International Immunology Advance Access published online on May 13, 2007
International Immunology, doi:10.1093/intimm/dxm048
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Suppression of B lymphopoiesis at a lymphoid progenitor stage in adult rabbits
1 Department of Microbiology and Immunology
2 Department of Cell Biology, Neurobiology and Anatomy, Stritch School of Medicine, Loyola University Chicago, 2160 South First Avenue, Maywood, IL 60153, USA
Correspondence to: Correspondence to: K. L. Knight; E-mail: kknight{at}lumc.edu
| Abstract |
|---|
|
|
|---|
B lymphopoiesis in rabbits is robust early in ontogeny, but is arrested by 16 weeks of age at which time no proB or preB cells are found in bone marrow (BM). To determine if BM cells from adults retain B lymphopoietic potential, we transferred BM from adult green fluorescent protein (gfp) transgenic rabbits into young rabbits. We found gfp+ preB cells arising in the young recipients, indicating that BM cells from adults can differentiate into B cell precursors. We identified a population of MHCIIIL-7-binding BM cells in adults that collectively expresses Tdt, EBF and Pax5genes known to be expressed in murine lymphoid progenitors. Upon co-culture with OP9 or OP9 delta-like 1+ stromal cells, we found that these cells both expanded in number and differentiated into B and T cell precursors, respectively, showing that early lymphoid progenitors, designated rLP for rabbit lymphoid progenitors, are present within the MHCIIIL-7-binding BM cell population. Further, IL-7 was required for rLPs to expand and differentiate into B cell precursors in vitro. The arrest of B lymphopoiesis in adults, however, is not likely due to the absence of IL-7, because the level of IL-7 transcripts was higher in BM from adults than in young rabbits. B lymphopoiesis was re-initiated in adults after sub-lethal irradiation as shown by the reappearance of B cell precursors and the presence of B cell receptor excision circles in BM. We conclude that B lymphopoiesis in adults is suppressed at a lymphoid progenitor stage (MHCIIIL-7 binding) of development.
Keywords: B cell development, IL-7
| Introduction |
|---|
|
|
|---|
B cells are continuously made in the bone marrow (BM) throughout life in humans (1) and mice (2), but in some species, including chicken, sheep and rabbit, B cells are produced only during gestation (3, 4) or for a short period of time after birth (5). In chicken and sheep, B cell precursors are produced in the avian yolk sac (3) or the fetal spleen (6), respectively. In rabbit, B lymphopoiesis takes place in the fetal liver and the neonatal BM (7). All three species utilize gut-associated lymphoid tissues (GALT) to expand and somatically diversify the limited pool of B cells made during fetal and neonatal development (8). The specialized GALT include the bursa in chickens, ileal Peyer's patches in sheep and appendix, sacculus rotundus and Peyer's patches in rabbits (8). GALT involute during puberty in chicken and sheep (9, 10); however, they do not involute in adult rabbits (11), but instead become secondary lymphoid tissues (12).
In previous studies, based on the status of Ig gene rearrangements, the expression of the B cell signaling molecule CD79a and MHC class II, and the expression of cytoplasmic and surface IgM, we identified three stages of B cell development in rabbit: proB (MHCII+CD79a+cytoIgMsurfaceIgM), preB (MHCII+CD79a+cytoIgM+surfaceIgM) and B cells (MHCII+CD79a+surfaceIgM+) (5). We found that by 4 months of age, virtually all proB and preB cells are absent in rabbit BM and the only CD79a+ B lineage cells present are diversified, recirculating B cells (5, 13). Therefore, the arrest of B lymphopoiesis in adults must take place at an as yet undefined stage prior to the proB cell stage.
Murine B lymphopoiesis encompasses many developmental stages that are distinguished by multiple cell-surface markers as well as a dependence on the cytokine IL-7 for growth, survival and differentiation (1417). The earliest stages of B lymphopoiesis, including the early lymphoid progenitor (ELP) (18) and common lymphoid progenitor (CLP) (19), exhibit biased potential for B, T and NK cell lineages. Murine ELPs and CLPs do not yet express lineage-specific markers, but they begin to express the lymphoid-specific high-affinity IL-7R, composed of the IL-7R
chain (20) and common
chain (21). IL-7R signaling has been shown to play an important role in maintaining the ability of CLPs to differentiate into B cell precursors by modulating the levels of the B lineage-specific transcription factor Early B Cell Factor (EBF) (22, 23). Further, IL-7RA/ and IL-7/ mice exhibit a complete block of B cell development in adulthood, but can produce B cells in utero and for a limited time after birth: 4 and 7 weeks, respectively (24, 25). In contrast, IL-7 signaling likely augments B lymphopoiesis in humans, but it is not required (2628).
In this study, we tested if BM cells in adult rabbits possess B lymphopoietic potential, if IL-7 is important for rabbit B cell development and if the arrest of B lymphopoiesis is reversible.
| Methods |
|---|
|
|
|---|
Rabbits
Rabbits were from the colony maintained by K.L.K. at Loyola University Chicago. The studies were approved by the Institutional Animal Care and Use Committee of Loyola University Chicago. The green fluorescent protein (gfp) transgenic rabbits were generated by microinjection of zygotes with a 1.6 kb cytomegalovirus (CMV)-driven gfp gene fragment derived from AseI/AflII-digested pEGFP-N1 (Clontech, Palo Alto, CA, USA) vector (29). Offspring were screened with a hand-held UV lamp. One male gfp transgenic founder was mated to develop a colony of gfp transgenic rabbits. The gfp transgene does not adversely affect B cell development in newborns, nor does it affect the timing of the arrest of B lymphopoiesis in adults.
BM transfer
BM was harvested from the femur and tibia of gfp+/ adult donors and 1 x 1082 x 108 total BM cells in
3.5 ml PBS were administered intravenously into the marginal ear vein of 5- to 9-week old recipients exposed to a near lethal dosage of
-irradiation (800900 rad) delivered by a 137Cs source in a Gammacell 40 (Nordion, Ottawa, Ontario, Canada). To determine in which recipients the BM had engrafted, PCR was performed on peripheral blood DNA (30) for the gfp transgene using as 5' primer, OS GFPin (5'-CACAAGCTGGAGTACAACTACAA-3') and 3' primer, OA GFPin (5'-CTCCAGCAGGACCATGTGAT-3') (IDT, Coralville, IA, USA). The gfp transgene was amplified from single cell or pooled preB cells with two rounds of amplification, using as 5' primer, OS GFPout (5'-ACCCTGGTGAACCGCATC-3') and 3' primer, OA GFPout (5'-GTCGCGGCCGCTTTACTTGTA-3') in the first round and OS GFPin and OA GFPin in the second round. Primers for VDJH rearrangements, VJL rearrangements and GAPDH were as described previously (5).
Antibodies and flow cytometry
PreB cells, MHCIIIL-7-binding cells, MHCIInon-IL-7-binding cells and double-positive (DP) thymocytes were isolated using a FACS-Star Plus CellSorter or a FACSAria CellSorter (BD Biosciences, San Jose, CA, USA) and a lymphocyte-sized forward-scatter (FSC) versus side-scatter (SSC) gate. PreB cells were obtained from freshly isolated BM cells that were treated with 0.85% NH4Cl to lyse RBCs and stained with FITC-conjugated goat anti-rabbit light chain, and after permeabilization with Cyofix/Cytoperm (BD Biosciences), stained with biotinylated (Bio) mouse anti-rabbit IgM (clone 367) (31) and PE-conjugated CD79a (BD Biosciences), followed by streptavidin (SAv)allophycoerythrin (Molecular Probes, Eugene, OR, USA). MHCIIIL-7-binding cells and MHCIInon-IL-7-binding BM cells were obtained after incubation with Bio rabbit IL-7 (rIL-7) at 2.5 ng ml1, followed by SAvPE and FITC-conjugated mouse anti-rabbit MHCII (clone 2C4) (32). DP thymocytes were identified from freshly isolated thymus after staining with mouse IgG2a anti-rabbit CD4 (BD Biosciences) and mouse IgG1 anti-rabbit CD8 (Serotec, Oxford, UK), followed by FITC-conjugated goat anti-mouse IgG2a (Southern Biotech, Birmingham, AL, USA) and PE-conjugated goat anti-mouse IgG1 (Southern Biotech). T cell precursors were identified using anti-CD3 (Spring Valley, Woodbine, MD, USA) followed by FITC-conjugated goat anti-mouse IgG (Southern Biotech). Analysis by flow cytometry was performed using a FACSCalibur and FACSCanto flow cytometer (BD Biosciences); only cells that fell within a lymphocyte FSC versus SSC gate were analyzed. Dead cells were gated-out by using propidium iodide staining.
OP9 co-cultures
OP9 GFP or OP9 delta-like 1+ (DL1) stromal cells (33), kindly provided by Juan Carlos Zúñiga-Pflücker (University of Toronto, Toronto, Ontario, Canada), were seeded in TC48- or TC96-well plates at 5 x 103 cells per well or 3 x 103 cells per well in
-MEM medium (GIBCO-BRL, Grand Island, NY, USA) supplemented with 20% FCS and rIL-7 at 25 ng ml1, unless otherwise indicated. MHCII, MHCIIIL-7-binding or MHCIIIL-7-non-binding BM cells (500020 000 per well) were sorted directly into OP9-containing wells. Cell growth was observed weekly and cells were fed one to two times per week.
Cloning and purification of rIL-7
IL-7 was cloned from BM by 3' rapid amplification of cDNA ends (RACE) as described (34), using as 5' primer, OS rIL-7in (5'-CTGTTGCCAGTGACATCATCT-3') or control 5' primer, RT2 GAPDH (5'-CATCACTGCCACCCAGAAGA-3') and as 3' primer, RACE0 (5'-CCAGTGAGCAGAGTGACG-3'). IL-7 transcripts were cloned into pGEMT (Promega, Madison, WI, USA) and sequenced. The IL-7 open reading frame (ORF) minus the proposed signal sequence was then cloned into the pET24b vector (Novagen, Madison, WI, USA) using as 5' primer, OS IL-7 SacI-noLDR (5'-GAGCTCCAATTGTGATATTGAGAAAATTAA-3') and as 3' primer, OA IL-7t XhoI (5'-CTCGAGGTTTTCTTTAATGCCCCTCAA-3'), underlined bps indicate restriction sites. Recombinant rIL-7 was generated in Escherichia coli BL21
DE3 cells (Invitrogen, Carlsbad, CA, USA). Briefly, rIL-7 was purified from the insoluble fraction with 5 M guanidineHCl containing 4 M imidazole using a Ni2+-NTA agarose column (Qiagen, Valencia, CA, USA). rIL-7 was dialyzed against refolding buffer (0.05 M glycine, 0.03 M NaOH, 0.4 M L-arginine, 1 mM dithiothreitol, pH 10.0) for 24 h at 4°C, followed by dialysis in PBS at 4°C as described (chemicals purchased from Sigma, St Louis, MO, USA) (35). Protein concentration was determined by Bradford assay (Bio-Rad, Hercules, CA, USA) and 0.5 mg of rIL-7 was biotinylated using NHS-LC-biotin (Pierce Chemicals, Rockford, IL, USA).
rIL-7 activity
The IL-7-dependent murine proB cell line YSBPB (a gift from Barbara Kee at University of Chicago, Chicago, IL, USA) was plated at 100 cells per well in a 96-well plate in OPTI-MEM (GIBCO-BRL) supplemented with 7% FCS, 2 x 105 M 2-mercaptoethanol and 1x penicillin/streptomycin/glutamine. Cells were cultured without IL-7, in the presence of a 1:50 dilution of murine IL-7 (mIL-7) supernatant (provided by B. Kee) or in the presence of rIL-7 (25 ng ml1). Cells were fed on day 3 and live cell counts were taken on day 6 using trypan blue exclusion.
Northern blot analysis
Total BM RNA was isolated from young and adult rabbits either by CsCl density centrifugation or TRIzol extraction (Invitrogen). Fifteen micrograms of RNA for each sample was resolved by electrophoresis on a 1% denaturing gel, transferred to nitrocellulose and probed for IL-7 transcripts using a 32P-labeled 500 bp probe corresponding to the ORF of rIL-7. The northern blot was exposed by phosphor screen imaging on a Typhoon 8600 Variable Mode Imager (Pharmacia, New York, NY, USA). The blot was then stripped and re-probed for GAPDH transcripts using a 32P-labeled GAPDH probe.
PCR for VDH, DJH and DJß recombination signal joints
Isolation of genomic DNA and closed circular DNA from BM cells was performed as described previously (13). VDH primers and PCR conditions were as described previously (13); DJß T cell receptor excision circles (TRECs) were amplified using as 5' primer, OS Jß2.1 (5'GGAGCACCCTCTAACTGTGCTA3') and as 3' primer, OA 1Dß2 (5'GCTCCTGCAAGACCACAGTAAGCA3').
Reverse transcriptionPCR for IL7-RA, EBF, Pax5 and gylceraldehyde-3-phosphate dehydrogenase
RNA was isolated from FACS-purified MHCIIIL-7-binding cells and MHCIIIL-7-non-binding cells using TriZol (Invitrogen) and used as a template for first strand cDNA synthesis. IL-7RA transcripts were identified using as 5' primer, OS rIL-7Rin (5'-CTATGCACAGAATGGAGACTTGGA-3') and as 3' primer, OA rIL-7Rin (5'-CATGCATCCAGTTGCCTTCAT-3'); terminal deoxynucleotidyl transferase (Tdt) transcripts were identified using as 5' primer, OS Tdt (5'GTGATTCTGTCACCCACATTGT3') and as 3' primer, OA Tdt (5'CTTCAGAACTTTCTCCATCTTCAA3'); EBF transcripts were identified using as 5' primer, OS EBF (5'GATTTCTACGTGCGCCTCA3') and as 3' primer, OA EBF (5'GAATCTCCGCATGTCACGTG3') and Pax5 transcripts were identified using as 5' primer, OS rPax5in (5'GTCAGTTCCATCAACAGGATCA3') and as 3' primer, OA rPax5in (5'GAGACTCCTGAATACCTTCGTCT3'). Primers for GAPDH transcripts were as described previously (5). All reverse transcription (RT)PCR products were cloned and sequenced and their identity confirmed by comparison with the respective murine and human genes.
| Results |
|---|
|
|
|---|
B cell differentiation potential of adult BM cells
In vivo.
We tested if BM from adult rabbits contains hematopoietic and/or lymphoid progenitors that can differentiate into CD79a+ B lineage cells by transferring adult BM cells into irradiated young recipient rabbits and searching for donor-derived B cell precursors. To differentiate between donor and recipient cells, we developed transgenic rabbits carrying gfp under the control of a CMV promoter and used BM from these rabbits as the source of donor cells. In four separate experiments, BM cells from four adult gfp transgenic rabbits were transferred into a total of 16 irradiated young recipients. The donor cells, obtained from adults aged 5.5 months, 11 months, 1 year and 2 years (Fig. 1A), contained B cells but no detectable proB or preB cells. Eight of the recipients carried the gfp transgene in peripheral blood cells and were sacrificed 23 weeks after transfer. By flow cytometry (Fig. 1B), both proB and preB cells were found in the BM of five of these eight recipients, which had received BM from three of the four adult donors. The percentages of proB and preB cell reconstitution for each recipient ranged from 1.36 to 8.0% (proB) and 0.04 to 0.63% (preB) (Fig. 1C), which are similar to the frequencies of proB and preB cells in BM of neonatal or young rabbits (5). The preB cells were FACS purified and by PCR, the gfp transgene was found in pools of preB cells or in single preB cells in each of the five reconstituted recipients (Fig. 1D and E and data not shown). By single-cell PCR, some of the preB cells in BM of the reconstituted rabbits were gfp and were presumably recipient derived. In addition, we found gfp+ CD4CD8 DP thymocytes, indicating that rabbit BM cells seeded the thymus and differentiated into T cell precursors, similar to murine BM cells (Fig. 1D, DP pools). These data indicate that adult BM contains hematopoietic and lymphoid progenitors that have the potential to differentiate into B and T cell precursors.
|
In vitro.
The murine OP9 and OP9 DL1 stromal cell lines promote development of lymphocytes from hematopoietic stem cells (HSCs) of both mice and humans (33, 36). To test whether OP9 stromal cells can support development of rabbit B lineage cells and whether BM cells from adults can differentiate into B cell precursors in vitro, we overlaid total BM cells from adult rabbits onto OP9 stromal cells and monitored the co-cultures for the appearance of B cell precursors. One to three weeks after the onset of the co-cultures, we observed colonies of proliferating cells. By flow cytometry, we identified these cells as proB cells (Fig. 2A), indicating that the murine OP9 stromal cells can support rabbit B cell development and that adult BM contains cells that can differentiate into B cell precursors in vitro. We extended this finding by showing that FACS-purified MHCII (CD79a proB and preB) BM cells from adults also differentiated into MHCII+ proB and preB cells (data not shown). Further, we found that the OP9 DL1 stromal cells promoted development of CD3+ T lineage cells from total BM (or MHCII BM) cells (Fig. 2B).
|
T lymphopoiesis in adults
In mouse, proB and proT cells differentiate from a hierarchy of hematopoietic progenitor subsets, including ELPs and CLPs. In addition, proT cells can also arise from a CLP-independent pathway via early thymic progenitors that seed the thymus (37). Because these lymphoid progenitor subsets have not yet been defined in rabbits, we sought to determine whether the arrest of B lymphopoiesis might occur at one of the shared B/T cell progenitor stages, manifesting in a coincident arrest of T lymphopoiesis, or whether the arrest of B lymphopoiesis is specific to the B cell lineage. We searched for evidence of T lymphopoiesis in adult rabbits by staining thymus cells for expression of CD4 and CD8 co-receptors. We found that the four T cell precursor subsets, CD4CD8 double-negative, CD4+CD8+ DP and CD4+CD8 or CD4CD8+ single-positive cells were present in thymus from both young and adult rabbits (Fig. 3A). Further, the percentage of cells in each subset was similar in newborn and adults. To determine if T cell precursors in adult thymus are actively rearranging TCR genes, we PCR amplified TREC signal joints formed during Dß2Jß2.1, Dß2Jß2.2 and Dß2Jß2.3 gene rearrangements. DJß TREC signal joints were readily amplified from both young and adult thymic DNA and their identity was confirmed by nucleotide sequence analysis (38; Fig. 3B and C). These results show that in contrast to B lymphopoiesis, in which B cell receptor excision circles (BRECs) are not detectable after
16 weeks of age, T lymphopoiesis, as identified by the presence of TRECs, continues well into adulthood.
|
Identification of lymphoid progenitors in young and adult BM
Murine CLPs can be identified by the expression of a number of surface molecules, including IL-7R, and the expression of the lymphoid-specific gene Tdt (39) and the B cell-specific gene EBF. To search for rabbit lymphoid progenitors (rLPs), we cloned rIL-7 and generated recombinant rIL-7 protein in E. coli. Purified rIL-7 was predominantly monomeric (Fig. 4A) and supported both the survival and proliferation of an IL-7-dependent murine proB cell line to a similar extent as mIL-7 (Fig. 4B), indicating that it is a functional ortholog of mIL-7. Previously, we had shown that all CD79a+ B lineage cells in rabbit BM are MHCII+ and that all lymphocyte-sized MHCII+ cells are CD79a+ (5; Fig. 4C). In addition, lymphocyte-sized MHCII+ cells from BM of young rabbits are predominantly proB and preB cell precursors. Using Bio rIL-7, we found that most MHCII+ (proB and preB) cells from young rabbit BM bound to Bio rIL-7, as expected, and some lymphocyte-sized MHCII cells also bound to Bio rIL-7 (
2.6%, Fig. 4F). The specificity of this binding was demonstrated by inhibition with unlabeled rIL-7 (Fig. 4E). We hypothesized that the MHCIIIL-7-binding cell population contains lymphoid progenitors. We FACS purified these cells from both young and adult rabbits (Fig. 5A) and by RTPCR showed that they expressed Tdt, IL-7RA and EBF (Fig. 5B), as expected of lymphoid progenitors. These cells also expressed Pax5, indicating that early B cell subsets may also be present (40). In contrast, the MHCIIIL-7-non-binding cells expressed low levels of IL-7RA, and did not express Tdt or EBF.
|
|
To determine if the MHCIIIL-7-binding cells from adults could functionally differentiate into B and T cell precursors, we co-cultured them with OP9 and OP9 DL1 stromal cells for 13 weeks. We found that these cells differentiated into CD79a+ proB and preB cells after co-culture with OP9 stromal cells (Fig. 5C) and that the newly arising B cell precursors expressed EBF, Pax5 and Tdt (data not shown). Further, these cells also contained VDH and DJH BRECs (Fig. 5D), indicating that they possess VDJ recombinase activity. In cultures with OP9 DL1 stromal cells, we observed that the newly arising CD3+ T cell precursors contained DJ TRECs (Fig. 5E and F). The MHCIIIL-7-non-binding cell population cultured on OP9 and OP9 DL1 stromal cells also gave rise to B and T lineage cells, respectively (data not shown). Whereas the MHCIIIL-7-binding cells likely represent lymphoid progenitors, such as CLPs and early B cell precursors, the MHCIIIL-7-non-binding cells likely represent earlier lymphoid progenitors, such as ELPs, multipotent progenitors and HSCs.
These results indicate that the population of MHCIIIL-7-binding cells in rabbit BM contains functional lymphoid progenitors and further that this population is present in adults as well as in young rabbits. We conclude that the arrest of B lymphopoiesis takes place either during or after a MHCIIIL-7-binding lymphoid progenitor cell stage, which we have designated rLP.
Requirement of IL-7 for rabbit B cell development in vitro
IL-7 is essential for B lymphopoiesis in mice, but is not required for B cell development in humans. However, human IL-7 (hIL-7) can induce proliferation of murine preB cells in vitro (41) and similarly, we found that rIL-7 can support the survival and proliferation of a mIL-7-dependent proB cell line. Excluding gaps and insertions, rIL-7 is 71% identical to mIL-7 and 70% identical to hIL-7, and like mIL-7, rIL-7 lacks exon 5 (Fig. 6A, cluster of dashes). To determine if rIL-7 is required for B cell development, we FACS purified MHCIIIL-7-binding BM cells from young rabbit BM and co-cultured them with OP9 stromal cells in the presence or absence of rIL-7. In each of two experiments, the co-cultures containing rIL-7 reproducibly generated proliferating B cell precursors (Fig. 6B), whereas cultures without rIL-7 generated no B cell precursors or 5-fold lower numbers than co-cultures containing rIL-7. By RTPCR, we found that the OP9 stromal cells produce IL-7 transcripts and to neutralize effects of mIL-7 on the generation of B cell precursors, we added goat anti-mIL-7 neutralizing antibody to the co-cultures and found either no B cell precursors or 7- to 10-fold lower numbers of B cell precursors. These results show that IL-7 is required for both differentiation of MHCIIIL-7-binding cells into B cell precursors and proliferation of rabbit B cell precursors in vitro.
|
The requirement of IL-7 for B lymphopoiesis in vitro led us to consider the possibility that the arrest of B lymphopoiesis in adults is due to diminished expression of IL-7 with age. Because other cell types in addition to stromal cells might produce IL-7, we analyzed expression of IL-7 from total BM RNA of various aged rabbits. However, by northern blot analysis of total BM RNA, we found almost no detectable IL-7 transcripts in young rabbits (1.53 weeks of age), but IL-7 transcripts in rabbits aged 3.5 months and older were detectable (Fig. 6C). By RTPCR, IL-7 transcripts were found in the BM at all ages (data not shown), indicating that IL-7 is expressed in BM of young rabbits, although at a level too low to be detected by northern analysis. These results demonstrate that IL-7 expression is up-regulated in adult rabbit BM, and show that the arrest of B lymphopoiesis is not due to a decline in IL-7 expression.
Re-initiation of B lymphopoiesis in adult BM
Even though B lymphopoiesis arrests by
16 weeks of age, the presence of early progenitor cells in BM, which can differentiate into B lineage cells, both in vitro and after adoptive transfer, prompted us to test whether B lymphopoiesis could be re-initiated in vivo. Because sub-lethal irradiation transiently depletes the BM of all dividing blood cell precursors, and is followed by a surge of hematopoiesis (42), we sub-lethally irradiated a total of four adult rabbits (aged 5 months, 6 months and 1.5 years) and 28 weeks later searched for B cell precursors in the BM. By flow cytometric staining, we found both proB and preB cells in BM in each of the irradiated adults (Fig. 7A and B). In addition, DNA from BM of irradiated adults contained VDH BRECs, whereas none are found in DNA from BM of unirradiated adults (Fig. 7C). The absence of BRECs in a preparation of circle DNA (which would be highly enriched for BRECs) from unirradiated adults (Fig. 7C, lane 4) suggests that the presence of BRECs in irradiated rabbits is not due to a small number of precursors that survive irradiation. Therefore, the presence of BRECs and the appearance of proB and preB cell precursors indicate that a new wave of B lymphopoiesis was initiated after irradiation. We conclude that even though B lymphopoiesis is arrested in adults, under the appropriate conditions, this arrest can be reversed.
|
| Discussion |
|---|
|
|
|---|
B lymphopoiesis arrests in adult rabbits by 16 weeks of age, at which time essentially no proB or preB cells are found in the BM (5). By adoptive transfer of BM cells from adults into young recipients and by in vitro experiments with murine OP9 stromal cells, we found that adults still possess B lymphopoietic potential. Further, we showed that BM cells from adults give rise to T cell precursors both in vivo and in vitro in OP9 DL1 stromal cell co-cultures.
In mice, HSCs transit through a series of lymphoid progenitor stages, after which the cells can either remain in the BM and continue B cell differentiation or seed the thymus and undergo T cell differentiation (19). We identified a small population (26%) of MHCIIIL-7-binding cells in rabbit BM that collectively expresses IL-7RA, Tdt, EBF and Pax5 and that can differentiate into B and T cell precursors in OP9 and OP9 DL1 stromal cell co-cultures, respectively. While these traits are characteristic of murine CLPs, we do not know if Tdt and EBF are expressed in the same IL-7-binding cells, as would be expected for CLPs. Furthermore, this population also contains cells that express Pax5, indicating that early and as yet undefined B cell precursors are also present. However, we suspect that a subset of the MHCIIIL-7-binding cells that differentiates into T cell precursors does not express Pax5, as Pax5 is known to lock in commitment to the B cell lineage (40). The unexpectedly high number of MHCIIIL-7-binding cells compared with those present in mice (0.050.5%) (43) is likely due, in part, to the presence of multiple IL-7R+ cells (including mature T cells), as well as cells that can bind rIL-7 through an alternative IL-7R, as previously found for hIL-7 (44). We conclude that the MHCIIIL-7-binding BM population contains rLPs, although functional analyses of single cells are needed to conclusively demonstrate whether these cells are lymphoid biased.
Even though adult rabbits produce MHCIIIL-7-binding cells in BM after B lymphopoiesis has arrested, we do not know if the rLPs from adults possess reduced B lymphopoietic potential compared with rLPs from young rabbits. We have observed that rLPs from young rabbits appear to give rise to B and T cell precursors with greater efficiency than adult rLPs; however, the composition of rLPs in young and adult BM is likely different and therefore we have not attempted to compare their lymphopoietic potential. Recent studies by Rossi et al. (45) and Min et al. (46) have shown that intrinsic age-related changes in HSCs and CLPs can lead to decreased levels of B lymphopoiesis in aged mice. However, because both total BM cells and rLPs from adults can generate B cell precursors in vivo and in vitro, respectively, we think the decline and arrest of B lymphopoiesis in adults is not simply due to reduced B lymphopoietic potential of rLPs, but that age-related changes that affect the ability of the BM microenvironment to promote B cell differentiation of rLPs also contribute to the arrest, similar to results reported by Labrie et al. (47). Changes within the supporting stromal cell environment during aging could disrupt hematopoietic and stromal cell niches, resulting in diminished supportive signals or increased suppressive signals that no longer drive differentiation, growth and survival during the early stages of B cell development, leading to the waning and arrest of B lymphopoiesis. Additionally, because we found that B cell development but not T cell development is specifically arrested in adults, we speculate that age-related changes in Notch ligand expression or Notch signaling might also contribute to the arrest of B lymphopoiesis, as Notch 1 ligation is known to promote T cell development at the expense of B cell development (48).
Because we identified rLPs based on their binding to rIL-7, we hypothesized that rabbit B cell development, like murine B cell development, requires IL-7, especially at a lymphoid progenitor stage (49). Consistent with this hypothesis, we found that rLPs co-cultured with OP9 stromal cells in the absence of rIL-7 generated drastically reduced levels of B cell precursors, or no B cell precursors, compared with rLPs co-cultured in the presence of rIL-7. Importantly, these data indicate that IL-7 is required for rabbit B lymphopoiesis in vitro and lead us to suggest that IL-7 is important for rabbit B lymphopoiesis in vivo. Surprisingly, we found that IL-7 transcripts are present at higher levels in adult BM and that the increase in IL-7 expression correlates with the timing of the arrest of B lymphopoiesis; however, we do not know whether IL-7 protein levels also increase. Elevated levels of IL-7 transcripts in adult BM might reflect an environmental response to the absence of B cell precursors or might even be involved in the arrest of B lymphopoiesis. Following the latter explanation, there are several possibilities by which IL-7 may contribute to the arrest. One explanation is that increased levels of IL-7 may actually block early stages of B lymphopoiesis in rabbits. Secondly, other cell types, besides lymphoid and B cell precursors, may utilize IL-7 and compete with rLPs and B cell precursors for IL-7. Finally, IL-7 protein in adults may be structurally altered and lack the capacity to promote B cell development. For example, Lai et al. (50) found that mIL-7 forms a heterodimer with hepatocyte growth factor beta, and together, they stimulate CLPs and pre-proB cells, but not proB and preB cells. The loss of a similar heterodimeric IL-7 protein isoform in adult rabbits could block rLPs or pre-proB-like cells from differentiating to proB and preB cells.
In contrast to the developmental termination of B lymphopoiesis in chicken and sheep, two fellow GALT species, our results suggest that B cell development in rabbits is developmentally suppressed. This suppression is likely mediated by aging HSCs and lymphoid progenitors, changes in the BM microenvironment and/or the accumulation of B lineage-suppressive cells in the BM. Re-initiation of B lymphopoiesis in adults by sub-lethal irradiation could occur (i) through rapid expansion of stem cells that differentiate and fill the hematopoietic niche following the death of pre-existing hematopoietic precursors and mature lymphocytes (51); (ii) through up-regulation of B lymphopoietic-promoting genes, as
-irradiation is known to induce changes in gene expression of radio-resistant BM and thymic stromal cells leading to increased levels of IL-1, IL-6, IL-7, tumor necrosis factor, stromal cell-derived factor-1 and stem cell factor transcripts and/or proteins (52, 53); (iii) through down-regulation of B lymphopoietic-inhibitory genes and/or (iv) through the elimination of one or more radio-sensitive B lineage-suppressive cells from adult BM. We speculate that other physiological conditions, such as inflammation or fluctuating levels of sex hormones (54, 55), might also reverse the suppression of B lymphopoiesis. However, preliminary data suggest that neither a localized immune response nor elimination of sex hormones can re-initiate B lymphopoiesis, as we did not observe B cell precursors or BRECs in adult BM 12 weeks following subcutaneous injection of bovine gamma globulin in Freund's adjuvant (P. Yam and K.L. Knight, unpublished observations). Further, orchiectomy did not sustain high levels of B cell precursors in a young male rabbit and also did not re-initiate B lymphopoiesis in an adult male rabbit (S.L. Kalis, P. Sethupathi, P. Jasper and K.L. Knight, unpublished observations).
In aging mice and humans, B cell immunity declines, in part, due to decreased levels of B lymphopoiesis (2, 43, 56). In rabbits, B lymphopoiesis starts to wane 4 weeks after birth and reversibly arrests by 4 months of age, thereby presenting a useful model to study age-related or developmental changes that promote or suppress B lymphopoiesis. Because the suppression of B lymphopoiesis in rabbits is synchronous and essentially complete, new signals that regulate B cell output can be identified, as these signals may play a more subtle role in promoting or inhibiting B lymphopoiesis in mice and humans. Further, understanding the mechanism by which B lymphopoiesis is suppressed in rabbits could lead to immunotherapies that can enhance B lymphopoiesis and B cell immunity in aging humans.
| Acknowledgements |
|---|
We thank Periannan Sethupathi for generating the gfp transgenic rabbit line and Patricia Simms in the FACS facility at Loyola University for helping with the FACS. This work was supported by National Institutes of Health grant AI50260.
| Abbreviations |
|---|
| Bio, biotinylated |
| BM, bone marrow |
| BREC, B cell receptor excision circle |
| CLP, common lymphoid progenitor |
| CMV, cytomegalovirus |
| DL1, delta-like 1 |
| DP, double positive |
| EBF, early B cell factor |
| ELP, early lymphoid progenitor |
| FSC, forward scatter |
| GALT, gut-associated lymphoid tissues |
| GFP, green fluorescent protein |
| GPD, glyceraldehyde-3-phosphate dehydrogenase |
| HSC, hematopoietic stem cell |
| hIL-7, human IL-7 |
| mIL-7, murine IL-7 |
| ORF, open reading frame |
| PBL, peripheral blood leukocytes |
| RACE, rapid amplification of cDNA ends |
| rIL-7, rabbit IL-7 |
| rLP, rabbit lymphoid progenitor |
| RT, reverse transcription |
| SAv, streptavidin |
| SSC, side scatter |
| Tdt, terminal deoxynucleotidyl transferase |
| TNF, tumor necrosis factor |
| TREC, T cell receptor excision circle |
| Notes |
|---|
Transmitting editor: P. Kincade
Received 18 October 2006, accepted 23 March 2007.
| References |
|---|
|
|
|---|
- Nunez C, Nishimoto N, Gartland GL, et al. B cells are generated throughout life in humans. J. Immunol. (1996) 156:866.[Abstract]
- Stephan RP, Sanders VM, Witte PL. Stage-specific alterations in murine B lymphopoiesis with age. Int. Immunol. (1996) 8:509.
[Abstract/Free Full Text] - Reynaud C-A, Bertocci B, Dahan A, Weill J-C. Formation of the chicken B-cell repertoire: ontogenesis, regulation of Ig gene rearrangement, and diversification by gene conversion. Adv. Immunol. (1994) 57:353.[Web of Science][Medline]
- McCullagh P, Press CM, McClure SJ, Larsen HJ, Landsverk T. The effect of dosage, gestational age and splenectomy on anti-IgM interception of prenatal B-cell development in sheep. Clin. Dev. Immunol. (2003) 10:19.[CrossRef][Medline]
- Jasper PJ, Zhai S-K, Kalis SL, Kingzette M, Knight KL. B lymphocyte development in rabbit: progenitor B cells and waning of B lymphopoiesis. J. Immunol. (2003) 171:6372.
[Abstract/Free Full Text] - Press CM, Hein WR, Landsverk T. Ontogeny of leukocyte populations in the spleen of fetal lambs with emphasis on the early prominence of B cells. Immunology (1993) 80:598.[Web of Science][Medline]
- Hayward AR, Simons MA, Lawton AR, Mage RG, Cooper MD. Pre-B and B cells in rabbits. Ontogeny and allelic exclusion of kappa light chain genes. J. Exp. Med. (1978) 148:1367.
[Abstract/Free Full Text] - Lanning D, Osborne B, Knight KL. Immunoglobulin genes and generation of antibody repertoires in higher vertebrates: a key role for GALT. In: Molecular Biology of B CellsAlt FW, Honjo T, Neuberger MS, eds. (2004) Elsevier Science Ltd. 433.
- Glick B. The bursa of Fabricius and immunoglobulin synthesis. Int. Rev. Cytol. (1977) 48:345.[Medline]
- Reynolds JD, Morris B. The evolution and involution of Peyer's patches in fetal and postnatal sheep. Eur. J. Immunol. (1983) 13:627.[Web of Science][Medline]
- Thorbecke GJ. Gamma globulin and antibody formation in vitro: I. gamma globulin formation in tissues from immature and normal adult rabbits. J. Exp. Med. (1960) 112:279.[Abstract]
- Weinstein PD, Mage RG, Anderson AO. The appendix functions as a mammalian bursal equivalent in the developing rabbit. Adv. Exp. Med. Biol. (1994) 355:249.[Medline]
- Crane MA, Kingzette M, Knight KL. Evidence for limited B-lymphopoiesis in adult rabbits. J. Exp. Med. (1996) 183:2119.
[Abstract/Free Full Text] - Hardy RR, Li YS, Allman D, Asano M, Gui M, Hayakawa K. B-cell commitment, development and selection. Immunol. Rev. (2000) 175:23.[CrossRef][Web of Science][Medline]
- Corcoran AE, Smart FM, Cowling RJ, Crompton T, Owen MJ, Venkitaraman AR. The interleukin-7 receptor alpha chain transmits distinct signals for proliferation and differentiation during B lymphopoiesis. EMBO J. (1996) 15:1924.[Web of Science][Medline]
- Jiang Q, Li WQ, Hofmeister RR, et al. Distinct regions of the interleukin-7 receptor regulate different Bcl2 family members. Mol. Cell. Biol. (2004) 24:6501.
[Abstract/Free Full Text] - Jiang Q, Li WQ, Aiello FB, et al. Cell biology of IL-7, a key lymphotrophin. Cytokine Growth Factor Rev. (2005) 16:513.[CrossRef][Web of Science][Medline]
- Igarashi H, Gregory SC, Yokota T, Sakaguchi N, Kincade PW. Transcription from the RAG1 locus marks the earliest lymphocyte progenitors in bone marrow. Immunity (2002) 17:117.[CrossRef][Web of Science][Medline]
- Kondo M, Weissman IL, Akashi K. Identification of clonogenic common lymphoid progenitors in mouse bone marrow. Cell (1997) 91:661.[CrossRef][Web of Science][Medline]
- Goodwin RG, Friend D, Ziegler SF, et al. Cloning of the human and murine interleukin-7 receptors: demonstration of a soluble form and homology to a new receptor superfamily. Cell (1990) 60:941.[CrossRef][Web of Science][Medline]
- Noguchi M, Nakamura Y, Russell SM, et al. Interleukin-2 receptor gamma chain: a functional component of the interleukin-7 receptor. Science (1993) 262:1877.
[Abstract/Free Full Text] - Dias S, Silva H Jr, Cumano A, Vieira P. Interleukin-7 is necessary to maintain the B cell potential in common lymphoid progenitors. J. Exp. Med. (2005) 201:971.
[Abstract/Free Full Text] - Kikuchi K, Lai AY, Hsu CL, Kondo M. IL-7 receptor signaling is necessary for stage transition in adult B cell development through up-regulation of EBF. J. Exp. Med. (2005) 201:1197.
[Abstract/Free Full Text] - Voßhenrich CA, Cumano A, Muller W, Di Santo JP, Vieira P. Thymic stromal-derived lymphopoietin distinguishes fetal from adult B cell development. Nat. Immunol. (2003) 4:773.[CrossRef][Web of Science][Medline]
- Carvalho TL, Mota-Santos T, Cumano A, Demengeot J, Vieira P. Arrested B lymphopoiesis and persistence of activated B cells in adult interleukin 7(/) mice. J. Exp. Med. (2001) 194:1141.
[Abstract/Free Full Text] - Noguchi M, Yi H, Rosenblatt HM, et al. Interleukin-2 receptor gamma chain mutation results in X-linked severe combined immunodeficiency in humans. Cell (1993) 73:147.[CrossRef][Web of Science][Medline]
- Puel A, Ziegler SF, Buckley RH, Leonard WJ. Defective IL-7R expression in T()B(+)NK(+) severe combined immunodeficiency. Nat. Genet. (1998) 20:394.[CrossRef][Web of Science][Medline]
- Johnson SE, Shah N, Panoskaltsis-Mortari A, Lebien TW. Murine and human IL-7 activate STAT5 and induce proliferation of normal human Pro-B cells. J. Immunol. (2005) 175:7325.
[Abstract/Free Full Text] - Knight KL, Spieker-Polet H, Kazdin DS, Oi VT. Transgenic rabbits with lymphocytic leukemia induced by the c-myc oncogene fused with the immunoglobulin heavy chain enhancer. Proc. Nat. Acad. Sci. USA (1988) 85:3130.
[Abstract/Free Full Text] - Gustincich S, Manfioletti G, Del Sal G, Schneider C, Carninci P. A fast method for high-quality genomic DNA extraction from whole human blood. Biotechniques (1991) 11:298.[Web of Science][Medline]
- Vajdy M, Sethupathi P, Knight KL. Dependence of antibody somatic diversification on gut-associated lymphoid tissue in rabbits. J. Immunol. (1998) 160:2725.
[Abstract/Free Full Text] - Lobel SA, Knight KL. The role of rabbit Ia molecules in immune functions as determined with the use of an anti-Ia monoclonal antibody. Immunology (1984) 51:35.[Web of Science][Medline]
- Schmitt TM, Zúñiga-Pflücker JC. Induction of T cell development from hematopoietic progenitor cells by delta-like-1 in vitro. Immunity (2002) 17:749.[CrossRef][Web of Science][Medline]
- Frohman MA. Rapid amplification of complementary DNA ends for generation of full-length complementary DNAs: thermal RACE. Methods Enzymol. (1993) 218:340.[Web of Science][Medline]
- Cosenza L, Sweeney E, Murphy JR. Disulfide bond assignment in human interleukin-7 by matrix-assisted laser desorption/ionization mass spectroscopy and site-directed cysteine to serine mutational analysis. J. Biol. Chem. (1997) 272:32995.
[Abstract/Free Full Text] - La Motte-Mohs RN, Herer E, Zúñiga-Pflücker JC. Induction of T-cell development from human cord blood hematopoietic stem cells by Delta-like 1 in vitro. Blood (2005) 105:1431.
- Allman D, Sambandam A, Kim S, et al. Thymopoiesis independent of common lymphoid progenitors. Nat. Immunol. (2003) 4:168.[CrossRef][Web of Science][Medline]
- Harindranath N, Alexander CB, Mage RG. Evolutionarily conserved organization and sequences of germline diversity and joining regions of the rabbit T-cell receptor beta-2 chain. Mol. Immunol. (1991) 28:881.[CrossRef][Web of Science][Medline]
- Kouro T, Medina KL, Oritani K, Kincade PW. Characteristics of early murine B-lymphocyte precursors and their direct sensitivity to negative regulators. Blood (2001) 97:2708.
[Abstract/Free Full Text] - Busslinger M. Transcriptional control of early B cell development. Ann. Rev. Immunol. (2004) 22:55.[CrossRef][Web of Science][Medline]
- Goodwin RG, Lupton S, Schmierer A, et al. Human interleukin 7: molecular cloning and growth factor activity on human and murine B-lineage cells. Proc. Nat. Acad. Sci. USA (1989) 86:302.
[Abstract/Free Full Text] - Park YH, Osmond D. Post-irradiation regeneration of early B-lymphocyte precursor cells in mouse bone marrow. Immunology (1989) 66:343.[Web of Science][Medline]
- Miller JP, Allman D. The decline in B lymphopoiesis in aged mice reflects loss of very early B-lineage precursors. J. Immunol. (2003) 171:2326.
[Abstract/Free Full Text] - Armitage RJ, Ziegler SF, Friend DJ, Park LS, Fanslow WC. Identification of a novel low-affinity receptor for human interleukin-7. Blood (1992) 79:1738.
[Abstract/Free Full Text] - Rossi DJ, Bryder D, Zahn JM, et al. Cell intrinsic alterations underlie hematopoietic stem cell aging. Proc. Nat. Acad. Sci. USA (2005) 102:9194.
[Abstract/Free Full Text] - Min H, Montecino-Rodriguez E, Dorshkind K. Effects of aging on the common lymphoid progenitor to pro-B cell transition. J. Immunol. (2006) 176:1007.
[Abstract/Free Full Text] - Labrie JE III, Sah AP, Allman DM, Cancro MP, Gerstein RM. Bone marrow microenvironmental changes underlie reduced RAG-mediated recombination and B cell generation in aged mice. J. Exp. Med. (2004) 200:411.
[Abstract/Free Full Text] - Pui JC, Allman D, Xu L, et al. Notch1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity (1999) 11:299.[CrossRef][Web of Science][Medline]
- Miller JP, Izon D, DeMuth W, Gerstein R, Bhandoola A, Allman D. The earliest step in B lineage differentiation from common lymphoid progenitors is critically dependent upon interleukin 7. J. Exp. Med. (2002) 196:705.
[Abstract/Free Full Text] - Lai L, Zeff RA, Goldschneider I. A recombinant single-chain IL-7/HGFbeta hybrid cytokine induces juxtacrine interactions of the IL-7 and HGF (c-Met) receptors and stimulates the proliferation of CFU-S12, CLPs, and pre-pro-B cells. Blood (2006) 107:1776.
[Abstract/Free Full Text] - Seki H, Kanegane H, Iwai K, et al. Ionizing radiation induces apoptotic cell death in human TcR-gamma/delta+ T and natural killer cells without detectable p53 protein. Eur. J. Immunol. (1994) 24:2914.[Web of Science][Medline]
- Sugimoto K, Adachi Y, Moriyama K, et al. Induction of the expression of SCF in mouse by lethal irradiation. Growth Factors (2001) 19:219.[Web of Science][Medline]
- Zubkova I, Mostowski H, Zaitseva M. Up-regulation of IL-7, stromal-derived factor-1 alpha, thymus-expressed chemokine, and secondary lymphoid tissue chemokine gene expression in the stromal cells in response to thymocyte depletion: implication for thymus reconstitution. J. Immunol. (2005) 175:2321.
[Abstract/Free Full Text] - Medina KL, Smithson G, Kincade PW. Suppression of B lymphopoiesis during normal pregnancy. J. Exp. Med. (1993) 178:1507.
[Abstract/Free Full Text] - Wilson CA, Mrose SA, Thomas DW. Enhanced production of B lymphocytes after castration. Blood (1995) 85:1535.
[Abstract/Free Full Text] - Rossi MI, Yokota T, Medina KL, et al. B lymphopoiesis is active throughout human life, but there are developmental age-related changes. Blood (2003) 101:576.
[Abstract/Free Full Text]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






