Skip Navigation


International Immunology Advance Access originally published online on February 25, 2008
International Immunology 2008 20(4):499-508; doi:10.1093/intimm/dxn009
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
20/4/499    most recent
dxn009v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Google Scholar
Right arrow Articles by Doi, T.
Right arrow Articles by Koyasu, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doi, T.
Right arrow Articles by Koyasu, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Author 2008. Published by Oxford University Press on behalf of The Japanese Society for Immunology. All rights reserved.
The online version of this article has been published under an open access model. Users are entitled to use, reproduce, disseminate, or display the open access version of this article for non-commercial purposes provided that: the original authorship is properly and fully attributed; the Journal and Oxford University Press and The Japanese Society for Immunology are attributed as the original place of publication with the correct citation details given; if an article is subsequently reproduced or disseminated not in its entirety but only in part or as a derivative work this must be clearly indicated. For commercial re-use, please contact journals.permissions@oxfordjournals.org

PI3K is a negative regulator of IgE production

Tomomitsu Doi1,2,4, Kunie Obayashi1,5, Takashi Kadowaki2,3, Hideki Fujii1,2 and Shigeo Koyasu1,2

1 Department of Microbiology and Immunology, Keio University School of Medicine, 35 Shinanomachi, Shinjuku-ku, Tokyo 160-8582, Japan
2 Core Research for Evolutional Science and Technology, Japan Science and Technology Agency, Saitama, Japan
3 Department of Metabolic Diseases, Graduate School of Medicine, University of Tokyo, Tokyo, Japan
4 Present address: Department of Immunology and Genomic Medicine, Kyoto University Graduate School of Medicine, Yoshida Konoe-cho, Sakyo-ku, Kyoto 606-6501, Japan
5 Present address: Department of Pharmacology, Kyoto University Graduate School of Medicine, Yoshida Konoe-cho, Sakyo-ku, Kyoto 606-6501, Japan

Correspondence to: S. Koyasu; E-mail: koyasu{at}sc.itc.keio.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 Disclosures
 References
 
The production of IgE, a main player in allergic disorders such as asthma and atopic dermatitis, is strictly regulated and the serum concentrations of IgE are normally kept at a much lower level than other isotypes. We found that mice deficient for the p85{alpha} regulatory subunit of class IA phosphoinositide 3-kinase (PI3K) produced increasing amounts of serum IgE. Purified p85{alpha}–/– B cells produced more IgE than wild-type B cells in vitro in response to anti-CD40 mAb and IL-4. PI3K inhibitors wortmannin and IC87114 enhanced IgE production by wild-type B cells stimulated with anti-CD40 mAb and IL-4. Under the same condition, antigen receptor cross-linking induced the expression of inhibitor of differentiation-2 and suppressed the expression of activation-induced cytidine deaminase and class switch recombination (CSR) in a PI3K-dependent manner. IgE production was also suppressed in a concentrated cell culture condition, which was completely reversed by PI3K inhibition. The selective suppression of IgE production by PI3K was also observed at a protein level after CSR. Our results indicate that PI3K negatively regulates IgE production at both CSR and protein levels.

Keywords: AID, class switch recombination, Id2, IC87114, IgE, PI3K, wortmannin


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 Disclosures
 References
 
IgE is involved in a defense mechanism against nematode, but at the same time, it is also a main player in allergic disorders such as asthma and atopic dermatitis (1). In normal circumstances, IgE production is strictly regulated and its serum concentration is much less than other isotypes (1). Although IgE has a relatively short half-life in plasma (2), it has been believed that the maintenance of low concentration of plasma IgE is ascribed to a tight control of IgE class switch recombination (CSR) (3, 4).

CSR takes place between two S regions located 5' to each constant region of Ig heavy chain (CH) gene. The regulation of CSR in B cells was collaborated with the germ line transcription (GLT) of CH genes and the induction of activation-induced cytidine deaminase (AID) expression. The specificity of CH switch is regulated at the level of CH GLT (5). IgE CSR is controlled by several molecules, the action of which converges on the regulation of C{epsilon} GLT that is induced by Th2 cytokines IL-4 and IL-13 (6) and inhibited by a Th1 cytokine IFN-{gamma} (7). Therefore, Th1/Th2 balance is a critical factor for IgE production.

Several transcription factors are known to regulate the balance between Th1/Th2 differentiation. Those include GATA3 (8), which promotes Th2 cell differentiation and inhibits Th1 cell differentiation, and T-bet (9), which exerts the opposite effects to GATA3. In addition, IL-21 blocks IgE production from LPS-stimulated B cells by inhibiting C{epsilon} GLT (10). Several B cell surface receptors, including the B cell receptor (BCR) (11), CD45 (12), cytotoxic T lymphocyte antigen 4 (13) and transcription factors such as Bcl-6 (14) and inhibitor of differentiation-2 (Id2) (15), seem to inhibit this process as well. Furthermore, low-affinity IgE receptor CD23 suppresses IgE production by an unknown mechanism (2, 16). Since IgG1 CSR is also regulated by IL-4 (17), if the efficiency of IgG1 and IgE CSR are the same, IgE-expressing cells must exceed IgG1-expressing cells because IgG1-expressing cells subsequently switch to IgE-expressing cells (1820). However, as mentioned, IgE production is controlled at a much lower rate than IgG1 production.

Phosphoinositide 3-kinases (PI3Ks) are lipid kinases that phosphorylate inositol phopholipids at the 3'-OH of inositol ring, generating second messengers that provide a binding site for pleckstrin homology domains of many signaling molecules (21). The PI3K family is divided into four groups (IA, IB, II and III) according to their structural characteristics and substrate specificity. Class IA PI3Ks are dimers containing one of regulatory subunits, p85{alpha}, p55{alpha}, p50{alpha}, p85β, p55{gamma} and one of catalytic subunits, p110{alpha}, p110β and p110{delta}. p85{alpha} is the most abundantly and ubiquitously expressed regulatory subunit of class IA PI3K. We and others previously reported that in mice deficient for the p85{alpha}, the number of mature B cells were reduced and the proliferation of peripheral B cells in response to BCR and LPS was severely impaired (22, 23). In addition, p85{alpha}–/– mice exhibit reduced production of Th2 cytokines and enhanced production of Th1 cytokines upon microbial infection (24, 25).

We demonstrate here that p85{alpha}–/– B cells produce more IgE than wild-type B cells and p85{alpha}–/– mice have increasing amounts of serum IgE despite the Th1-biased immune responses. The inhibition of p110{delta}, a major catalytic subunit in B cells, enhances IgE production. In addition to the inhibition of IgG1 and IgE CSR, PI3K also suppresses IgE production at a protein level. Our results indicate that PI3K is an isotype selective negative regulator for IgE production.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 Disclosures
 References
 
Reagents and antibodies
FITC-anti-IgE, biotin-anti-IgG1, biotin-anti-IgG3, PE-anti-CTLA-4 antibodies and streptavidin–allophycocyanin were purchased from BD Biosciences (San Jose, CA, USA). Propidium iodide and carboxyfluoroscein succinimidyl ester (CFSE) were purchased from Sigma (St Louis, MO, USA). Anti-trinitrophenol–IgE was produced as ascites from a hybridoma and concentration was determined by ELISA. Anti-CD19 Magnetic Cell Sorting (MACS) beads were purchased from Miltenyi Biotec (Bergisch, Gladbach Germany). Anti-CD40 antibody was purchased from eBioscience (San Diego, CA, USA). Recombinant IL-4, IFN-{gamma} and IL-21 were purchased from Peprotech (London, UK). Anti-IgM antibody F(ab)'2 fragment was purchased from Jackson ImmunoResearch (Bar Harbor, ME, USA).

Mice and immunization
p85{alpha}–/– mice (22) on a C57BL/6 background were maintained under specific pathogen-free conditions at Taconic (Germantown, NY, USA) or our animal facility. p85{alpha}–/– and p85{alpha}+/– mice were obtained by intercrossing heterozygous (p85{alpha}+/–) female mice with homozygous (p85{alpha}–/–) male mice and littermate mice were used for each experiment. C57BL/6 mice were obtained from Sankyo Laboratory Service Company (Tokyo Japan). All animal experiments were performed in accordance with our institutional guidelines. Mice were immunized intra-peritoneally with 100 µg of (4-hydroxy-3-nitrophenyl) acetyl (NP)-conjugated chicken {gamma} globulin (CGG) (NP-CGG) precipitated with alum or 5 µg of NP-CGG mixed with a CpG-based ImmunEagy mouse adjuvant (Qiagen) and boosted with 50 µg of soluble NP-CGG 71 days after primary immunization.

Immunohistochemistry
Tissue samples from spleen from immunized mice were frozen in Tissue-Tek O.C.T. compound (Sakura Finetechnical). Tissue sections (6 µm thick) were prepared and fixed in acetone for 10 min. Endogenous peroxidase was blocked with 0.3% H2O2 in PBS for 10 min. Cells were stained with biotin-conjugated peanut agglutinin and streptavidin–HRP and counterstained with hematoxylin.

B cell purification and cell culture
Single cell suspensions of spleen cells were prepared, and red blood cells were removed by hypotonic lysis. B cells were purified with anti-CD19 magnetic beads using AutoMACS (Miltenyi Biotec). Alternatively, splenocytes were incubated with FITC–anti-IgE, FITC–anti-CD11c, PE–anti-CD3{epsilon}, PE–anti-Gr-1 antibodies followed by anti-FITC and anti-PE magnetic beads and naive B cells were purified by AutoMACS with a negative selection procedure according to the manufacturer’s recommendation. The purity of splenic B cells and naive B cells were 95% and 85%, respectively. Essentially same results were obtained by both preparations. One hundred thousand B cells were cultured in one well of 96-well plates with 200 µl of complete medium (RPMI 1640 containing 10% FCS, sodium pyruvate, non-essential amino acid, penicillin and streptomycin) unless otherwise stated. For IgG1 and IgE CSR, B cells were stimulated with 5 µg ml–1 anti-CD40 antibodies and 10 ng ml–1 IL-4 for 4 days. For IgG3 CSR, cells were stimulated with 5 µg ml–1 anti-CD40 and 10 µg ml–1 LPS for 5 days.

Flow cytometric analysis
PBS containing 0.5% BSA and 10 mM ethyleneglycol-bis(2-aminoethylether)-N,N,N',N'-tetraacetic acid (EGTA) was used for staining except for the experiment shown in Fig. 1D where EGTA was omitted. Since secreted IgE binds B cell surface via CD23, EGTA treatment that removes bound IgE from CD23 is important to quantitate surface IgE expression. Cells were stained with biotin–anti-IgG1 or anti-IgG3 antibodies in 50% of normal rat serum. After washing, cells were stained with FITC–anti-IgE antibody and streptavidin–allophycocyanin. For intracellular staining, cells were fixed and permeabilized in 70% ethanol and stained with FITC–anti-IgE antibody.


Figure 1
View larger version (44K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Enhanced IgE production in p85{alpha}–/–mice. Mice were immunized with alum-precipitated NP-CGG and boosted with soluble NP-CGG after 71 days. Open and filled circles in (A) and (C) show the titers of p85{alpha}+/ (n = 6), p85{alpha}–/– mice (n = 7), respectively. (A) NP-specific IgM, IgG1 and IgG2a responses were measured by ELISA. RU; relative unit. (B) Spleen sections from immunized p85{alpha}+/ and p85{alpha}–/– naive mice. Cells were stained with peanut agglutinin and hematoxylin. Brown is PNA. (C) NP-specific IgE (left) and total IgE (right) were measured by ELISA. **P < 0.01, *P < 0.05. (D) Splenocytes from p85{alpha}+/ and p85{alpha}–/– naive mice were stained with anti-CD19 and anti-IgE with or without EGTA pre-treatment. (E) Three hundred micrograms of trinitrophenol-specific IgE was injected intravenously to p85{alpha}+/ and p85{alpha}–/– mice (n = 4). After 1, 3, 5 days, serum trinitrophenol-specific IgE concentrations were measured by ELISA. Open and filled circles show the IgE titer of p85{alpha}+/ and p85{alpha}–/– mice, respectively.

 
ELISA and ELISPOT
NP-specific antibody titers were determined by ELISA using microtiter plates coated with NP–BSA. NP–BSA-coated plates were incubated with 1% BSA for blocking non-specific biding, and diluted serum samples were added to individual wells. Bound antibodies were revealed by HRP-conjugated anti-IgG1, IgG2a, IgM (SouthernBiotech, Birmingham, AL, USA) or IgE (Bethyl, Montgomery TX, USA) antibodies.

The frequency of IgE-producing cells was determined by enzyme-linked immunospot (ELISPOT) using anti-IgE antibody-coated filter plates. B cells (105 or 106) were plated in one well with culture medium. Plates were incubated at 37°C in a CO2 incubator for 5 h. Spots derived from IgE-producing cells were visualized with HRP-conjugated anti-IgE antibody.

Reverse transcription–PCR and digestion circularization–PCR
Total RNA was purified with Trizol reagent (Invitrogen, San Diego, CA, USA). Two micrograms of total RNA was used for reverse transcription. The amounts of mRNAs for AID, C{gamma}1-GLT, {gamma}1-circle transcript (CT), C{epsilon}-GLT, Iµ-C{epsilon}-post-switch transcript (PST), Id2 and β-actin were measured by semi-quantitative PCR. Digestion circularization (DC)–PCR was previously described (7, 26). Briefly, genomic DNA was digested with EcoRI. Self-ligated DNA fragments were used for PCR. PCR was done with the following primer pairs: AID, CAATTTTCAGATCGCGTCCCT and GCGCTTTGCTCCTTTCTCTACA; {gamma}1-CT, GGCCCTTCCAGATCTTTGAG and AATGGTGCTGGGCAGGAAGT; C{gamma}1-GLT, GGCCCTTCCAGATCTTTGAG and GGATCCAGAGTTCCAGGTCACT; C{epsilon}-GLT, CATCTGGGCATGAATTAATGGTTACTA and GTAGCTCCAAGGTGGGCTCAGT; Id2, CAGCCATTTCACCAGGAGAACA and CAGCATTCAGTAGGCTCGTGTCA; Iµ-C{epsilon}-PST, CTCTGGCCCTGCTTATTGTTG and GTAGCTCCAAGGTGGGCTCAGT; β-actin, GTGGGCCGCTCTAGCCACCAA and TCTTTGATGTCACGCACGATTTC; nAChR DC-PCR, GGCCGGTCGACAGGCGCGCACTGACACCACTAAG and GCGCCATCGATGGACTGCTGTGGGTTTCACCCAG; Sµ-S{gamma}1 DC-PCR, GGCCGGTCGACGGAGACCAATAATCAGAGGGAAG and GCGCCATCGATGGAGAGCAGGGTCTCCTGGGTAGG and Sµ-S{epsilon} DC-PCR, GTCCTTCAATTTCTTACATAACC and ATGCAGGATACACCCCAGAC.

Statistics
We used Mann–Whitney’s U-test for statistical analysis of in vivo experiments and unpaired Student’s t-test for statistical analysis of in vitro experiments.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 Disclosures
 References
 
Enhanced IgE production in p85{alpha}–/– mice
To investigate antibody response to T cell-dependent antigen in p85{alpha}–/– mice, mice were immunized with alum-precipitated NP-CGG and boosted with soluble NP-CGG on day 71. NP-specific IgM, IgG1, IgG2a and IgE titers were analyzed by ELISA (Fig. 1). In p85{alpha}–/– mice, IgM, IgG1 and IgG2a responses to NP were comparable to or slightly less than those of p85{alpha}+/– mice (Fig. 1A). Germinal center formation after immunization was impaired in p85{alpha}–/– mice compared with wild-type mice (Fig. 1B). These results are consistent with our previous observation that mature B cell numbers are reduced in p85{alpha}–/– mice and BCR- and LPS-mediated activation is partially impaired in p85{alpha}–/– B cells (22).

Unexpectedly, p85{alpha}–/– mice produced significantly more NP-specific IgE than p85{alpha}+/– mice from 14 days after immunization and the higher titers were sustained for up to 70 days (Fig. 1C, left panel). Upon the secondary immunization with soluble NP-CGG, the concentration of NP-specific serum IgE was increased and the titers were higher in p85{alpha}–/– than p85{alpha}+/– mice. Total serum IgE of p85{alpha}–/– mice was also higher than that of p85{alpha}+/– mice at 14 days after immunization (Fig. 1C, right panel). These results indicate that the lack of p85{alpha} leads to higher IgE response. Since alum is a strong inducer of T cell-independent IL-4 production (27), CpG-based adjuvant was used to examine if enhancement of IgE production is due to alum-based immunization. Although CpG-based adjuvant barely induced IgE in p85{alpha}+/– mice, the adjuvant strongly induced IgE production in p85{alpha}–/– mice (data not shown), further demonstrating that the lack of p85{alpha} results in a higher IgE response.

Before immunization, serum IgE titer was extremely low and close to or below detection sensitivity because free IgE is trapped by tissue mast cells and B cells via the high-affinity IgE receptor Fc{epsilon}RI and the low-affinity IgE receptor CD23, respectively. When B cells from unimmunized mice were stained with anti-IgE antibody, substantial amounts of IgE were detected on the surface of most splenic B cells from p85{alpha}–/– mice, while only low amounts were detected on B cells from p85{alpha}+/– mice (Fig. 1D). Such surface IgE was removed by treating cells with EGTA, confirming that these IgE molecules bound B cells via CD23. These results indicate that p85{alpha}–/– mice produce more IgE than p85{alpha}+/– mice even under naive conditions.

Since IgE is rapidly cleared from the serum compared with other isotypes, it is possible that IgE clearance is impaired in p85{alpha}–/– mice. To test this possibility, IgE was exogenously injected to p85{alpha}+/– and p85{alpha}–/– mice and serum IgE concentrations were measured (Fig. 1E). There was no difference in the kinetics of IgE clearance between p85{alpha}+/– and p85{alpha}–/– mice. These results collectively indicate that IgE production is accelerated in p85{alpha}–/– mice without changing IgE clearance from the serum.

Enhanced IgE production by p85{alpha}–/– B cells
To determine whether the dysregulation of IgE production in p85{alpha}–/– mice is B cell autonomous, splenic B cells from p85{alpha}–/– and p85{alpha}+/– mice were stimulated with anti-CD40 and IL-4 to induce CSR to IgG1 and IgE in vitro. The amounts of IgM and IgG1 produced by p85{alpha}–/– B cells in the supernatant were lower than or comparative to those of p85{alpha}+/– B cells. In contrast, the production of IgE from p85{alpha}–/– B cells was higher than that of p85{alpha}+/– B cells (Fig. 2A). Flow cytometric analysis and ELISPOT assay also demonstrated that higher percentage of B cells expressed IgE in p85{alpha}–/– B cells than p85{alpha}+/– B cells (Fig. 2B and C). These results indicate that p85{alpha} deficiency in B cells enhances IgE production.


Figure 2
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Enhanced IgE production in p85{alpha}–/– B cells. (A) Purified splenic B cells were stimulated with 5 µg ml–1 anti-CD40 and indicated concentrations of IL-4. After 4 days, IgE, IgG1 and IgM titers in culture supernatants were measured by ELISA. White and black bars show the titers of p85{alpha}+/ and p85{alpha}–/– B cells, respectively. (B) The indicated numbers of p85{alpha}+/ and p85{alpha}–/– B cells were stimulated with 5 µg ml–1 anti-CD40 and 10 ng ml–1 IL-4 in 200 µl culture medium. The expression of IgG1 and IgE on the cell surface was analyzed by flow cytometry. The percentages of IgG1+ and IgE+ cells are indicated at each gate. (C) B cells were stimulated as in (A). The numbers of IgE-producing cells were counted by ELISPOT in duplicate cultures. Data are representatives of three independent experiments; data are shown as mean ± SD.

 
Kinase activity of PI3K is required for IgE suppression
The major catalytic subunit of class IA PI3K expressed in B cells is p110{delta} and the lack of p85{alpha}, which stabilizes p110s (28, 29), greatly reduced the expression of p110{delta} (30). To determine whether the kinase activity of PI3K is required for IgE suppression, PI3K was inhibited with pharmacological inhibitors and cell surface expression of IgG1, IgG3 and IgE was examined by flow cytometry (Fig. 3A). IC87114, a specific inhibitor of p110{delta} (31), enhanced the number of cells expressing IgE but not those expressing IgG1 or IgG3, indicating that PI3K activity is required for IgE-selective suppression. It is possible that the high percentages of IgE-positive cells are caused by the specific survival of IgE-positive cells compared with B cells expressing other isotypes in the presence of PI3K inhibitor. However, IC87114 treatment for 3 days increased absolute number of IgE-positive cells (Fig. 3B) without affecting cell division as examined by the dilution of fluorescence intensity of CFSE-labeled B cells (Fig. 3C), confirming that the inhibition of PI3K enhances IgE CSR rather than the selective survival or proliferation of IgE-expressing B cells.


Figure 3
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. The kinase activity of PI3K is required for IgE suppression. (A) Splenic B cells (1 x 106 in 200 µl) were stimulated with 5 µg ml–1 anti-CD40 and 10 ng ml–1 IL-4 for IgG1 and IgE CSR, 5 µg ml–1 anti-CD40 and 10 µg ml–1 LPS for IgG3 CSR with (IC) or without (–) 5 µM IC87114. CSR was analyzed by flow cytometry. The percentages of B cells expressing IgG1, IgE, and IgG3 were indicated at each gate. (B) The absolute number of IgE+ cells at indicated days after stimulation. B cells were cultured in duplicate. Data are representatives of two independent experiments and are shown as mean ± SD. (C) CFSE-labeled B cells were cultured with anti-CD40 and IL-4 for 3 days in the presence (IC) or absence (–) of 5 µM IC87114. CFSE fluorescence intensities were analyzed by flow cytometry.

 
Inhibition of PI3K enhances CSR to IgE and IgG1
We next examined the mechanisms of enhanced IgE production by inhibiting PI3K. First, CSR was assayed by DC–PCR and it was revealed that the PI3K inhibitor enhanced both IgE and IgG1 CSR induced by anti-CD40 and IL-4 (Fig. 4A), indicating that PI3K activity directly suppresses IgE production by blocking IgE CSR. It has been known that BCR signal suppresses IgE and IgG1 CSR (11). We then tested the effect of PI3K inhibitor on the BCR-mediated suppression of CSR. As shown in Fig. 4B, BCR cross-linking suppressed IgE CSR at the C{epsilon} GLT level. Interestingly, the same signal suppressed IgG1 CSR as examined by {gamma}1-CT but C{gamma}1-GLT was unaffected (Fig. 4B). CSR examined by C{gamma}1-CT and C{epsilon}-GLT was partially recovered by wortmannin. Partial recovery of IgG1 CSR was confirmed by flow cytometric analysis (Fig. 4C). BCR signal also suppressed the expression of AID but induced Id2. Such inhibition of AID and induction of Id2 were partially reversed with PI3K inhibitor wortmannin, suggesting that PI3K is also involved in the BCR-mediated effects on CSR.


Figure 4
View larger version (32K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. BCR cross-linking inhibits IgG1 and IgE CSR via PI3K. B cells (1 x 105 in 200 µl) were stimulated with 5 µg ml–1 anti-CD40 and 10 ng ml–1 IL-4. (A) B cells were stimulated for 2 or 3 days with or without 5 µM IC87114. Sµ-S{gamma}1 and Sµ-S{epsilon} recombination was detected by DC–PCR. Nicotinic acetylcholine receptor (nAchR) was used as internal control for DC–PCR. (B) B cells were stimulated with or without 1 µg ml–1 anti-µ antibody with or without 100 nM of wortmannin for 2 days. The expression of β-actin, AID, {gamma}1-CT, C{gamma}1-GLT, C{epsilon}-GLT and Id2 were measured by real-time PCR. PCR was done in duplicate and data are shown as mean ± SD. and representatives of three independent experiments are presented. (C) Splenic B cells were stimulated for 3 days with or without 100 nM wortmannin and the expression of IgG1 and IgE on the cell surface was analyzed by flow cytometry. (D) Flow cytometric analysis of stimulated B cells in the presence of 100 U ml–1 of IFN-{gamma} or 20 ng ml–1 of IL-21 with or without 5 µM IC87114 for 4 days. The percentages of IgG1+ and IgE+ cells are indicated at each gate.

 
It is known that a Th1 cytokine IFN-{gamma} suppresses IgE production but IC87114 had no effect on IFN-{gamma}-mediated suppression of IgE CSR (Fig. 4D). It has been reported that IL-21 specifically inhibits IgE CSR induced by a combination of LPS and IL-4 (10). However, IL-21 enhanced IgE CSR in B cells stimulated by a combination of anti-CD40 and IL-4. IC87114 treatment killed B cells in the presence of IL-21 (Fig. 4D).

PI3K-mediated cell density-dependent IgE suppression at post-translational level
It is known that IgE CSR is sensitive to cell density and IgE production is suppressed in high-density cell cultures (32). Enhanced IgE induction by p85{alpha}–/– B cells was more prominent in high-density cultures (Fig. 2B) as p85{alpha}+/– B cells were more sensitive to cell density than p85{alpha}–/– B cells. This observation prompted us to test the involvement of PI3K in cell density-dependent IgE suppression. IgE secretion and the percentages of IgE+ cells decreased as cell density increased (Fig. 5A and B: thin lines). The inhibition of PI3K cancelled this suppression as IgE production became proportional to the cell numbers in the presence of IC87114 (Fig. 5A). In addition, the percentages of IgE+ B cells were independent of cell density in the presence of IC87114 (Fig. 5B: thick lines). These results indicate that PI3K is involved in the cell density-dependent suppression of IgE production. Such density-dependent suppression was not observed for IgM and IgG1 secretion or IgM+ and IgG1+ cell numbers, indicating that the cell density-dependent suppression is specific for IgE production.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. Cell density-dependent IgE suppression is mediated by PI3K activity. The indicated concentrations of B cells were stimulated with 5 µg ml–1 anti-CD40 and 10 ng ml–1 IL-4 for 4 days with (square) or without (diamond) 5 µM IC87114. (A) The concentration of each isotype in the supernatant was measured by ELISA. (B) The percentages of IgE+ and IgG1+ were analyzed by flow cytometry. B cells were cultured in duplicate. Data are the mean ± SD. (C) The indicated numbers of cells were stimulated with 5 µg ml–1 anti-CD40 and 10 ng ml–1 IL-4 for 2 days. Iµ-C{epsilon}-PST was detected by reverse transcription–PCR. The amount of cDNA was normalized by β-actin. Five-fold serial dilutions of cDNAs were amplified. (D) The indicated numbers of cells were stimulated with (IC) or without (–) 5 µM of IC87114 for 4 days. Intracellular IgE was stained and analyzed by flow cytometry. The percentages of IgE+ cells are indicated at each gate. The mean fluorescence intensities of IgE are indicated under each panel. Data are representatives of three independent experiments.

 
Even though IgE production was suppressed by high cell density, the amounts of IgE mRNA were unaffected by cell density as examined by the amounts of Iµ-C{epsilon}-PST (Fig. 5C). When total IgE was stained by an intracellular staining method, it was revealed that the percentages of IgE-positive cells were not dramatically affected by cell density but the mean fluorescence intensity of IgE staining decreased as cell density increased (Fig. 5D), suggesting that the cell density-dependent inhibition of IgE is regulated at a protein synthesis, degradation and/or transport level. The inhibition of PI3K still elevated IgE amounts in high-cell density cultures compared with untreated cultures. These results collectively indicate that PI3K negatively regulates IgE production at both CSR and protein levels.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 Disclosures
 References
 
Mast cells play a central role in allergic responses by releasing inflammatory substances. The activation of mast cells is triggered by the binding of allergen in complex with allergen-specific IgE to the high-affinity IgE receptors Fc{epsilon}RI. Since the pharmacological inhibition of p110{delta} reduced mast cell activation and protected mice against passive systemic anaphylactic allergic responses, p110{delta} was proposed to be a new target for therapeutic intervention in allergic diseases (33). As shown here, however, the inhibition of PI3K including p110{delta} augments IgE responses, raising the possibility that the inhibition of PI3K pathway in vivo may not be beneficial for the protection of allergic disorders. As demonstrated by the binding of higher amounts of IgE on p85{alpha}–/– B cell surface via CD23 compared with those of wild-type B cells, the lack of p85{alpha} leads to higher level of IgE production even without immunization. In addition, we sometimes observed significant amounts of IgE in the serum of unimmunized p85{alpha}–/– mice, indicating that IgE production is generally enhanced in the absence of p85{alpha}. Although it has been reported that the basal level of serum IgE in p110{delta}–/– mice is comparable to that of wild-type mice (34), it will be of interest to examine the IgE response to exogenous antigen in those mice. In vitro induction of IgE CSR in p110{delta}–/– B cells will also be informative to compare the phenotype observed in p85{alpha}–/– mice in future studies.

Since the augmentation of IgE production by p85{alpha}–/– B cells was reproduced by the inhibition of p110{delta} kinase activity with an isoform-specific inhibitor IC87114, it is likely that p85{alpha} suppresses IgE production by recruiting p110{delta} catalytic subunit rather than functioning as a GTPase activating protein (GAP) activity (35) that is independent of the kinase activity of PI3K. In addition, these results indicate that the PI3K activity in B cells autonomously regulates IgE production. It is of note that B cells deficient for phosphatase and tensin homolog deleted on chromosome 10 (PTEN), a negative regulator of PI3K, are unable to induce AID and CSR (36, 37), which is consistent with our observation. Downstream target of PI3K to suppress IgE production is elusive at the moment. BCR signal and cell–cell interaction must transduce signals through PI3K for IgE inhibition because CD40 and IL-4 receptor also activate PI3K via tumor necrosis factor receptor associated factor 6 (TRAF6) (38) and insulin receptor substrate 1 (IRS1) (39) molecules, respectively.

Our results demonstrate that PI3K negatively regulates IgE production through two different mechanisms. First mechanism is the suppression of CSR for both IgG1 and IgE. It has been reported that the cross-linking of BCR inhibits CSR to IgG1 and IgE mediated by CD40 and IL-4 regardless of their effect on proliferation (11, 40) and the inhibition of PI3K partially restored the effect of BCR cross-linking (Fig. 4). In this context, it is of interest to note that high-dose allergen exposure specifically prevents IgE production and allergic responses (4144). The mechanism of BCR-mediated CSR inhibition for IgE seems different from that for IgG1 as BCR cross-linking blocks C{epsilon} GLT but not C{gamma}1 GLT. BCR cross-linking induces the expression of Id2, which inhibits C{epsilon}-GLT (15) and, to a lesser extent, AID expression (45). While the block of AID induction results in the inhibition of IgG1 CSR in B cells stimulated by anti-CD40 and IL-4, IgE CSR is likely regulated at both AID induction and C{epsilon} GLT levels. As shown here, BCR-mediated Id2 induction was partially dependent on PI3K, implying the involvement of Id2 in the PI3K-mediated negative regulation of IgE CSR. Although Id2 is known to inhibit IgE CSR, Id2 is unlikely a main factor of PI3K-mediated IgE suppression because IC87114 also enhanced IgE CSR in Id2–/– B cells (T. Doi, K. Obayashi and S. Koyasu, unpublished observation). In addition, it is known that IgE production is still lower than IgG1 in Id2–/– mice (15).

If the efficiency of IgG1 and IgE CSR is the same and IgG1 and IgE CSR occur independently, the percentages of IgG1-expressing cells must be lower than those of IgE-expressing cells because a part of IgG1-expressing cells subsequently switch to IgE-expressing cells (1820). The fact that both IgG1 and IgE CSRs are negatively regulated by PI3K (Fig. 4A) yet the percentage of IgE-expressing cells is much lower than that of IgG1-expressing cells suggests the presence of another IgE-selective suppression mechanisms. Such second mechanism seems operative at the protein level as PI3K reduces IgE protein expression. It has previously been reported that IgE production is suppressed in a concentrated cell culture in vitro (32), which may explain the fact that IgE-expressing B cells are >1000 times more frequent in the nasal mucosa, which contain fewer B cells, than other lymphoid tissues (46). Our present results indicate that such density-dependent suppression is completely dependent on PI3K signaling (Fig. 5). The amount of IgE mRNA was not suppressed in high-density cultures, suggesting that the density-dependent suppression is controlled at a protein level. Although the mechanism is unclear at the moment, there are several possibilities. IgE expression may be suppressed at the level of protein synthesis, intracellular trafficking, internalization or degradation. Decrease of IgE+ cells at high density may be due to internalization of IgE as has been shown for CTLA-4 in naive T cells (47). If this were the case, anti-IgE antibody added to the culture medium of IgE-expressing cells would accumulate inside the cells. To test this possibility, we compared the accumulation of FITC-conjugated anti-IgE antibody by IgE-expressing B cells at 37 or 4°C. No accumulation of anti-IgE antibody in B cells was observed after 3 h incubation at concentrated cell culture, while anti-CTLA-4 antibody accumulated in T cells at 37°C as reported (T. Doi, K. Obayashi and S. Koyasu, unpublished observation). Thus the lack of surface IgE is unlikely due to enhanced internalization. The total amount of IgE examined by intracellular staining was much lower in the absence of PI3K inhibitor than that in the presence of the inhibitor (Fig. 5). Therefore, PI3K-dependent degradation and/or block of IgE protein synthesis are more likely to explain IgE reduction at the protein level.

It has been reported that basal signal or tonic signal through BCR is critical for the survival of peripheral B cells and that B cells are eliminated from body shortly after BCR ablation (48). It is possible that PI3K-dependent suppression of surface IgE expression leads to the specific elimination of IgE-positive cells after IgE production, which should be examined in future studies.


    Funding
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 Disclosures
 References
 
Mitsubishi Foundation; a Grant-in-Aid for Scientific Research (B) (16390146, 18390155) from the Japan Society for the Promotion of Science; National Grant-in-Aid for the Establishment of a High-Tech Research Center in a private University; Scientific Frontier Research Grant from the Ministry of Education, Culture, Sports, Science and Technology, Japan; Research Fellowship of the Japan Society for the Promotion of Science for Young Scientists to T.D.; 21st Century Center of Excellence Program from the Ministry of Education, Culture, Sports, Science and Technology, Japan to K.O.


    Disclosures
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 Disclosures
 References
 
The authors have no financial conflict of interest.


    Acknowledgements
 
We thank M. Motouchi, N. Yumoto and K. Takei for animal care and M. Muramatsu, K. Kinoshita and L. K. Clayton for critical reading of the manuscript and valuable suggestions. Thanks are also due to C. Sadhu and J. Hayflick of ICOS Corporation for the generous gifts of IC87114.

Funding to pay the Open Access publication charges for this article was provided by Keio University School of Medicine.


    Abbreviations
 
AID, activation-induced cytidine deaminase
BCR, B cell receptor
CGG, chicken {gamma}globulin
CFSE, carboxyfluoroscein succinimidyl ester
CSR, class switch recombination
CT, circle transcript
DC, digestion circularization
GLT, germ line transcription
Id2, inhibitor of differentiation-2
NP, (4-hydroxy-3-nitrophenyl) acetyl
PI3K, phosphoinositide 3-kinase
PST, post-switch transcript

    Notes
 
Transmitting editor: T. Kurosaki Back

Received 17 September 2007, accepted 11 January 2008.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Funding
 Disclosures
 References
 

  1. Geha R, Jabara H, Brodeur S. The regulation of immunoglobulin E class-switch recombination. Nat. Rev. Immunol. (2003) 3:721.[CrossRef][Web of Science][Medline]
  2. Yu P, Kosco-Vilbois M, Richards M, Kohler G, Lamers M. Negative feedback regulation of IgE synthesis by murine CD23. Nature. (1994) 369:753.[CrossRef][Medline]
  3. Snapper C, Finkelman F, Paul W. Differential regulation of IgG1 and IgE synthesis by interleukin 4. J. Exp. Med. (1988) 167:183.[Abstract/Free Full Text]
  4. Mao C, Stavnezer J. Differential regulation of mouse germline Ig {gamma}1 and {epsilon} promoters by IL-4 and CD40. J. Immunol. (2001) 167:1522.[Abstract/Free Full Text]
  5. Lutzker S, Rothman P, Pollock R, Coffman R, Alt F. Mitogen- and IL-4-regulated expression of germ-line Ig {gamma}2b transcripts: evidence for directed heavy chain class switching. Cell. (1988) 53:177.[CrossRef][Web of Science][Medline]
  6. de Vries J, Punnonen J, Cocks B, de Waal Malefyt R, Aversa G. Regulation of the human IgE response by IL4 and IL13. Res. Immunol. (1993) 144:597.[CrossRef][Web of Science][Medline]
  7. Xu L, Rothman P. IFN-{gamma} represses {epsilon} germline transcription and subsequently down-regulates switch recombination to {epsilon}. Int. Immunol. (1994) 6:515.[Abstract/Free Full Text]
  8. Zheng W, Flavell R. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell. (1997) 89:587.[CrossRef][Web of Science][Medline]
  9. Szabo S, Kim S, Costa G, Zhang X, Fathman C, Glimcher L. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell. (2000) 100:655.[CrossRef][Web of Science][Medline]
  10. Suto A, Nakajima H, Hirose K, et al. Interleukin 21 prevents antigen-induced IgE production by inhibiting germ line C({epsilon}) transcription of IL-4-stimulated B cells. Blood. (2002) 100:4565.[Abstract/Free Full Text]
  11. Rush J, Hasbold J, Hodgkin P. Cross-linking surface Ig delays CD40 ligand- and IL-4-induced B cell Ig class switching and reveals evidence for independent regulation of B cell proliferation and differentiation. J. Immunol. (2002) 168:2676.[Abstract/Free Full Text]
  12. Yamada T, Zhu D, Saxon A, Zhang K. CD45 controls interleukin-4-mediated IgE class switch recombination in human B cells through its function as a Janus kinase phosphatase. J. Biol. Chem. (2002) 277:28830.[Abstract/Free Full Text]
  13. Pioli C, Gatta L, Ubaldi V, Doria G. Inhibition of IgG1 and IgE production by stimulation of the B cell CTLA-4 receptor. J. Immunol. (2000) 165:5530.[Abstract/Free Full Text]
  14. Harris M, Chang C, Berton M, et al. Transcriptional repression of Stat6-dependent interleukin-4-induced genes by BCL-6: specific regulation of i{epsilon} transcription and immunoglobulin E switching. Mol. Cell. Biol. (1999) 19:7264.[Abstract/Free Full Text]
  15. Sugai M, Gonda H, Kusunoki T, Katakai T, Yokota Y, Shimizu A. Essential role of Id2 in negative regulation of IgE class switching. Nat. Immunol. (2003) 4:25.[CrossRef][Web of Science][Medline]
  16. Sherr E, Macy E, Kimata H, Gilly M, Saxon A. Binding the low affinity Fc{epsilon}R on B cells suppresses ongoing human IgE synthesis. J. Immunol. (1989) 142:481.[Abstract]
  17. Linehan L, Warren W, Thompson P, Grusby M, Berton M. STAT6 is required for IL-4-induced germline Ig gene transcription and switch recombination. J. Immunol. (1998) 161:302.[Abstract/Free Full Text]
  18. Yoshida K, Matsuoka M, Usuda S, Mori A, Ishizaka K, Sakano H. Immunoglobulin switch circular DNA in the mouse infected with Nippostrongylus brasiliensis: evidence for successive class switching from µ to {epsilon} via {gamma}1. Proc. Natl Acad. Sci. USA. (1990) 87:7829.[Abstract/Free Full Text]
  19. Mills F, Thyphronitis G, Finkelman F, Max E. Ig µ-{epsilon} isotype switch in IL-4-treated human B lymphoblastoid cells. Evidence for a sequential switch. J. Immunol. (1992) 149:1075.[Abstract]
  20. Siebenkotten G, Esser C, Wabl M, Radbruch A. The murine IgG1/IgE class switch program. Eur. J. Immunol. (1992) 22:1827.[Web of Science][Medline]
  21. Koyasu S. The role of PI3K in immune cells. Nat. Immunol. (2003) 4:313.[CrossRef][Web of Science][Medline]
  22. Suzuki H, Terauchi Y, Fujiwara M, et al. Xid-like immunodeficiency in mice with disruption of the p85{alpha} subunit of phosphoinositide 3-kinase. Science. (1999) 283:390.[Abstract/Free Full Text]
  23. Fruman D, Snapper S, Yballe C, et al. Impaired B cell development and proliferation in absence of phosphoinositide 3-kinase p85{alpha}. Science. (1999) 283:393.[Abstract/Free Full Text]
  24. Fukao T, Tanabe M, Terauchi Y, et al. PI3K-mediated negative feedback regulation of IL-12 production in DCs. Nat. Immunol. (2002) 3:875.[CrossRef][Web of Science][Medline]
  25. Fukao T, Yamada T, Tanabe M, et al. Selective loss of gastrointestinal mast cells and impaired immunity in PI3K-deficient mice. Nat. Immunol. (2002) 3:295.[CrossRef][Web of Science][Medline]
  26. Chu C, Paul W, Max E. Quantitation of immunoglobulin µ-{gamma}1 heavy chain switch region recombination by a digestion-circularization polymerase chain reaction method. Proc. Natl Acad. Sci. USA. (1992) 89:6978.[Abstract/Free Full Text]
  27. Jordan M, Mills D, Kappler J, Marrack P, Cambier J. Promotion of B cell immune responses via an alum-induced myeloid cell population. Science. (2004) 304:1808.[Abstract/Free Full Text]
  28. Toker A, Cantley L. Signalling through the lipid products of phosphoinositide-3-OH kinase. Nature. (1997) 387:673.[CrossRef][Medline]
  29. Katso R, Okkenhaug K, Ahmadi K, White S, Timms J, Waterfield M. Cellular function of phosphoinositide 3-kinases: implications for development, homeostasis, and cancer. Annu. Rev. Cell Dev. Biol. (2001) 17:615.[CrossRef][Web of Science][Medline]
  30. Suzuki H, Matsuda S, Terauchi Y, et al. PI3K and Btk differentially regulate B cell antigen receptor-mediated signal transduction. Nat. Immunol. (2003) 4:280.[CrossRef][Web of Science][Medline]
  31. Bilancio A, Okkenhaug K, Camps M, et al. Key role of the p110{delta} isoform of PI3K in B-cell antigen and IL-4 receptor signaling: comparative analysis of genetic and pharmacologic interference with p110{delta} function in B cells. Blood. (2006) 107:642.[Abstract/Free Full Text]
  32. Rabah D, Conrad D. Effect of cell density on in vitro mouse immunoglobulin E production. Immunology. (2002) 106:503.[CrossRef][Web of Science][Medline]
  33. Ali K, Bilancio A, Thomas M, et al. Essential role for the p110{delta} phosphoinositide 3-kinase in the allergic response. Nature. (2004) 431:1007.[CrossRef][Medline]
  34. Okkenhaug K, Bilancio A, Farjot G, et al. Impaired B and T cell antigen receptor signaling in p110{delta} PI 3-kinase mutant mice. Science. (2002) 297:1031.[Abstract/Free Full Text]
  35. Chamberlain M, Berry T, Pastor M, Anderson D. The p85{alpha} subunit of phosphatidylinositol 3'-kinase binds to and stimulates the GTPase activity of Rab proteins. J. Biol. Chem. (2004) 279:48607.[Abstract/Free Full Text]
  36. Suzuki A, Kaisho T, Ohishi M, et al. Critical roles of Pten in B cell homeostasis and immunoglobulin class switch recombination. J. Exp. Med. (2003) 197:657.[Abstract/Free Full Text]
  37. Omori S, Cato M, Anzelon-Mills A, et al. Regulation of class-switch recombination and plasma cell differentiation by phosphatidylinositol 3-kinase signaling. Immunity. (2006) 25:545.[CrossRef][Web of Science][Medline]
  38. Arron J, Vologodskaia M, Wong B, et al. A positive regulatory role for Cbl family proteins in tumor necrosis factor-related activation-induced cytokine (trance) and CD40L-mediated Akt activation. J. Biol. Chem. (2001) 276:30011.[Abstract/Free Full Text]
  39. Wang L, Keegan A, Paul W, Heidaran M, Gutkind J, Pierce J. IL-4 activates a distinct signal transduction cascade from IL-3 in factor-dependent myeloid cells. EMBO J. (1992) 11:4899.[Web of Science][Medline]
  40. Cho S, Conrad D. A new multivalent B cell activation model—anti-IgD bound to Fc{gamma}RI: properties and comparison with CD40L-mediated activation. Int. Immunol. (1997) 9:239.[Abstract/Free Full Text]
  41. Sudowe S, Rademaekers A, Kolsch E. Antigen dose-dependent predominance of either direct or sequential switch in IgE antibody responses. Immunology. (1997) 91:464.[CrossRef][Medline]
  42. Arps V, Sudowe S, Kolsch E. Antigen dose-dependent differences in IgE antibody production are not due to polarization towards Th1 and Th2 cell subsets. Eur. J. Immunol. (1998) 28:681.[CrossRef][Web of Science][Medline]
  43. Sakai K, Yokoyama A, Kohno N, Hiwada K. Effect of different sensitizing doses of antigen in a murine model of atopic asthma. Clin. Exp. Immunol. (1999) 118:9.[CrossRef][Web of Science][Medline]
  44. Riedl M, Landaw E, Saxon A, Diaz-Sanchez D. Initial high-dose nasal allergen exposure prevents allergic sensitization to a neoantigen. J. Immunol. (2005) 174:7440.[Abstract/Free Full Text]
  45. Gonda H, Sugai M, Nambu Y, et al. The balance between Pax5 and Id2 activities is the key to AID gene expression. J. Exp. Med. (2003) 198:1427.[Abstract/Free Full Text]
  46. Takhar P, Smurthwaite L, Coker H, et al. Allergen drives class switching to IgE in the nasal mucosa in allergic rhinitis. J. Immunol. (2005) 174:5024.[Abstract/Free Full Text]
  47. Linsley P, Bradshaw J, Greene J, Peach R, Bennett K, Mittler R. Intracellular trafficking of CTLA-4 and focal localization towards sites of TCR engagement. Immunity. (1996) 4:535.[CrossRef][Web of Science][Medline]
  48. Lam K, Kuhn R, Rajewsky K. In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell. (1997) 90:1073.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrowOA All Versions of this Article:
20/4/499    most recent
dxn009v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Google Scholar
Right arrow Articles by Doi, T.
Right arrow Articles by Koyasu, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doi, T.
Right arrow Articles by Koyasu, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?