Skip Navigation



International Immunology Advance Access published online on January 30, 2007
International Immunology, doi:10.1093/intimm/dxl147
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/3/305    most recent
dxl147v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Xin, J.
Right arrow Articles by Huang, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xin, J.
Right arrow Articles by Huang, H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Japanese Society for Immunology. 2007. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

The initial response of CD4+ IL-4-producing cells

Junping Xin1, Keitaro Ohmori2,3, Jun Nishida2,3, Yuechun Zhu4,1 and Hua Huang2,3,*

1 Department of Cell Biology, Loyola University Chicago School of Medicine, Maywood, IL 60153, USA
2 Division of Allergy and Immunology, Department of Medicine
3 Department of Integrated Immunology, National Jewish Medical and Research Center, University of Colorado Health Science Center, 1400 Jackson Street, Denver, CO 80206, USA
4 Present address: Department of Biochemistry and Molecular Biology, Kuming Medical College, Kuming, Yunnan 650031, People’s Republic of China

Correspondence to: Correspondence to: H. Huang; E-mail: huangh{at}njc.org


   Abstract
Top
 Abstract
Introduction
 Methods
 Results
 Discussion
 References
 
Naive CD4+ T cells were reported to produce small amounts of IL-4 in vitro, which are implicated to be sufficient to initiate Th2 response in vivo. However, IL-4-producing naive CD4+ T cells are difficult to study in vivo because they are present in low numbers shortly after the first antigen exposure. Here, we used IL-4/green fluorescence protein (GFP) reporter mice (G4 mice) to track the initial response of CD4+ IL-4-producing cells. We first established a flow cytometry method to estimate the number of GFP+ cells. We demonstrated the effectiveness of this method by showing that the responding CD4+GFP+ cells exhibited an activated phenotype, possessed the capacity to express IL-5 and IL-13, but not IFN-{gamma} mRNA, and showed enhanced levels of GATA3 and c-maf mRNA expression. More importantly, we showed that the cell lines derived from FACS-sorted CD4+GFP+ cells were antigen specific. By using this newly established method, we showed that the majority of responding GFP+ cells were CD4+ T cells. Our study provides direct ex vivo evidence to show that a small percent of CD4+ T cells that have no previous experience of antigenic stimulation might produce IL-4 to initiate Th2 response.

Keywords: CD4+ T cells, IL-4/GFP reporter mice, initial IL-4 production


   Introduction
Top
 Abstract
 Introduction
Methods
 Results
 Discussion
 References
 
Th-mediated immune responses play critical roles in health and disease states. Th can be divided into two major types. Th1 principally produce IFN-{gamma} but not IL-4, whereas Th2 produce IL-4, IL-5 and IL-13 but not IFN-{gamma}. Naive CD4+ T cells—defined as no prior experience of antigenic stimulation—can differentiate into either Th1 or Th2, primarily depending on the cytokine environments where they first encounter antigens. IL-12 drives naive CD4+ T cells to differentiate into Th1, whereas IL-4 directs naive CD4+ T cells to differentiate into Th2 cells. While the cellular source for initial IL-12 production has become reasonably well established, the cellular source for initial IL-4 production remains less studied (1, 2).

Cellular sources for initial IL-4 production have been reported to include NKT cells (3, 4), basophils (5, 6), eosinophils (7–9), mast cells (10, 11) and CD4+ T cells (12–15). These cells possess the capacity to produce IL-4 promptly in various experimental systems without a requirement for priming. Among these initial IL-4-producing cells, CD4+ T cells as initial IL-4-producing cells offer several advantages. First, in contrast to NKT cells and {gamma}{delta}-T cells, which use restricted TCRs that can only recognize a limited number of antigens, CD4+ T cells provide a wider spectrum of TCRs that recognize a variety of allergens and parasitic antigens. Second, CD4+ T cells, unlike basophils, eosinophils and mast cells, are in the right place at the right time; they are located in the lymph node where they recognize antigens to initiate immune response.

However, CD4+ T cells that can produce initial IL-4 are difficult to study in vivo because these cells are present in low numbers shortly after antigen stimulation. Furthermore, the small amounts of IL-4 produced could be quickly consumed by surrounding cells, making it even more difficult for detection. Here, we used IL-4/green fluorescence protein (GFP) reporter mice (G4 mice) to overcome those problems and demonstrate that directly ex vivo the majority of antigen-responding IL-4-producing cells were CD4+ T cells.


   Methods
Top
 Abstract
 Introduction
 Methods
Results
 Discussion
 References
 
Mice
IL-4/GFP reporter mice (G4 mice) were described previously (16, 17). A breeding pair of the G4 mice (129 backcrossed to C57BL/6 mice for 12 generations) was provided to us by William E. Paul of the National Institutes of Health (NIH) (Bethesda, MD, USA). These mice were bred into gfp-Il4/gfp-Il4 homozygous [homozygous for a knock-in gfp gene in the place of exon 1 of the Il4 gene (G4hom mice)] in our pathogen-free facility and fed a protein-free diet (Harlan 7012). Handling of animals complied with the animal protocols approved by either the Loyola University Medical School or National Jewish Medical and Research Institutional Animal Care and Use Committee.

Immunization protocols and cell sample preparations
For preparing GFP+ cells, G4hom mice were injected intra-peritoneally (i.p.) with 100 µg of ovalbumin (OVA) (Sigma, St Louis, MO, USA) in 100 µl of PBS 1:1 mixed with 100 µl of Imject aluminum hydroxide and magnesium (alum) (Pierce, Rockford, IL, USA) on day 0. Mesenteric lymph nodes (MLNs) were taken out at the time points specified.

Flow cytometric analysis
Single-cell suspension of lymph node cells was stained with allophycocyanin (APC)-labeled anti-CD4 antibody (BD PharMingen, San Diego, CA, USA). PE-labeled antibodies to all TCR{alpha}ß, NK1.1 and CD62L were purchased from BD PharMingen. The stained cells were analyzed with a FACScan (Becton-Dickinson, Mountain View, CA, USA).

FACS sorting, reverse transcriptase–PCR and real-time PCR
GFP+ cells were electronically sorted into a test tube by using a BD FACStar plus instrument. Over 99% of sorted cells were GFP+ as examined under a fluorescence microscope. Naive CD4+ cells were prepared from MLNs of unimmunized G4hom mice by using the method as described previously (18). mRNA was isolated using MicroPoly (A) PureTM kit (Ambion Inc., Austin, TX, USA) according to the manufacturer’s instructions. cDNA was synthesized and PCR was subsequently performed with the following primer pairs—IL-5 primer sequences: forward, 5'-CAATGAGACGATGAGGCT TC-3' and reverse, 5'-CCACTCTGTACTCATCACAC-3'; IL-13: forward, 5'-ACAGCTCCCTGGTTCTCTCA-3' and reverse, 5'-CGTGGCGAAACAGTTGCTTTGTG-3'; T-bet: forward, 5'-CCTGTTGTGGTCCAAGTT and reverse, TTTCCACACTGCACCCACTT, and IFN-{gamma}: forward, ATTGAAAGCCTAGAAAGTCTG and reverse, CTCATGAATGCATCCTTTTTCG. PCR for amplifying IL-5, IL-13 and GAPDH consisted of 30 cycles at 95°C for 20 s, 58°C for 30 s and 72°C for 65 s, followed by 7 min at 72°C. For amplification of IFN-{gamma} and T-bet, we performed 40 cycles at 95°C for 30 s, 60°C for 30 s and 72°C for 60 s.

For real-time PCR analysis, the following primers were used—GATA3: forward, CCTACCGGGTTCGGATGTAA and reverse, TCACACACTCCCTGCCTTCT; c-maf: forward, AGCAGTTGGTGACCATGTCG and reverse, TGGAGATCTCCTGCTTGAGG, and Jun B: forward, CCTGTCTCTACACGACTACA and reverse, TTGAGGCTAGCTTCAGAGAT. Real-time PCR was performed in an ABI PRISMTM 7700 Sequence Detection System. The cycling conditions were 95°C for 10 min, followed by 95°C for 15 s and 60°C for 1 min for 40 cycles. The amounts of mRNA were expressed as a relative fold of induction to GAPDH (relative fold = 2{Delta}CT, where {Delta}CT = CFormula – CFormula.

Testing of antigen specificity of CD4+GFP+ cell lines
Fifty of the CD4+GFP+ cells prepared from G4hom mice that received peritoneal injection of OVA plus alum 24 h prior to sorting were deposited onto one well of a 96-well plate containing 0.1 x 106 irradiated APC, anti-CD3 (3 µg ml–1), anti-CD28 (3 µg ml–1) and IL-2 (10 U ml–1) (PeproTech Inc., Rocky Hill, NJ, USA). Colonies were screened 2 weeks after the initial stimulation. Colonies were re-stimulated with 1 x 106 irradiated APC plus anti-CD3 (3 µg ml–1), anti-CD28 (3 µg ml–1) and IL-2 (10 U ml–1), APC plus OVA peptide (prepared by Alpha Diagnostic International, San Antonio, TX, USA) and IL-2 or APC plus cytochrome c peptide (prepared by National Institute of Allergy and Infectious Disease, Biological Resource Branch, Bethesda, MD, USA) and IL-2 for 36 h. Supernatants were collected and used for the measurement of IL-5 protein by ELISA (BD PharMingen).


   Results
Top
 Abstract
 Introduction
 Methods
 Results
Discussion
 References
 
Establishment of a method to analyze initial responding GFP+ cells
To analyze GFP+ cells, we first developed a method to estimate a small number of GFP+ cells (Fig. 1). We used a live-gate that was defined by using the FL1 (GFP) and the FL3 plots (Fig. 1A). FL1 and FL3 plots allowed us to differentiate auto-fluorescence from green fluorescence. Auto-fluorescence can be detected by both FL1 and FL3, whereas green fluorescence can only be detected by FL1. After GFP+ cells were collected (Fig. 1B), we used a combinatorial analysis gate consisting of a more stringently defined GFP+ gate and a size gate to analyze multiple-color-labeled GFP+ cells. The GFP+ gate was determined by comparing the background mean fluorescence intensity (MFI) shown by lymphocytes prepared from unimmunized G4hom mice to MFI displayed by lymphocytes prepared from immunized G4hom mice (Fig. 1C). The size gate was determined by using a ‘backgating’ technique (Fig. 1C). First, we gated on GFP+ cells prepared from immunized G4hom mice using the FL3 and the FL1 plot. Then we used a forward scatter and a side scatter plot to determine the size of GFP+ cells. This gate was useful when multiple-color analysis was involved; it gated out cell aggregates that bind to antibodies non-specifically.


Figure 1
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1. A live-gate and two analysis gates used for collecting and analyzing GFP+ cells are shown. G4hom mice were not injected (Unim) or injected i.p. with 100 µg OVA plus alum (OVA). Single cells were prepared from MLNs and stained with APC-labeled anti-CD4 antibody 24 h after injection. GFP+ cells were collected through the live-gate (A). Collected data are shown before they were subjected to the use of analysis gates (B). For data analysis, a combination of a more strictly defined fluorescence gate (GFP+) and a size gate were used (C). GFP+ cells were then divided into CD4+ and CD4– populations (D). The percent of CD4+GFP+ and CD4–GFP+ in GFP+ cells represents data collected from 7 mice (n = 7).

 
The majority of CD4+GFP+ cells in response to OVA stimulation are antigen-specific conventional CD4+ T cells
To identify the cells that promptly expressed IL-4 after antigenic stimulation, we used two criteria to describe an initial IL-4 producer. First, initial IL-4 producers must produce IL-4 independent of IL-4. Second, they must produce IL-4 without requiring a priming period. To meet these requirements, we used G4hom mice, which we confirmed previously did not produce IL-4 (9). And we measured GFP+ cells at early time points (24 h) after single i.p. injection of OVA. We found that the majority of GFP+ cells 24 h after a single injection of OVA plus alum were CD4+ T cells (CD4+GFP+: 84.2 ± 5.4% and CD4–GFP+: 14.4 ± 6.3%) (Fig. 1D).

CD4+ NKT cells have been reported to produce IL-4 promptly in response to anti-CD3 treatment in vivo (3, 4). To determine what percentage of CD4+GFP+ cells were conventional CD4+ T cells and what percentage of CD4+GFP+ cells were NKT cells, we stained the CD4+GFP+ cells with PE-labeled anti-TCR{alpha}ß antibody or anti-NK1.1 antibody. We showed that the majority of CD4+GFP+ cells expressed TCR{alpha} and ß chains, and ~16% of CD4+GFP+ cells expressed NK1.1 (Fig. 2). Our data suggest that although NKT cells were enriched in CD4+GFP+ cell population, the majority of CD4+GFP+ cells detected in our system were conventional CD4+ T cells.


Figure 2
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2. The majority of CD4+GFP+ cells are conventional CD4+ T cells. Single cells were prepared and pooled from MLNs of seven G4hom mice 24 h after OVA injection. Cells were stained with APC-labeled anti-CD4 antibody, PE-labeled isotype control, PE-labeled anti-all Vß antibody or PE-labeled anti-NK1.1 antibody. GFP+ cells were collected through the live-gate. GFP– cells were collected without the live-gate. CD4+GFP+ cells were analyzed by using the combinational analysis gate consisting of the size gate, the CD4+ gate and the GFP+ gate, whereas CD4+GFP– cells were analyzed by using the combinational gate consisting of the size gate, the CD4+ gate and the GFP– gate shown in Fig. 1.

 
To compare these IL-4-independent CD4+GFP+ cells with Th2, we FACS sorted CD4+GFP+ cells from mice that received OVA injection 24 h prior to assay and stimulated them with phorbol myristate acetate–ionomycin for 4 h. We examined Th2 and Th1 cytokine mRNA expression and found that CD4+GFP+ cells possessed the capacity to express IL-5 and IL-13, but not IFN-{gamma} mRNA (Fig. 3A). We further found that these CD4+GFP+ cells expressed enhanced GATA3 mRNA. c-maf and Jun B mRNA were also enhanced but to a less degree compared with that of Th2 (Fig. 3B). CD4+GFP+ cells did not express the Th1-specific transcription factor T-bet (Fig. 3A). These results suggest that the CD4+GFP+ cells exhibit a phenotype that resembles that of CD4+ Th2 memory cells.


Figure 3
View larger version (13K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3. CD4+GFP+ cells exhibit a phenotype that resembles that of CD4+ Th2 memory cells. (A) CD4+GFP+ cells express IL-5 and IL-13, but not IFN-{gamma} mRNA. To prepare CD4+GFP+ cells, single cells were prepared from pooled MLNs of six G4hom mice that received i.p. injection of OVA plus alum 24 h prior to assay. CD4+GFP+ cells were isolated electronically. The cells were not stimulated (–) or stimulated with phorbol myristate acetate (50 ng ml–1) and ionomycin (1 µM) for 4 h and used for mRNA preparation with a MicroPoly (A) PureTM kit. cDNAs were synthesized and divided for the amplification of IL-5, IL-13, IFN-{gamma}, T-bet and GAPDH. The amounts of cDNA used per PCR were calculated to be equivalent to 270 of CD4+GFP+ cells. These results represent three similar experiments. (B) CD4+GFP+ cells express enhanced levels of GATA3 and c-maf mRNA. Naive CD4+ T cells were prepared from MLNs of unimmunized G4hom mice and Th2 were prepared by using the method described previously (18). CD4+GFP+ cells were isolated by FACS sorting. cDNA was synthesized by reverse transcription. The amounts of mRNA were quantified by real-time PCR using specific primers indicated and expressed as a relative fold of induction to GAPDH (relative fold = 2{Delta}CT, where {Delta}CT = CFormula – CFormula. These results represent two similar experiments.

 
Because the frequency of CD4+GFP+ cells in response to OVA stimulation was low, we examined whether CD4+GFP+ cells can become activated by OVA stimulation in vivo. We found that ~95% of CD4+GFP+ cells, compared with 16.3% of CD4+GFP– cells, expressed low levels of CD62L, an activation marker, 24 h after i.p. injection of OVA (Fig. 4). To demonstrate whether CD4+GFP+ cells were antigen specific, we FACS sorted CD4+GFP+ cells from mice that received an OVA injection 24 h prior to assay and expanded them in vitro to establish cell lines. We showed that two cell lines derived from CD4+GFP+ cells produced IL-5 in response to OVA peptide but not cytochrome c peptide stimulation (Fig. 5). These data demonstrated that the CD4+GFP+ cells detected in our system were OVA specific.


Figure 4
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4. CD4+GFP+ cells show an activated phenotype. Cells were prepared from pooled MLNs of four G4hom mice 24 h after injection. They were stained with APC-labeled anti-CD4 and PE-labeled anti-CD62L antibodies. GFP+ cells were collected using the live-gate and analyzed with the CD4+ gate and the GFP+ gate (CD4+GFP+). For analyzing GFP– cells, total lymph node cells from those same mice were collected without the live-gate. They were analyzed with the analysis gate consisting of the CD4+ gate and the GFP– gate (CD4+GFP–). The numbers within the FACS plots indicate the percentage of CD62L negative in CD4+GFP+ cells or in CD4+GFP– cells. These results represent two similar experiments.

 

Figure 5
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5. CD4+GFP+ cell lines show OVA specificity. CD4+GFP+ cells (50 cells per well) were sorted directly onto a 96-well plate containing anti-CD3 (3 µg ml–1), anti-CD28 (3 µg ml–1), IL-2 (10 U ml–1) and irradiated T cells-depleted APC. Two cell lines are shown. They were stimulated with cytochrome c peptide (CC), OVA peptide (OVA) or anti-CD3 antibody (anti-CD3) for 36 h. Supernatants were collected and measured for IL-5 protein by ELISA.

 
The number of CD4+GFP+ but not CD4–GFP+ cells increases in the draining lymph node
To determine the kinetics of the initial response of IL-4-producing cells to antigen stimulation in vivo, we estimated the number of CD4+GFP+ cells and CD4–GFP+ cells in various treatment groups. We observed a significant increase in the number of CD4+GFP+ cells in the MLN starting at 24 h after injection. Such increase reached peak levels at 48 h and returned to near-background levels at 5 days after injection. In contrast, alum plus PBS did not cause an increase in the number of CD4+GFP+ cells. The number of CD4–GFP+ cells did not increase throughout the course of antigenic stimulation (Fig. 6). These results suggest that CD4+ T cells may contribute to the majority of IL-4-independent IL-4 production shortly after antigen stimulation.


Figure 6
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 6. The majority of GFP+ cells shortly after antigen stimulation are CD4+ T cells. Single cells were prepared from MLNs of individual G4hom mouse and stained with APC-labeled anti-CD4 antibody, 6, 24, 48 or 72 h or 5 days after i.p. injection with OVA plus alum or PBS plus alum. GFP+ cells were collected using the live-gate (shown in Fig. 1A) and analyzed using the size gate and the GFP+ gate (shown in Fig. 1C). GFP+ cells were then divided into CD4+GFP+ by combining the size gate and the GFP+ gate with the CD4+ gate (shown in Fig. 1D) and CD4–GFP+ cells by combining the size gate and the GFP+ gate with the CD4– gate (shown in Fig. 1D). Mean and standard deviation of the number of CD4+GFP+ or CD4–GFP+ cells per one million cells at each time point were calculated. Four to six individual G4hom mice were used for each time point. Significant differences in the number of CD4+GFP+ cells were observed between Unim and 24 h (P < 0.01), Unim and 48 h (P < 0.01) and Unim and 72 h (P < 0.01) by using the Student’s t-test.

 

   Discussion
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
References
 
Initial IL-4 producers are of great interest because they are thought to provide the first burst of IL-4 to prime naive CD4+ T cells into Th2 effector cells and thus initiate a Th2 immune response. In this report, we took advantage of an enhanced GFP as a reporter expression, which, unlike IL-4 protein, does not turn over quickly and cannot be consumed by the surrounding cells. This feature enabled us to develop and to verify the flow cytometry method to detect small numbers of GFP+ cells.

The frequencies of initial IL-4-producing CD4+ T cells, as reported by GFP expression, were low but consistent with previous studies. McHeyzer-Williams et al. (19) demonstrated that the number of CD4+ T cells that were specific for cytochrome c was ~1000 cells per draining lymph node 3 days after antigen stimulation. The number of antigen-specific CD4+ T cells that also produced IL-4 directly ex vivo was even lower (20). In another study, Stetson et al. (21) showed that the number of Leishmania-specific T cells were also low ~200 cells per lymph node at 24 and 48 h after infection.

We observed that the number of CD4+GFP+ cells increased 24 h after administration of OVA plus alum and reached peak levels at 48 h after administration of OVA plus alum. We think the increase could be the result of the activation of a small number of OVA-specific CD4+ T cells that were pre-committed with the capacity to produce IL-4. This activation explanation is consistent with the activation kinetics of GFP reporter expression in vitro. We observed that high levels of GFP expression by CD4+ T cells prepared from G4 mice required overnight TCR stimulation. It is reasonable to consider that OVA-specific CD4+ IL-4-producing T cells could divide 24 h after OVA stimulation. Indeed, this division may explain the highest number of CD4+GFP+ cells observed at 48 h after the initial antigenic stimulation. Because G4hom mice have two copies of the knock-in gfp gene and lose the ability to produce IL-4 (9), we considered the development of CD4+GFP+ cells to be IL-4 independent. It remains unclear whether a unique population of CD4+ T cells produces IL-4 or if every naive CD4+ T cell possesses an equal ability to produce IL-4 stochastically. Further characterization of CD4+GFP+ cells with unique cell-surface markers may reveal whether these cells belong to a separate lineage from conventional CD4+ T cells.

The CD4+GFP+ cells analyzed in this study resembled the phenotype of Th2 memory cells. These cells expressed IL-5, IL-13 mRNA and Th2-specific transcription factors but not IFN-{gamma} mRNA or the Th1-specific transcription factor T-bet. The CD4+GFP+ cells found in our study might include naive CD4+ T cells and resting CD4+ T cells. The resting CD4+ T cells could have previously been exposed to environmental antigens that may prepare these cells to mount a recall response to an antigen that they have never encountered before, such as OVA that is a chicken protein and was unlikely to be present in the food or in the animal facilities. It is possible that the resting CD4+ GFP+ cells, although bearing a memory phenotype, have never encountered an antigenic stimulation. Although the exact contribution to initial IL-4 production by the type of resting CD4+ T cells that are cross-primed by environmental antigens could be difficult to determine and require further study, inclusion of these cells in our study could provide a more realistic estimate of initial IL-4 production by CD4+ T cells. Together, these two types of cells could be important cellular sources of initial IL-4 production because CD4+ T cells, unlike NKT cells, basophils or eosinophils, express TCRs that can recognize a broad spectrum of antigenic structures and become activated and produce cytokines soon after first antigenic stimulation. The small amounts of IL-4 production by the CD4+ T cells could be instrumental in directing naive CD4+ T cells to differentiate into Th2, especially under certain conditions where antigenic stimulation—such as those provided by allergens and parasites—do not trigger high amounts of IL-12 and IFN-{gamma} (22–24), or under the conditions where resting CD4+ T cells of certain genetic backgrounds, for example, Balb/c background, possess significantly higher ability to produce IL-4 (25). Whether the CD4+GFP+ cells identified in this report are authentic initial IL-4-producing cells require the finding of unique surface markers and confirmation provided by adoptive transfer experiments, and our study may provide a useful model for a detailed molecular analysis of how CD4+ T cells produce initial IL-4 to initiate Th2 responses.


   Acknowledgements
 
We are grateful to William E. Paul and Christophe Pannetier for providing us with a breeding pair of IL-4/GFP reporter mice. We thank Pat Simms and Josh Loons for excellent cell sorting and Yiqing Jiang and Tom Startz for technical assistance. We thank Leah Cho for editorial assistance. This study was supported in part by a grant (ROA1 AI 48568) from the NIH (H.H.) and the Lydia Schweppe Immunology Career Development Award.


   Abbreviations
 
alum, aluminum hydroxide and magnesium
APC, allophycocyanin
G4hom, homozygous for a knock-in gfp gene in the place of exon 1 of the Il4 gene
GFP, green fluorescence protein
i.p., intra-peritoneal
MFI, mean fluorescence intensity
MLN, mesenteric lymph node
NIH, National Institutes of Health
OVA, ovalbumin peptide

   Notes
 
* This author is a former faculty member of Loyola University Chicago School of Medicine. Back

Transmitting editor: K. Murphy

Received 3 February 2006, accepted 21 December 2006.


   References
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Murphy KM and Reiner SL. (2002) The lineage decisions of helper T cells. Nat. Rev. Immunol. 2:933.[CrossRef][Web of Science][Medline]
  2. Seder RA and Paul WE. (1994) Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635.[CrossRef][Web of Science][Medline]
  3. Yoshimoto T and Paul WE. (1994) CD4pos, NK1.1pos T cells promptly produce interleukin 4 in response to in vivo challenge with anti-CD3. J. Exp. Med. 179:1285.[Abstract/Free Full Text]
  4. Yoshimoto T, Bendelac A, Watson C, Hu-Li J, Paul WE. (1995) Role of NK1.1+ T cells in a TH2 response and in immunoglobulin E production. Science 270:1845.[Abstract/Free Full Text]
  5. Le Gros G, Ben-Sasson SZ, Conrad DH, et al. (1990) IL-3 promotes production of IL-4 by splenic non-B, non-T cells in response to Fc receptor cross-linkage. J. Immunol. 145:2500.[Abstract]
  6. Kullberg MC, Berzofsky JA, Jankovic DL, et al. (1996) T cell-derived IL-3 induces the production of IL-4 by non-B, non-T cells to amplify the Th2-cytokine response to a non-parasite antigen in Schistosoma mansoni-infected mice. J. Immunol. 156:1482.[Abstract]
  7. Moqbel R, Ying S, Barkans J, et al. (1995) Identification of messenger RNA for IL-4 in human eosinophils with granule localization and release of the translated product. J. Immunol. 155:4939.[Abstract]
  8. Sabin EA, Kopf MA, Pearce EJ. (1996) Schistosoma mansoni egg-induced early IL-4 production is dependent upon IL-5 and eosinophils. J. Exp. Med. 184:1871.[Abstract/Free Full Text]
  9. Chen L, Grabowski KA, Xin JP, et al. (2004) IL-4 induces differentiation and expansion of Th2 cytokine-producing eosinophils. J. Immunol. 172:2059.[Abstract/Free Full Text]
  10. Brown MA, Pierce JH, Watson CJ, Falco J, Ihle JN, Paul WE. (1987) B cell stimulatory factor-1/interleukin-4 mRNA is expressed by normal and transformed mast cells. Cell 50:809.[CrossRef][Web of Science][Medline]
  11. Plaut M, Pierce JH, Watson CJ, Hanley-Hyde J, Nordan RP, Paul WE. (1989) Mast cell lines produce lymphokines in response to cross-linkage of Fc epsilon RI or to calcium ionophores. Nature 339:64.[CrossRef][Medline]
  12. Schmitz J, Thiel A, Kuhn R, et al. (1994) Induction of interleukin 4 (IL-4) expression in T helper (Th) cells is not dependent on IL-4 from non-Th cells. J. Exp. Med. 179:1349.[Abstract/Free Full Text]
  13. Noben-Trauth N, Hu-Li J, Paul WE. (2000) Conventional, naive CD4+ T cells provide an initial source of IL-4 during Th2 differentiation. J. Immunol. 165:3620.[Abstract/Free Full Text]
  14. Demeure CE, Yang LP, Byun DG, Ishihara H, Vezzio N, Delespesse G. (1995) Human naive CD4 T cells produce interleukin-4 at priming and acquire a Th2 phenotype upon repetitive stimulations in neutral conditions. Eur. J. Immunol. 25:2722.[Web of Science][Medline]
  15. Nurieva RI, Duong J, Kishikawa H, et al. (2003) Transcriptional regulation of Th2 differentiation by inducible costimulator. Immunity 18:801.[CrossRef][Web of Science][Medline]
  16. Hu-Li J, Pannetier C, Guo L, et al. (2001) Regulation of expression of IL-4 alleles: analysis using a chimeric GFP/IL-4 gene. Immunity 14:1.[CrossRef][Web of Science][Medline]
  17. Min B, Prout M, Hu-Li J, et al. (2004) Basophils produce IL-4 and accumulate in tissues after infection with a Th2-inducing parasite. J. Exp. Med. 200:507.[Abstract/Free Full Text]
  18. Zhang Y, Apilado R, Coleman J, et al. (2001) Interferon gamma stabilizes the T helper cell type 1 phenotype. J. Exp. Med. 194:165.[Abstract/Free Full Text]
  19. McHeyzer-Williams LJ, Panus JF, Mikszta JA, McHeyzer-Williams MG. (1999) Evolution of antigen-specific T cell receptors in vivo: preimmune and antigen-driven selection of preferred complementarity-determining region 3 (CDR3) motifs. J. Exp. Med. 189:1823.[Abstract/Free Full Text]
  20. Panus JF, McHeyzer-Williams LJ, McHeyzer-Williams MG. (2000) Antigen-specific T helper cell function: differential cytokine expression in primary and memory responses. J. Exp. Med. 192:1301.[Abstract/Free Full Text]
  21. Stetson DB, Mohrs M, Mallet-Designe V, Teyton L, Locksley RM. (2002) Rapid expansion and IL-4 expression by Leishmania-specific naive helper T cells in vivo. Immunity 17:191.[CrossRef][Web of Science][Medline]
  22. Jankovic D, Kullberg MC, Caspar P, Sher A. (2004) Parasite-induced Th2 polarization is associated with down-regulated dendritic cell responsiveness to Th1 stimuli and a transient delay in T lymphocyte cycling. J. Immunol. 173:2419.[Abstract/Free Full Text]
  23. Traidl-Hoffmann C, Mariani V, Hochrein H, et al. (2005) Pollen-associated phytoprostanes inhibit dendritic cell interleukin-12 production and augment T helper type 2 cell polarization. J. Exp. Med. 201:627.[Abstract/Free Full Text]
  24. Boldogh I, Bacsi A, Choudhury BK, et al. (2005) ROS generated by pollen NADPH oxidase provide a signal that augments antigen-induced allergic airway inflammation. J. Clin. Invest. 115:2169.[CrossRef][Web of Science][Medline]
  25. Chatelain R, Varkila K, Coffman RL. (1992) IL-4 induces a Th2 response in Leishmania major-infected mice. J. Immunol. 148:1182.[Abstract]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/3/305    most recent
dxl147v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Xin, J.
Right arrow Articles by Huang, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xin, J.
Right arrow Articles by Huang, H.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?