategies. Aids. (2005) 19:2069.[Web of Science][Medline]
  35. O'Sullivan B, Thomas R. CD40 and dendritic cell function. Crit. Rev. Immunol. (2003) 23:83.[CrossRef][Web of Science][Medline]
  36. Sussman JJ, Bonifacino JS, Lippincott-Schwartz J, et al. Failure to synthesize the T cell CD3-zeta chain: structure and function of a partial T cell receptor complex. Cell. (1988) 52:85.[CrossRef][Web of Science][Medline]
  37. Klausner RD, Lippincott-Schwartz J, Bonifacino JS. The T cell antigen receptor: insights into organelle biology. Annu. Rev. Cell Biol. (1990) 6:403.[CrossRef][Web of Science][Medline]
  38. Choi EM, Chen JL, Wooldridge L, et al. High avidity antigen-specific CTL identified by CD8-independent tetramer staining. J. Immunol. (2003) 171:5116.[Abstract/Free Full Text]
  39. Willemsen RA, Sebestyen Z, Ronteltap C, Berrevoets C, Drexhage J, Debets R. CD8 alpha coreceptor to improve TCR gene transfer to treat melanoma: down-regulation of tumor-specific production of IL-4, IL-5, and IL-10. J. Immunol. (2006) 177:991.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/9/1083    most recent
dxm076v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Yang, W
Right arrow Articles by Junghans, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, W
Right arrow Articles by Junghans, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?