International Immunology Advance Access originally published online on November 28, 2007
International Immunology 2008 20(1):155-164; doi:10.1093/intimm/dxm127
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SAGE library screening reveals ILT7 as a specific plasmacytoid dendritic cell marker that regulates type I IFN production
1 Department of Immunobiology, Ginkgo Biomedical Research Institute, Tokyo, Japan
2 Department of Pediatrics, Division of Hematology, Oncology and Bone Marrow Transplantation, University of Minnesota Cancer Center, Minneapolis, MN, USA
3 Research Center for Advanced Science and Technology, University of Tokyo, Tokyo, Japan
Correspondence to: Y. Kamogawa-Schifter; E-mail: ykamogawa{at}sbigroup.co.jp
| Abstract |
|---|
|
|
|---|
Plasmacytoid dendritic cells (pDCs) link innate to acquired immune responses by producing high levels of type I IFN upon infection. In order to identify the specific genes that control pDC, we compared serial analysis of gene expression libraries from human pDCs, herpes simplex virus-stimulated pDCs and monocytes. We found that Ig-like transcript ILT7 is specifically expressed on pDC cell surfaces and is down-regulated when pDC mature in response to viral or bacterial stimulation. ILT7 expression on the cell surface required association with the Fc
RI
adaptor molecule. Although treatment with one anti-ILT7-specific mAb suppressed type I IFN production in response to cytosine-phosphate-guanosice (CpG) stimulation, another anti-ILT7 mAb up-regulated type I IFN production. We conclude that ILT7 is a key regulator of human pDC function.
Keywords: IFN, ILT7, pDC, SAGE
| Introduction |
|---|
|
|
|---|
Plasmacytoid dendritic cells (pDCs), initially described as plasmacytoid T cells or plasmacytoid monocytes by pathologists studying inflamed lymphoid tissue, were recently shown to be important in the production of type I IFNs in response to viral infections (1). Although little is known about how pDCs are activated, other cells important in innate immunity, such as NK cells, use cell-surface receptors to distinguish between normal and abnormal cells and to decide whether to ignore or respond to a potential threat (2). For example, the NK receptor Ly49H recognizes the m157 mouse cytomegalovirus-encoded protein, which is expressed on infected cells. When activated, Ly49H induces the production of cytokines and initiates the killing of infected cells through association with DAP12 (3). In contrast, inhibiting NK receptors that have immunoreceptor tyrosine-based inhibition motif (ITIM) in their cytoplasmic domains, prevent the activation of NK cells initiated by activating receptors engaging their ligands (2, 4).
In humans, the Ig-like transcript (ILT) family of receptors (also known as leukocyte Ig-like receptors, monocyte/macrophage Ig-like receptors and CD85) regulate the activation of myeloid cells (5). Like the NK receptors, this family contains two subgroups in which highly related, Ig-like extracellular domains are paired with distinct cytoplasmic domains that mediate either activation or inhibition (6). Long, ITIM-containing cytoplasmic domains in the inhibitory receptors transduce negative signals, whereas the short cytoplasmic domains of the stimulatory receptors lack intrinsic signaling motifs, but their transmembrane domains interact with immunoreceptor tyrosine-based activation motif (ITAM)-bearing adaptor molecules to activate cells (6).
ILT genes are located on chromosome 19q13.4 in humans, near killer cell Ig-like receptors, Fc
R, LAIR and NKp46 (7). ILT genes are preferentially and differentially expressed in myeloid lineage cells. For example, although monocytes express most ILTs, granulocytes and dendritic cells (DCs) express only ILT1 and 5 or ILT1 and 3, respectively. Although inhibitory ILT2 and ILT4 receptors interact with a variety of classical and non-classical MHC class I molecules (e.g. HLA-A, HLA-B and HLA-G) (6, 8), the ligands for other ILTs are unknown. ILT1 associates with Fc
RI
and activates eosinophils to release cytotoxic granule proteins and cytokines and to produce lipid mediators (9, 10). In this study, we analyzed serial analysis of gene expression(SAGE) libraries to identify pDC-specific molecules. We report here that ILT7 is a pDC-specific cell-surface molecule that regulates pDC function.
| Methods |
|---|
|
|
|---|
Reagents
CAL-1 cells were obtained from Dr S. Kamihira (Nagasaki University, Nagasaki, Japan). Lineage (CD3, CD14, CD16, CD19, CD20 and CD56) mAbs, anti-CD123, anti-CD14, anti-CD19 and anti-CD4 mAbs were purchased from Becton Dickinson (BD PharMingen, San Diego, CA, USA). Blood dendritic cell antigen (BDCA)-2 and BDCA-4 mAbs were purchased from Miltenyi Biotec (Germany). F(ab')2 fragments of goat anti-mouse IgG were purchased from Jackson ImmunoResearch (West Grove, PA, USA) and used as a cross-linker.
Preparation and transfection of cells
Human PBMCs were isolated from apheresis products of healthy blood donors (Memorial Blood Centers of Minnesota, Minneapolis, MN, USA) by Ficoll-Paque density gradient centrifugation. pDCs were enriched from PBMCs by using BDCA-4 cell isolation kits (Miltenyi Biotec) and a MACS system. The BDCA-4+ cell-enriched preparation was stained with a mixture of FITC-conjugated mouse anti-human antibodies against lineage markers (CD3, CD14, CD16, CD19, CD20 and CD56), allophycocyanin (Apc)-conjugated anti-CD11c and PE-conjugated anti-CD123 mAbs. Labeled cells were sorted on a FACS Vantage SE (BD Biosciences, San Jose, CA, USA) to collect the lineage–CD11c–CD123+ pDC. The purity of sorted pDCs was consistently >98%. For monocyte purification, anti-CD14-conjugated MACS beads were used for enrichment of CD14+ monocytes and the cells were then sorted by flow cytometry. pDCs were stimulated with inactivated herpes simplex virus (HSV)-1 (10 plague-forming units per cell) for 12 h before SAGE analysis. CD19, CD3 and CD56 beads were used to purify B cells, T cells and NK cells, respectively.
293T cells were transfected with plasmid DNA carrying N-Flag-tagged ILT7 cDNA, myc-tagged Fc
RI
cDNA, myc-tagged DAP12 cDNA, myc-tagged CD3
cDNA and myc-tagged DAP10 cDNA through the use of the Effectene transfection reagent (Qiagen, Hilden, Germany). Cell-surface expression of ILT7 was assessed 48 h after transfection by flow cytometric analysis.
Generation of antibodies
Anti-ILT7 mAbs were generated by immunizing female BALB/c mice with 293T cells transfected with C-Flag-tagged ILT7 and myc-tagged Fc
RI
. Hybridoma supernatants were tested for their ability to stain ILT7- and Fc
RI
-transfected 293T cells but not parental 293T cells, as assayed by flow cytometry. IgG subclass was determined with a mouse IgG isotyping kit (Zymed Laboratories Inc., South San Francisco, CA, USA).
Anti-ILT7 polyclonal antibodies were developed by immunizing rabbits with the polypeptide CSQEANSRKDNAPFRVVEPWEQ (amino acids 477–498 of ILT7).
Cloning of ILT7, Fc
RI
, CD3
, DAP10 and DAP12
A human pDC cDNA library was constructed from 5 µg poly (A+) RNA from human pDC. Oligo (dT)-primed cDNA was synthesized by using the SuperScript Choice System (Invitrogen, Carlsbad, CA, USA) and inserted into the EcoRI site of the pME18S vector. Both N-Flag and C-Flag-tagged ILT7 or C-terminal myc-tagged Fc
RI
and DAP12 were constructed by PCR using the oligonucleotides listed below and the human pDC cDNA library as a template. C-terminal myc-tagged CD3
and DAP10 were constructed from the human spleen matchmaker cDNA Library (TAKARA BIO INC., Shiga Japan).
N-Flag-tagged ILT7 forward primer: 5'-CCGCTCGAGATGACCCTCATTCTCACAAGCCTGCTCTTCTTTGGGCTGAGCCTGGGCGATTACAAGGATGACGACGATAAGCCCAGGACCCGGGTGCAGGCAGAA-3' and N-Flag-tagged ILT7 reverse primer: 5'-CTAGACTAGTTCAGATCTGTTCCCAAGGCTC-3'. C-Flag-tagged ILT7 forward primer: 5'-CCGCTCGAGATGACCCTCATTCTCACAAGC-3' and C-Flag-tagged ILT7 reverse primer: 5'-CTAGACTAGTTCACTTATCGTCGTCATCCTTGTAATCGATCTGTTCCCAAGGCTC-3'.
Myc-tagged Fc
RI
forward primer: 5'-CCGCTCGAGATGATTCCAGCAGTGGTCTTG-3' and myc-tagged Fc
RI
reverse primer: 5'-CTAGACTAGTCTACAGATCCTCTTCAGAGATGAGTTTCTGCTCCTGTGGTGGTTTCTCATG-3'. Myc-tagged DAP12 forward primer: 5'-CCGCTCGAGACCATGGGGGGACTTGAACCCTGC-3' and myc-tagged DAP12 reverse primer: 5'-ATAGTTTAGCGGCCGCTCACAGATCCTCTTCAGAGATGAGTTTCTGCTCTTTGTAATACGGCCTCTG-3'. Myc-tagged DAP10 forward primer: 5'-CCGCTCGAGACCATGATCCATCTGGGTCAC-3' and myc-tagged DAP10 reverse primer: 5'-TTTACTAGTTCACAGATCCTCTTCAGAGATGAGTTTCTGCTCGCCCCTGCCTGGCATGTT-3'. Myc-tagged CD3
forward primer: 5'-CCGCTCGAGACCATGAAGTGGAAGGCGCTT-3' and myc-tagged CD3
reverse primer: 5'-TTTACTAGTTTACAGATCCTCTTCAGAGATGAGTTTCTGCTCGCGAGGGGGCAGGGCCTG-3'. The PCR was conducted by using the following parameters: 1 cycle at 94°C for 2 min and 25 cycles at 94°C for 15 s, 55°C for 30 s and 68°C for 1 min and 30 s. Purified PCR products were isolated and ligated into the pME18X expression vector.
Quantitative reverse transcription–PCR
Quantitative reverse transcription (RT)–PCR was performed with SYBR green probes on the ABI Prism 7000 (Applied Biosystems), as described by the manufacturer. The primer sequences for quantitative real time RT–PCR were as follows: ILT7, sense 5'-CCTCAATCCAGCACAAAAGAAGT-3' and anti-sense 5'-CGGATGAGATTCTCCACTGTGTAA-3'; human Fc
RI
, sense 5'-CCAGCCCAAGATGATTCCA-3' and anti-sense 5'-CAGGGCCGCTGCTTGTT-3' and human glyceraldehyde-3-phosphatedehydrogenase (GAPDH), sense 5'-CCACCCATGGCAAATTCC-3' and anti-sense 5'-TGGGATTTCCATTGATGACAAG-3'.
cDNA samples for PCR were obtained from MTC multiple tissue human cDNA panels (Takara Bio Inc.) or from immune cells prepared from human PBMCs. PCR was conducted with the following parameters: 50°C for 2 min, 95°C for 10 min, 40 cycles at 95°C for 15 s and 60°C for 1 min. Each transcript was normalized to human GAPDH gene values to account for sample variation. All PCR assays were performed in triplicate and results are represented by their mean values.
Immunoprecipitation and immunoblotting
Cells were lysed with lysis buffer [50 mM HEPES/KOH (pH 7.6), 150 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 0.5% Triton X-100, 10% glycerol, protease inhibitors and phosphatase inhibitors]. Lysates were immunoprecipitated with 2 µg antibodies bound to protein A-Sepharose (Amersham Pharmacia Biotech, Buckinghamshire, UK). Proteins were separated on SDS–PAGE, and then transferred to polyvinylidene fluoride membranes (Millipore Corporation, Bedford, MA, USA). Western blotting was performed by using either anti-myc (Santa Cruz Biotechnology, San Diego, CA, USA) or anti-FLAG M2 antibody (Sigma–Aldrich, St Louis, MO, USA), followed by incubation with HRP-coupled secondary antibodies and visualization by ECL detection reagents (Amersham Pharmacia Biotech). To detect glycosylation, cell lysates were immunoprecipitated with 2 µg of anti-ILT7 polyclonal antibody, and then treated with or without 3 U N-glycosidase F (Roche Diagnostics, Mannheim, Germany) for 15 h at 37°C before western blotting.
Intracellular calcium measurement
In total, 1 x 106 of ILT7- and Fc
RI
-transfected CAL-1 cells were incubated with 5 µl of Fluro-3AM (Molecular Probes, Carlsberg, CA, USA) in a total volume of 1 ml at 37°C for 30 min. Cells were then centrifuged and re-suspended in 100 µl of isotype-matched control mAb (mouse IgG2a) or anti-ILT7 mAbs (10 µg ml–1) with RPMI-1640 medium at 4°C for 15 min. Cells were washed with medium and analyzed by flow cytometry (FACSCaliburTM; BD Biosciences) to detect Ca2+ influx, followed by addition of 10 µg of goat anti-mouse IgG as a cross-linker.
Construction of SAGE libraries
SAGE libraries were constructed with 10 µg of total RNA from monocytes, pDCs, and pDCs after HSV stimulation using the I-SAGE kit according to the manufacturer's instructions (Invitrogen). Briefly, poly (A+) RNA was isolated with oligo (dT)-coupled magnetic beads and converted to cDNA. The resulting cDNA library was digested with NlaIII (anchoring enzyme), separated with streptavidin-coated magnetic beads and divided into two fractions after extensive washing. Each fraction was ligated with one of the two annealed linker pairs. After unligated linkers were removed by extensive washing, the tags besides NlaIII restriction site (CATG) of each transcript were released from the magnetic beads by cleavage with BsmFI (tagging enzyme). Then the two tagged fractions were blunted and ligated to produce ditags. After the ditags were amplified by performing 29 PCR cycles (1 cycle at 95°C for 2 min, 27 cycles at 95°C for 30 s, 55°C for 1 min, 70°C for 1 min and 1 cycle at 70°C for 5 min), the 102-bp band was collected by gel purification and digested with NlaIII to recover the 26-bp ditags. The band containing the ditags was excised and self-ligated to produce long concatemers. Concatemers of 700–1200 bp were isolated by 8% PAGE, ligated into the pZErO®-1 vector and transformed into One Shot® TOP10 Electrocomp Escherichia coli. Resulting colonies were screened by PCR to select long inserts (>600 bp) for automated sequencing. SAGE tags of 10 bp were extracted, filtered and tabulated by using the SAGE2000 software. Tag-to-gene mappings were performed by matching tag sequences to the most reliable SAGE map list (ftp://ftp.ncbi.nlm.nih.gov/pub/sage/map/mm). The three SAGE libraries were then normalized so that the tag number was expressed as tags per 100 000 for comparison purposes.
Internalization of ILT7 mAbs
ILT7- and Fc
RI
-transfected CHO-K1 cells were incubated with 10 µg ml–1 of anti-ILT7 mAbs at 4°C for 30 min. They were then washed two times with cold RPMI-1640 medium containing 10% FCS and stained with Apc-conjugated goat anti-mouse Ig antibody (BD PharMingen) at 4°C for 15 min. Cells were divided into two groups and incubated for 1 h at either 37 or 4°C. Anti-ILT7 mAbs remaining at the cell surface were detected by staining with FITC-conjugated donkey anti-goat IgG (Santa Cruz Biotechnology) followed by analysis using flow cytometry.
Measurement of IFN production in pDC induced by ILT7 cross-linking
PDCs were purified from PBMCs with anti-BDCA-4-coated microbeads (Miltenyi Biotec) and an autoMACS. ELISA plates (96 well) were coated overnight with 10 µg ml–1 antibodies in PBS at 4°C. Plates were washed and blocked with 10% FCS in RPMI-1640 medium at 37°C for 2 h. pDCs (4 x 104 cells per well) were added to the antibody-coated plates and incubated at 37°C for 30 min. Then CpG 2216 (0.1 µM) was added and then cells were incubated at 37°C for 20 h. Supernatants were harvested and IFN
production was measured with ELISA Kits (Bender MedSystems, Vienna, Austria).
| Results |
|---|
|
|
|---|
Construction of SAGE libraries to find pDC-specific cell-surface molecules
In order to identify pDC-specific molecules, we constructed SAGE libraries from human pDCs, pDCs stimulated with HSV1 and monocytes. By searching a panel of transcripts encoding membrane proteins that are expressed on pDC but not on monocytes or stimulated pDC, we chose the ILT7 gene for further analysis (Table 1). Among ILT family members, ILT2, 3 and 7 were expressed on pDC. ILT7 was the only family member specifically transcribed by pDC in our SAGE analysis. For further analysis, we examined transcripts from a panel of immune cells by quantitative RT–PCR and confirmed pDC-specific expression of ILT7 (Fig. 1A). Moreover, the tissue distribution of ILT7 was examined by using a tissue panel of cDNA by quantitative RT–PCR. This analysis showed that ILT7 was expressed mainly by lymphoid tissues (Fig. 1B). We, therefore, conclude that ILT7 is specifically transcribed by pDC.
|
|
ILT7 associates with Fc
RI
but not DAP12We cloned ILT7 cDNA from a pDC library and tagged it on either the C- or N-terminus with the Flag epitope. Because ILT7 has a charged amino acid in its transmembrane domain, it likely requires an adaptor protein such as DAP12, DAP10 Fc
RI
, or CD3
for cell-surface expression and signal transduction. We, therefore, cloned Fc
RI
and DAP12 from human pDC libraries and DAP10 and CD3
from human spleen cDNA libraries, respectively, tagged them on their C-termini with the myc epitope, and examined whether they associated with ILT7.
Western blotting determined that ILT7 associates with Fc
RI
and weakly with CD3
but not DAP12 and DAP10 in 293T cells (Fig. 2A). Among these adaptor proteins, Fc
RI
most strongly associated with ILT7. Moreover, flow cytometric analysis of ILT7-transfected 293T cells revealed that ILT7 was maximally expressed on the cell surface in the presence of Fc
RI
(Fig. 2B). Because CD3
is not expressed by pDC (data not shown), ILT7 likely associates with Fc
RI
. Interestingly, although Fc
RI
was robustly expressed in pDC, it—like ILT7—was markedly down-regulated after HSV stimulation (Fig. 2C).
|
Western blotting indicated that recombinant ILT7 protein expressed on the surface of 293T cells is heterogeneous in size. Treatment of transfected cells with N-glycosidase reduced the apparent molecular weight of ILT7 to that predicted by its amino acid sequence (Fig. 2D), suggesting that ILT7 is a highly glycosylated protein.
Generation of ILT7-specific mAb
In order to examine ILT7 expression and function, we generated ILT7-specific mAbs by immunizing mice with 293T cells co-transfected with both C-Flag-tagged ILT7 and C-myc-tagged Fc
RI
. We identified several ILT7-specific mAbs by screening hybridoma supernatants for antibodies that stained ILT7-transfected but not untransfected 293T cells (Fig. 3A). Several mAb-stained pDCs co-stained with BDCA-2 and CD123, but not with lineage markers (Fig. 3B). Because these antibodies did not stain CD14+ monocytes, which express most other ILTs (11), we concluded our mAbs did not cross-react with other ILTs.
|
ILT7 expression is down-regulated in stimulated pDC
SAGE analysis suggests that ILT7 transcription decreases markedly after viral stimulation (Table 1). To determine whether ILT7 protein levels also decrease after stimulation, we activated PBMC with several Toll-like receptor (TLR) stimuli, such as CpGs and viruses, and with cytokines. CpG 2216 stimulation clearly down-regulated ILT7 expression (Fig. 3C), and this down-regulation occurred earlier than that of BDCA-2 which is also reduced after activation (Fig. 3D and Supplementary Figure 1). Importantly, the addition of IFN-
did not affect ILT7 expression, suggesting that it is TLR signaling, and not IFN-
itself, that reduces ILT7 expression in activated pDC.
Antibody characteristics
We have characterized several ILT7 mAbs. Most of the mAbs stained PBMCs, as well as ILT7-transfected CAL-1 cells, with a similar staining pattern (Fig. 4A). Because some mAbs cause internalization of receptors, we examined whether ILT7 was internalized after anti-ILT7 mAb treatment. As shown in Fig. 4(B), every anti-ILT7 mAb evaluated was internalized by ILT7-transfected CHO-K1 cells at 37°C within 60 min.
|
Another pDC-specific cell-surface molecule, BDCA-2, induces Ca2+ signaling in pDC when bound by an anti-BDCA-2 mAb (12, 13). Because ILT7 associates with Fc
RI
, which contains ITAM in its cytoplasmic domain, we speculated that the signal through ILT7 might activate pDC upon receptor cross-linking. In order to evaluate the activation through ILT7, we analyzed the effect of anti-ILT7 mAb treatment on Ca2+ influx in the pDC cell line CAL-1, which expresses BDCA-2, BDCA-4 and ILT7 and produces tumor necrosis factor-
after CpG stimulation (14). Interestingly, although some anti-ILT7 mAbs—such as 37D—induced a potent Ca2+ influx in CAL-1 cells, others—such as 26E—did not at the concentration (10 µg ml–1) of mAb that saturates cell-surface ILT7 (Fig. 4C). Competition assays subsequently indicated that these two mAbs recognize different epitopes (data not shown) and exhibit different affinities (the Kd value of 26E mAb was 10 times higher than 37D mAb; K. Ishida et al. unpublished data).
The effects of anti-ILT7 mAbs on type I IFN production
Because type I IFNs are the major cytokines produced by pDC, we examined whether anti-ILT7 mAbs also affect type I IFN production in activated pDC. Remarkably, CpG-induced type I IFN production was inhibited by cross-linking with 37D mAb, but augmented by cross-linking with 26E mAb (Fig. 5A). When we stimulated pDCs with active influenza virus (PR8), cross-linking of 37D mAb similarly inhibited IFN production, but 26E mAb did not (Fig. 5B). The mechanism of this reciprocal effect on type I IFN production by anti-ILT7 mAbs is not known.
|
| Discussion |
|---|
|
|
|---|
Immune cells have many cell-surface receptors that control their activities. For example, in T cells and B cells, the TCR and B cell receptor, respectively, regulate their antigen-specific activation (15, 16). Similarly, TLRs, present on the cell surface or in endosomes, activate innate immune cells in response to microbial pathogens (17–19). In this study, we used SAGE analysis to determine that ILT7 is a pDC-specific cell-surface receptor. We found that both mRNA and protein expression of ILT7 were limited to pDC and were down-regulated after activation.
Although the ILT family of receptors are preferentially expressed on myeloid cells, some (ILT1, 2 and 5) are also expressed on B, T and NK cells (11). Analysis by RT–PCR indicates that, among DC subsets, myeloid DC express ILT1, 2 and 3, whereas pDC express ILT2, 3 and 7 (which was confirmed by our SAGE analysis) but not ILT1 or 4 (20, 21). Interestingly, although ITIM-bearing ILTs, such as ILT2 and 3, are up-regulated after virus stimulation, our quantitative RT–PCR and anti-ILT7 cell-surface staining indicate that ILT7—associated with the ITAM adaptor—is markedly down-regulated after stimulation with virus.
In contrast to the studies of Ju et al. (20), in which ILT2 and ILT3 transcripts and proteins were down-regulated in activated pDC, we observed remarkable up-regulation of ILT3 (SAGE tag 9–24) after HSV stimulation. This difference might be caused by differences in the stimuli and time course (CpG versus HSV virus and 24 versus 12 h). Despite the fact that the biological function of the ILT family of genes is not well understood, it is possible that the reciprocal expression patterns of ITIM versus ITAM-associated ILT receptors after viral stimulation play a critical role in the regulation of pDC activation.
As others have predicted from structural analyses (20–23), we found that ILT7 must associate with the adaptor molecule Fc
RI
for stable surface expression and signal transduction in 293T cells. We also showed the weak association between ILT7 and CD3
by immunoblot as well as staining of cell-surface expression of ILT7. However, CD3
may not be used as an adaptor for ILT7 in normal conditions. Fc
RI
expresses an ITAM [YXXL/I (X6-8) YXXL/I], which is shared with other adaptors such as DAP12 (24, 25). In general, activation of receptors associated with these adaptor molecules induces the activation of the Src family of protein kinases (protein tyrosine kinases) and the subsequent phosphorylation of ITAM tyrosines. This phosphorylation leads, in turn, to the recruitment and activation of the tandem Src homology domain 2 containing tyrosine kinases such as spleen tyrosine kinase (Syk) and zeta-chain (TCR)-associated protein kinase 70 kD and the phosphorylation and activation of the multiple signaling molecules that link the receptor downstream signaling pathways and effector functions (2, 24).
Interestingly, quantitative RT–PCR indicates that the expression of Fc
RI
transcripts is remarkably high in pDC, but is down-regulated severely after viral stimulation (20). These data suggest that the Fc
RI
-dependent signaling in pDC is tightly controlled, possibly to avoid overactivation. Fc
RI
has been shown to associate with ILT1 and ILT1-specific mAb triggers intracellular Ca2+ mobilization in monocytes, as well as degranulation and the release of serotonin in ILT1-transfected Rat Basophilic leukemia RBL cells (9). However, cross-linking with our anti-ILT7 mAb 37D induced Ca2+ mobilization in ILT7-transfected CAL-1 pDC leukemic cells and down-regulated IFN production by purified pDC after CpG and influenza virus stimulation. In contrast, cross-linking with the anti-ILT7 mAb 26E stimulated CpG-induced IFN production without affecting Ca2+ mobilization. In addition, the effects of ILT7 mAbs in response to influenza virus were less than CpG stimuli.
The mechanisms for the reciprocal function of these two anti-ILT7 mAbs remain to be determined. It is possible that the answer lies at least in part in the different binding affinities displayed by the 37D and 26E mAbs. Pasquier et al. (26) showed that Fc
RI associated with the ITAM-bearing Fc
RI
adaptor transduced either positive or negative signals into the cells depending on the affinity of the ligand used to activate the cells. They demonstrated that in the absence of sustained aggregation, weak ligand binding to Fc
RI triggered a predominantly negative signal through the recruitment of Src homology 2 domain-containing tyrosine phosphatase-1 (SHP-1), whereas sustained clustering of Fc
RI (strong ligand binding) led to potent activation of Syk, which competes with SHP-1 recruitment. Thus, the fact that our mAbs bind to ILT7 with different affinities may explain why they result in distinct outcomes. For example, whereas the high-affinity 37D mAb (the affinity of 37D mAb is 10 times more than 26E mAb K. Ishida et al. unpublished data) may cause aggregation of ILT7 that leads to inhibition of type I IFN production after TLR9 stimulation, 26E mAb may bind to ILT7 weakly and recruit other signaling molecules that promote IFN production.
The identification of ILT7's physiological ligands will allow us to better understand the molecule's biological function in pDC. mAbs acting as either ILT7 agonists or antagonist may be useful for certain clinical applications. They may also provide therapeutic drugs for autoimmune diseases that involve the secretion of type I IFN.
| Supplementary data |
|---|
|
|
|---|
Supplementary Figure 1 is available at International Immunology Online.
| Acknowledgements |
|---|
We are grateful for the generous gift of CAL-1 cells from Drs. T. Maeda and S. Kamihira at Nagasaki University, Japan. We thank T. Ozawa and M. Abiko for assistant work and Drs S. Miyatake at Tokyo Metropolitan Institute of Medical Science, Japan, and K. Conger for critical reading of the manuscript. We also thank Dr L. Lanier at University of California, San Francisco (UCSF) for helpful discussions.
| Abbreviations |
|---|
| APC, allophycocyanin |
| BDCA, blood dendritic cell antigen |
| CPG, cytosine-phosphate-guampsine |
| DC, dendritic cell |
| GAPDH, glyceraldehyde-3-phosphatedehydrogenase |
| HSV, herpes simplex virus |
| ILT, Ig-like transcript |
| ITAM, immunoreceptor tyrosine-based activation motif |
| ITIM, immunoreceptor tyrosine-based inhibition motif |
| pDC, plasmacytoid dendritic cell |
| RT, reverse transcription |
| SAGE, serial analysis of gene expression |
| SHP-1, Src homology 2 domain-containing tyrosine phosphatase-1 |
| Syk, spleen tyrosine kinase |
| TLR, Toll-like receptor |
| Notes |
|---|
Transmitting editor: T. Saito
Received 13 February 2007, accepted 26 October 2007.
| References |
|---|
|
|
|---|
- Siegal FP, Kadowaki N, Shodell M, et al. The nature of the principal type 1 interferon-producing cells in human blood. Science (1999) 284:1835.
[Abstract/Free Full Text] - Vivier E, Nunes JA, Vely F. Natural killer cell signaling pathways. Science (2004) 306:1517.
[Abstract/Free Full Text] - Arase H, Mocarski ES, Campbell AE, Hill AB, Lanier LL. Direct recognition of cytomegalovirus by activating and inhibitory NK cell receptors. Science (2002) 296:1323.
[Abstract/Free Full Text] - Colonna M, Nakajima H, Cella M. Inhibitory and activating receptors involved in immune surveillance by human NK and myeloid cells. J. Leukoc. Biol. (1999) 66:718.[Abstract]
- Cella M, Nakajima H, Facchetti F, Hoffmann T, Colonna M. ILT receptors at the interface between lymphoid and myeloid cells. Curr. Top. Microbiol. Immunol. (2000) 251:161.[Web of Science][Medline]
- Young NT, Canavez F, Uhrberg M, Shum BP, Parham P. Conserved organization of the ILT/LIR gene family within the polymorphic human leukocyte receptor complex. Immunogenetics (2001) 53:270.[CrossRef][Web of Science][Medline]
- Wende H, Colonna M, Ziegler A, Volz A. Organization of the leukocyte receptor cluster (LRC) on human chromosome 19q13.4. Mamm. Genome (1999) 10:154.[CrossRef][Web of Science][Medline]
- Navarro F, Llano M, Bellon T, Colonna M, Geraghty DE, Lopez-Botet M. The ILT2 (LIR1) and CD94/NKG2A NK cell receptors respectively recognize HLA-G1 and HLA-E molecules co-expressed on target cells. Eur. J. Immunol. (1999) 29:277.[CrossRef][Web of Science][Medline]
- Nakajima H, Samaridis J, Angman L, Colonna M. Human myeloid cells express an activating ILT receptor (ILT1) that associates with Fc receptor gamma-chain. J. Immunol. (1999) 162:5.
[Abstract/Free Full Text] - Tedla N, Bandeira-Melo C, Tassinari P, et al. Activation of human eosinophils through leukocyte immunoglobulin-like receptor 7. Proc. Natl Acad. Sci. USA (2003) 100:1174.
[Abstract/Free Full Text] - Colonna M, Nakajima H, Cella M. A family of inhibitory and activating Ig-like receptors that modulate function of lymphoid and myeloid cells. Semin. Immunol. (2000) 12:121.[CrossRef][Web of Science][Medline]
- Dzionek A, Sohma Y, Nagafune J, et al. BDCA-2, a novel plasmacytoid dendritic cell-specific type II C-type lectin, mediates antigen capture and is a potent inhibitor of interferon alpha/beta induction. J. Exp. Med. (2001) 194:1823.
[Abstract/Free Full Text] - Fanning SL, George TC, Feng D, et al. Receptor cross-linking on human plasmacytoid dendritic cells leads to the regulation of IFN-alpha production. J. Immunol. (2006) 177:5829.
[Abstract/Free Full Text] - Maeda T, Murata K, Fukushima T, et al. A novel plasmacytoid dendritic cell line, CAL-1, established from a patient with blastic natural killer cell lymphoma. Int. J. Hematol. (2005) 81:148.[CrossRef][Web of Science][Medline]
- Werlen G, Palmer E. The T-cell receptor signalosome: a dynamic structure with expanding complexity. Curr. Opin. Immunol. (2002) 14:299.[CrossRef][Web of Science][Medline]
- Kurosaki T. Regulation of B cell fates by BCR signaling components. Curr. Opin. Immunol. (2002) 14:341.[CrossRef][Web of Science][Medline]
- Takeda K, Akira S. Toll-like receptors in innate immunity. Int. Immunol. (2005) 17:1.
[Abstract/Free Full Text] - Akira S. TLR signaling. Curr. Top. Microbiol. Immunol. (2006) 311:1.[Web of Science][Medline]
- Barton GM. Viral recognition by Toll-like receptors. Semin. Immunol. (2007) 19:33.[CrossRef][Web of Science][Medline]
- Ju XS, Hacker C, Scherer B, et al. Immunoglobulin-like transcripts ILT2, ILT3 and ILT7 are expressed by human dendritic cells and down-regulated following activation. Gene (2004) 331:159.[CrossRef][Web of Science][Medline]
- Cao W, Rosen DB, Ito T, et al. Plasmacytoid dendritic cell-specific receptor ILT7-Fc{epsilon}RI{gamma} inhibits Toll-like receptor-induced interferon production. J. Exp. Med. (2006) 203:1399.
[Abstract/Free Full Text] - Rissoan M-C, Duhen T, Bridon J-M, et al. Subtractive hybridization reveals the expression of immunoglobulin-like transcript 7, Eph-B1, granzyme B, and 3 novel transcripts in human plasmacytoid dendritic cells. Blood (2002) 100:3295.
[Abstract/Free Full Text] - Dietrich J, Cella M, Colonna M. Ig-like transcript 2 (ILT2)/leukocyte Ig-like receptor 1 (LIR1) inhibits TCR signaling and actin cytoskeleton reorganization. J. Immunol. (2001) 166:2514.
[Abstract/Free Full Text] - Billadeau DD, Leibson PJ. ITAMs versus ITIMs: striking a balance during cell regulation. J. Clin. Investig. (2002) 109:161.[CrossRef][Web of Science][Medline]
- Lanier LL, Bakker AB. The ITAM-bearing transmembrane adaptor DAP12 in lymphoid and myeloid cell function. Immunol. Today (2000) 21:611.[CrossRef][Web of Science][Medline]
- Pasquier B, Launay P, Kanamaru Y, et al. Identification of FcalphaRI as an inhibitory receptor that controls inflammation: dual role of FcRgamma ITAM. Immunity (2005) 22:31.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
W. Cao, L. Bover, M. Cho, X. Wen, S. Hanabuchi, M. Bao, D. B. Rosen, Y.-H. Wang, J. L. Shaw, Q. Du, et al. Regulation of TLR7/9 responses in plasmacytoid dendritic cells by BST2 and ILT7 receptor interaction J. Exp. Med., July 6, 2009; 206(7): 1603 - 1614. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





