International Immunology Advance Access originally published online on August 13, 2007
International Immunology 2007 19(8):923-933; doi:10.1093/intimm/dxm050
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression and function of mixed lineage kinases in dendritic cells
Department of Immunology and Molecular Pathology, University College London, Windeyer Institute, 46 Cleveland Street, London W1T 4JF, UK
Correspondence to: B. M. Chain; E-mail: b.chain{at}ucl.ac.uk
| Abstract |
|---|
|
|
|---|
Dendritic cells (DCs) sense the presence of conserved microbial structures in their local microenvironment via specific pattern recognition receptors (PRRs). This leads to a programme of changes, which include migration and activation, and enables them to induce adaptive T cell immunity. Mitogen-activated protein kinases (MAPKs) are implicated in this response, but the pathways leading from PRR ligation to MAPK activation, and hence DC activation, are not fully understood. Recent studies in the nervous system have suggested that the mixed lineage kinase (MLK) family of MAPK kinase kinase proteins may be involved as an intermediary step between PRRs and MAPKs. Therefore, in this study, we have used a well-established DC model to explore the role of MLKs in these cells. Messenger RNA for MLKs 2, 3, 4 and DLK and protein for MLKs 2, 3 and DLK are found in DC. DC activation in response to model PRR ligands, such as LPS or poly (I:C), is accompanied by phosphorylation of MLK3. In contrast, another known PRR ligand, zymosan, induces little MLK3 phosphorylation. Inhibition of MLK activity using a pharmacological inhibitor, CEP11004, blocks p38 and Jun N-terminal kinase (JNK) MAPK activation in response to LPS and poly (I:C), but not zymosan. The inhibition is associated with a block in DC activation as measured by cell-surface marker expression and cytokine secretion. Thus, MLKs are expressed in DC, and are implicated in DC activation, and the involvement of MLKs appears to be selective, depending on the nature of the DC stimulus.
Keywords: dendritic cells, mixed lineage kinases, toll-like receptors
| Introduction |
|---|
|
|
|---|
Dendritic cells (DCs) play a key role at the interface between innate and adaptive immunity, and how they are activated can be important in regulating the nature of the immune response (1). This activation involves changes in morphology, cell-surface phenotype and cytokine secretion, and is induced by interaction between conserved molecular structures on micro-organisms (pathogen associated molecular patterns) and pattern recognition receptors (PRRs) on the DC, of which toll-like receptors (TLRs) are prototypes (2, 3). However, the mechanisms involved in these DC changes are complex. It has become clear that there are both qualitative and quantitative differences in outcome seen in response to different stimuli (4–6). A possible explanation for the different outcomes is that they are determined by the different signals transmitted via the various PRRs, and are in turn mediated by various adaptor proteins that associate preferentially with one or other PRR (7).
From previous work, it appears that activation of the nuclear factor-kappa B family of transcription factors is a common essential step in all examples of DC maturation (8). In contrast, the role of the different members of the mitogen-activated protein kinase (MAPK) family appears more complex. Some studies have suggested that p38 and extracelluler signal regulated kinase-1 (ERK) MAPKs may play antagonistic roles (9). A previous study from our laboratory highlighted the differential regulation of p38 and JNK in determining the balance between activation and apoptosis. We suggested that the balance may play a critical role in allowing induction of protective responses, but limiting the development of autoimmunity (10).
In these previous studies, the role of JNK in DC apoptosis was probed using two small molecular weight inhibitors, one a direct inhibitor of JNK and the other an inhibitor of an upstream kinase family, the mixed lineage kinases (MLKs), that has not been explored in DC signalling previously (10). MLKs are a family of serine/threonine kinases, which act as MAPK kinase kinases (MAP3Ks) (11). Most work on MLK proteins (especially MLK3) has been in neuronal cells, and has been limited to their selective activation of JNK, with an important consequent role in regulation of apoptosis (12). An analogous role in regulating apoptosis in response to oxidative stress was demonstrated in DC (10). More recently, however, MLKs have been implicated in a variety of other neuronal functions, including cytokine secretion (13), cell division (14) and morphology and migration (15). All of these processes have analogues in DC. Their involvement in the MAPK pathways is also more complex than was first thought, since MLK3 has been implicated in the upstream regulation of p38 and ERK MAPKs, in addition to JNK (16).
In this study, we have documented the expression of MLKs in DC. Several members of the MLK family are indeed found in DC. We have examined the functional involvement of MLKs in DC activation, and shown that they do indeed act upstream of MAPK in these cells. However, MLK activation was found to depend on the nature of the PRR stimulus. Therefore, we propose that manipulation of MLK may allow selective modulation of the DC activation pathway, and thus has the potential to influence outcome of DC-regulated responses.
| Methods |
|---|
|
|
|---|
Reagents and antibodies
The complete medium (CM) used comprised RPMI 1640 (Gibco BRL, Paisley, UK) supplemented with penicillin (100 U ml–1), streptomycin (100 µg ml–1), L-glutamine (2 mM) (all from Cancer Research UK Clare Hall Laboratories, London, UK) and FCS (10% v/v) (Gibco BRL) (heat inactivated 56°C, 30 min) unless otherwise indicated. Human recombinant granulocyte macrophage colony-stimulating factor (GM-CSF) and human recombinant IL4 were provided by Schering-Plough, Kenilworth, NJ, USA. LPS (Salmonulla minesotta), poly (I:C) and zymosan (all obtained from Sigma Chemical Co., Poole, UK) and the inhibitors SB203580 (Sigma), SP600125 (Signal Research Division, Celgene, San Diego, CA, USA) and CEP11004 (Cephalon Inc., West Chester, PA, USA) were diluted to working concentrations in CM.
Antibodies used in this study were as follows: phospho-p38 (rabbit pAb, Cell Signaling Technology); total-p38 (rabbit pAb, Cell Signaling Technology); phospho-JNK (rabbit mAb, Promega, Madison, WI, USA); total-JNK (mouse mAb IgG1, Santa Cruz Biotechnology, CA, USA); total MLK2 (rabbit pAb, Signet Laboratories Inc., Dedham, MA, USA); total DLK (rabbit pAb , kind gift of Larry Holzman, University of Michigan, Ann Arbor); phospho-MLK3 (rabbit pAb, Cell Signaling Technology) raised against a synthetic phosphoThr277/Ser281 peptide corresponding to residues surrounding phosphoThr277/Ser281 in human MLK3; total-MLK3 (rabbit pAb, Cell Signaling Technology); CD83 (Dako, Glostrup, Denmark); CD86 (supernatant mouse mAb BU63, IgG1, gift from D. Hardie, Birmingham Medical School, Birmingham, UK) and HLA-DR (supernatant mouse mAb L243, IgG2a, gift from P. C. L. Beverley).
Cell preparation
DCs were prepared from PBMCs as described previously (17). Lymphocytes and monocytes were depleted rigorously (<2%) on day 4 of culture by immunomagnetic bead depletion with antibodies against CD2 (mouse mAb MAS593, IgG2b, Harlan Sera-lab, Crawley Down, UK), CD3 (supernatant mouse mAb UCH-T1, IgG1, gift from P. C. L. Beverley) and CD19 (supernatant mouse mAb BU12, IgG1, gift from D. Hardie). These purified cells were used as day 4 DC in some experiments. The purified cells were re-cultured at 5 x 105 DC per ml in fresh CM supplemented with GM-CSF and IL4 for a further 3 days. On day 7 of culture, monocyte-derived DCs were washed twice and re-cultured in CM (or CM containing 0.5% FCS for western blotting experiments). At this time, SB203580, SP600125 or CEP11004 or inhibitors were added as appropriate. DCs obtained in this way were <2% CD3 or CD19 positive and >95% HLA-DR and CD11c positive. CD1a expression was more variable, but always >80%. For studies requiring the DC precursor population (e.g. Fig. 1b), monocytes were prepared from PBMC by 2-h adherence to plastic, followed by extensive washing, and detachment in 2 mM ethylene diamine tetra-acetic acid (EDTA).
|
Western blotting
DCs were incubated in CM containing 0.5% FCS v/v for at least 24 h prior to treatment. Total cell extracts were prepared by re-suspending the cells in 50 µl sample buffer [2% SDS (Sigma), 10% glycerol (BDH, Poole, UK), 2% ß-mercaptoethanol (Sigma), 60 mM Tris–HCl (pH 6.8; Calbiochem, CA, USA) and bromophenol blue (Sigma)] and stored at –20°C. Before loading, lysates were sonicated and boiled for 5 min, and then resolved by running 25 µl on a SDS/12.5% PAGE gel and transferred to an enhanced chemiluminescence (ECL) nitrocellulose membrane (Amersham Pharmacia Biotech, Bucks, UK). Immunoblotting was performed by standard procedures using HRP-conjugated rabbit anti-mouse IgG or swine anti-rabbit IgG detection antibodies (both Dako) in combination with ECL detection reagent (Amersham Pharmacia Biotech). Densitometry of blots was performed using ImageJ software (http://rsb.info.nih.gov/ij/).
Polymerase chain reaction
For genomic DNA preparation, 5 x 106 DCs were re-suspended in 500 µl lysis buffer [0.2% SDS (Sigma), 0.1 M Tris (pH 8.5; Calbiochem), 5 mM EDTA (Sigma) and 200 mM NaCl (Sigma)] containing 1% proteinase K (Sigma) at 55°C with shaking overnight. Genomic DNA was precipitated using propan-2-ol (BDH), and re-suspended in dH2O (Sigma) prior to concentration determination by spectrophotometry and stored at –20°C.
For total RNA preparation, 5 x 106 DCs were lysed using TRIzol solution according to the manufacturer's instructions (Invitrogen, Carlsbad, Germany). When required, contaminating DNA was removed by re-suspension in DNase buffer (Promega) at 37°C for 1 h. Finally, RNA was re-suspended in dH2O, prior to concentration determination by spectrophotometry, and stored at –20°C.
Reverse transcription was performed using the First-Strand cDNA Synthesis Kit (Promega) following the manufacturer's instructions. To maximize stringency and sensitivity of detection of MLK protein synthesis, a nested strategy was used whereby one or two primers were designed to be used in a second PCR reaction using the first round product as template. PCR Primers (Sigma Genosys) used were as follows:
- ßactinF: GACGAGGCCCAGAGCAAGAGACG,
- ßactinR: GATCCACATCTGTGGAAGGTGGAC,
- FMLK1: CTTGCTGGCAGCCAGTTG,
- RMLK1: ATCTCGTTTGAAGCGCTC,
- FnestMLK1: TGGTGCCCATCGACATTG,
- RnestMLK1: GACCCTCCCGTCTTTTCTTC,
- FMLK2: TGGAGCTGGAGAGCTTCAAGAAG,
- RMLK2: GGAAGTCCAGAAGGTCACGA,
- FnestMLK2: CAGTCGCTCACGCCCACCCACG,
- FMLK3: AGCCCATTGAGAGTGACGAC,
- RMLK3: CGTCGAAGAGACCCTGGAT,
- FnestMLK3: AGTGGCACAAAACCACACAA,
- RnestMLK3: CTGCATGGAATGGAAGGAGT,
- FMLK4: TGGAGTGCTGCTGTGGGA,
- RMLK4: CTTTTCCTTTGTTCTCAACTC,
- RnestMLK4: GTTTCCAGTCATCTTGCATGG,
- FDLK: AGTGGCACAAAACCACACAA,
- RDLK: TCAACGCTGTTGGAGTTGTC and
- FnestDLK: TAGTGAACCTTCCCCCAGTG.
- ßactinR: GATCCACATCTGTGGAAGGTGGAC,
Flow cytometric analysis
For phenotypic analysis, 2 x 105–5 x 105 cells per group were harvested, and incubated with the relevant mAb for 30 min at 4°C. This was followed by 1:50 diluted FITC-conjugated rabbit anti-mouse IgG or PE-conjugated rabbit anti-mouse IgG (both DAKO) for 30 min at 4°C. Cells were examined using a FACScan (Beckton-Dickinson) and analysed with WinMDI software (Joseph Trotter, Scripps Research Institute).
Cytokine concentration determination
DCs were incubated at 5 x 105 cells in 1 ml volume. Supernatants were collected after 24 h, frozen and stored at –70°C. Cytokine concentrations were determined by cytometric bead array (Beckton-Dickinson) according to manufacturer's instructions. Samples were examined using a FACSArray Flow cytometer (Beckton-Dickinson) and analysed with BD CBA software (Beckton-Dickinson).
Allogeneic proliferation assays
Details of these assays have been published previously (18). Briefly, day 6 DCs were cultured in 3 ml volumes in the presence or absence of CEP inhibitor. LPS (100 ng ml–1) or zymosan (10 µg ml–1) was added to some wells on day 7 for a further 24 h. DCs were collected, washed thoroughly to remove inhibitor or stimulant, counted and re-cultured in 96-well round bottom plates at numbers shown in the figure. Allogeneic T cells were obtained from the non-adherent population of PBMC fraction, and cryopreserved in FCS containing 10% dimethylsulfoxide (Sigma–Aldrich) at –70°C. Cells were thawed rapidly (37°C) and B cells, monocytes and macrophages were depleted by incubation with CD19, HLA-DR and CD14 MoAb for 45 min on ice. Cells were washed and then mixed with magnetic microbeads and separated on magnetic columns. T cells were used immediately after purification. 105 T cells were added to each well. On day 3, the cells were pulsed with 1 µCi [3H]thymidine (ICN Biomedical, High Wycombe, UK) for the final 18 h of culture. Cells were harvested and T cell proliferation was measured by liquid scintillation counting (Microbeta Systems). All assays were performed in triplicate. Control wells contained T cells only and DCs only, and these yielded <1000 counts per minute thymidine incorporation.
Statistics and data analysis
Statistical significance of changes in median fluorescence intensity and cytokine secretion of inhibitor-treated versus control stimulation was determined using pairwise one-way analysis of variance with Dunnetts modification.
| Results |
|---|
|
|
|---|
Several MLK isoforms are expressed in DC
No data on expression, activation or function of MLKs in DC have been reported previously. Therefore, we looked for mRNA for all five members of the MLK family in these highly purified DC preparations using nested PCR. As shown in Fig. 1a, MLKs 2, 3, 4 and DLK message (lanes marked m), but not MLK1 message, are expressed in the reference baseline DC population. The size of the fragments corresponded to the predicted product size in each case, and the identity of all the PCR products was confirmed by sequencing. Genomic DNA was used as a positive control to confirm that the primer pairs were functioning correctly (lanes marked g). The design of the nested primer strategy was such that the polymerase crossed intron/exon boundaries, thus excluding the possibility that the signals observed were due to contaminating genomic DNA.
In order to confirm that the presence of message correlated with protein expression, and also to rule out the possibility that the PCR signal was derived from a minor contaminating cell population, the expression of MLK2, 3 and DLK protein was demonstrated by western blot (Fig. 1b, left panel) (no antibody was available for MLK1 and MLK4). All three enzymes were already expressed in monocytes, as well as at day 4 and day 7 of DC culture. In view of the absence of MLK1 message, and the previous observations that this form is found in epithelial rather than haematopoietic cells, expression of this kinase was not pursued further, although the remote possibility cannot be formally excluded that some very long-lived residual protein might be present in the absence of further translation. Equal numbers of cells were added to each lane, and the amount of MLK3 protein on a per cell basis can be seen to increase rapidly during the first four days of differentiation. This coincided with an overall general increase in cell size and in cell protein content during monocyte to DC transition, as shown by the total protein stain (1b, right panel) and by control western blotting for actin.
MLK3 phosphorylation is induced by TLR ligation
MLKs are believed to be phosphorylated at multiple sites, some of which are associated with enzyme activation while others are constitutive. The expression and phosphorylation of MLK3, the most widely expressed MLK and now known to be present in DC (Fig. 1), was examined (Fig. 2). LPS at the concentration which induces maximal DC maturation in this model (100 ng ml–1) induced a time-dependent increase in MLK3 phosphorylation as evidenced by increased binding of an antibody recognizing phosphorylated MLK3 Thr277/Ser281. The phospho-western blot showed the presence of a consistent basal level of phosphorylation before stimulation. This was associated with two bands, although the relative intensity of the two bands varied between individuals. Phosphorylation peaked at 40 min, somewhat before maximal phosphorylation of p38 or JNK, which was observed after 60 min (10; data not shown).
|
Next, we examined the ability of different concentrations of three different PRR ligands, LPS, poly (I:C) and zymosan, to induce MLK phosphorylation. Phosphorylation was induced by LPS concentrations of 10 ng ml–1 or higher and 10 µg ml–1 poly (I:C) or higher, the concentrations which also activate p38 (10; data not shown). The pattern of phosphorylation observed was different for the two stimuli, since LPS induced phosphorylation of the upper band of MLK predominantly, while poly (I:C) induced strong phosphorylation of both bands. In contrast, no additional phosphorylation of MLK3 above the basal level was observed at any concentration between 10 ng and 10 µg ml–1 zymosan.
MLK activity is required for activation of p38 and JNK
Although described originally as a JNK-specific MAP3K, MLK3 is known to also operate upstream of p38 (19). To investigate the downstream MAPK targets of MLK in DC, we used an MLK-specific inhibitor CEP11004, which inhibits MLKs 1, 2, 3 and DLK, but not the closely related LZK proteins or other less closely related kinases, such as PKC (20). The ability of different concentrations of the CEP11004 inhibitor to prevent LPS-induced activation of p38 and JNK was first examined (Fig. 3a). Both p38 and JNK phosphorylation was blocked in a dose-dependent manner. The inhibitor alone had no effects on phosphorylation of either of the MAPKs. Two other selective serine/threonine kinase inhibitors, SB203580 (a selective inhibitor of p38) and SP600125 (a selective inhibitor of JNK), had no effect on phosphorylation of the MAPKs (data not shown).
|
A concentration of 1 µM was chosen for further study, consistent with previous cellular studies with this inhibitor (20). This concentration gave almost maximal inhibition of JNK and p38, but had no effect on cell viability, as judged by propidium iodide/annexin V staining [(10) and data not shown].
DCs were also stimulated with poly (I:C), or zymosan, in the presence or absence of 1 µM CEP11004 (Fig. 3b and c). CEP11004 inhibited both p38 and JNK activation in response to poly (I:C), similar to its effects on LPS-induced MAPK phosphorylation shown in panel a. In contrast, CEP11004 had very little effect on p38 activation induced by zymosan (Fig. 3c). JNK was not activated by zymosan, so the effects of the inhibitor could not be tested.
The failure of zymosan to induce MLK3 phosphorylation and the failure of CEP11004 to block p38 phosphorylation in response to zymosan are both consistent with the notion that the signalling pathway activated by zymosan utilizes a distinct MAP3K compared with that activated by zymosan.
MLK inhibition inhibits DC activation in response to LPS and poly (I:C), but not zymosan
Given that MLK is an upstream regulator of MAPKs in DC (Fig. 3) and MAPKs have been shown to be important in controlling DC activation, we next investigated the effects of MLK inhibition on DC-surface phenotype and cytokine synthesis. DCs were stimulated with LPS, poly (I:C) or zymosan in the presence of MLK and MAPK inhibitors, and then examined by flow cytometry, and supernatants were examined by ELISA.
Three consistent and reproducible cell-surface indicators of DC activation were chosen, reflecting the primary antigen-specific signal (HLA-DR), the co-stimulatory signal (CD86) and a terminal differentiation marker (CD83). Preliminary experiments established that optimal up-regulation of all three markers was induced by 100 ng ml–1 LPS, 25 µg ml–1 poly (I:C) and 10 µg ml–1 zymosan (not shown). First different concentrations of the MLK inhibitor were tested for their effect on LPS-induced CD86 up-regulation (Fig. 4a). CEP11004 (1 µM) gave maximal inhibition, demonstrating that inhibition of CD86 induction was correlated with inhibition of p38 and JNK (Fig. 3a). Then the same concentration of CEP was tested on DC stimulated by all three TLR ligands. The effects of the p38 (SB 203580) and JNK (SP600125) inhibitors, at optimal non-toxic concentrations determined previously (10), were also tested in parallel (Fig. 4b).
|
Inhibition of p38 blocked up-regulation of all three of the surface markers examined in response to all three stimuli (Fig. 4b–d). These observations confirm and extend previous studies emphasizing the central role for p38 MAPK in controlling DC activation. Blocking the JNK pathway did not significantly inhibit up-regulation of any marker in response to any of the three stimuli tested (Fig. 4b–d).
In contrast to the MAPK inhibitors, the inhibitory activity of CEP11004 was highly dependent on which TLR stimulus was tested. Up-regulation of all three markers induced by LPS or poly (I:C) was blocked by the MLK inhibitor to the same extent as by the inhibitor of p38 (Fig. 4b and c) . In contrast, MLK inhibition had no effect on the up-regulation of surface markers stimulated by zymosan (Fig. 4d).
All inhibitors were non-toxic at the concentrations shown (10), and did not alter the level of expression of surface markers in the absence of TLR ligation (data not shown).
To examine the effect of inhibiting MLK or MAPK on DC further, the secretion of three cytokines, TNF-
, IL10 and IL6 was also studied (Fig. 5). Since the absolute levels of each cytokine released in response to each stimulus differed, the data are normalized to cytokine level in the presence of stimulus and absence of inhibitor. The absolute value of cytokine concentration corresponding to 100% is also shown, however, above each 100% bar (see Fig. 5).
|
Inhibition of p38 blocked secretion of IL10, IL6 and TNF
in response to all three stimuli as described previously (21, 22), and secretion of IL10 and IL6 in response to zymosan (Fig. 5a–c, middle columns of each panel). The exception was the release of TNF
in response to zymosan (panel 5c, left panel), which was enhanced in the presence of p38 inhibitor. Similarly to phenotype, no consistent inhibition of cytokine secretion by the JNK inhibitor was observed (data not shown). IL12p70 levels were also measured but were below the sensitivity of the assay under the conditions used. As before, the effects of the MLK CEP11004 inhibitor were stimulus specific. Inhibition of MLK blocked cytokine secretion in response to LPS and poly (I:C), but had no inhibitory effect on any cytokine secreted in response to zymosan (Fig. 5a–c, right column of each panel).
To rule out that the selectivity between LPS and zymosan was simply a dose-related effect, the release of cytokines was tested at a series of different inhibitor concentrations (Fig. 5d and e). A reduction in the secretion of all cytokines in response to LPS was seen at inhibitor concentrations of 0.1 µM or above. In contrast, no inhibition of the zymosan-induced response was seen at any concentration.
MLK inhibition blocks LPS-induced enhancement of antigen presentation
In order to examine the effects of MLK inhibition on DC function, CEP-treated DCs were tested as stimulators in an allogeneic T cell proliferation response. As shown in Fig. 6 (left panel), LPS-treated DCs showed enhanced ability to stimulate allogeneic T cell proliferation. In contrast, DCs pre-treated with CEP (1 µM) showed reduced potency in antigen presentation. Furthermore, the antigen-presenting cell (APC) activity of CEP-treated DC was not increased by LPS treatment, which was consistent with the inhibitor effects of CEP on LPS-induced phenotypic changes and cytokine release. Zymosan did not enhance the APC activity of DC in this assay, irrespective of the presence or absence of CEP. This may reflect the high release of IL10 triggered by this ligand (Fig. 5).
|
| Discussion |
|---|
|
|
|---|
The identity of the MAP3Ks that are involved in TLR signalling, and hence in DC activation, remains poorly defined. Previous studies have implicated transforming growth factor ß-activated kinase 1, but it remains unclear whether the major function of this kinase is to activate p38 MAPK or to activate nuclear factor-kappa B directly (23, 24). Several MAP3Ks have been implicated in p38 and JNK MAPK activation downstream of TLR including MEKK1 (25), MEKK3 (26) and ASK1 (27). The expression and function of other MAP3Ks in DC, and specifically the MLK family of proteins, has not been investigated previously.
In this study, we found that of the five MLK proteins investigated, four were expressed in DC. MLK1 was not detected. In the one other study investigating MLK expression in haematopoietic cells directly, MLK1 was found to be present in the monocytic THP1 cell line, but at the lowest abundance of the three MLK proteins examined (28).
The role of MLK proteins in TLR signalling is not well documented, although studies have recently suggested the involvement of MLK in LPS responses (28, 29) and Myd88-dependent responses (30) in other cell types. In this study, a link between at least one member of the MLK family, MLK3, and TLR signalling is demonstrated by showing that MLK3 is phosphorylated in response to the TLR4 ligand LPS and the TLR3 ligand poly (I:C). In every experiment, two bands were seen when immunoblotting for phosphorylated MLK3, which may reflect the presence of a hyperphosphorylated second isoform possessing a slightly different electrophoretic mobility, as has been described previously (14). Only one band was observed when blotting for total MLK. A possible explanation for this is that the peptide sequence recognized by this antiserum (which was not available from the manufacturer) may be obscured when the enzyme is hyperphosphorylated.
The upstream phosphorylation events controlling MLK3 activity are not completely understood, and may reflect a combination of auto-phosphorylation and hetero-phosphorylation by kinases including AKT2 (31) and germinal centre kinases (32). The MLK inhibitor CEP11004 did not block phosphorylation of MLK3 induced in response to TLR ligation (not shown). This suggests that an additional kinase, rather than auto-phosphorylation, was responsible for the MLK3 phosphorylation observed (Fig. 2) in response to ligation of TLR.
The time course of MLK activation in DC, which peaked at
40 min, was consistent with a function in downstream activation of MAPKs, since maximal phosphorylation of p38 and JNK is observed slightly later, at around 60 min post-stimulation. The temporal link between MLK and MAPK activity was further supported by pharmacological studies using the selective MLK inhibitor CEP11004. In agreement with several other studies, inhibition of MLKs in general interfered with downstream signalling via both the p38 and JNK MAPK pathways. Remarkably, the involvement of MLK was again stimulus dependent. Inhibition of MLK blocked p38 and JNK activation in response to both LPS and poly (I:C), but had little or no effect on activation by zymosan. Thus, activation of p38 is a common end point in signalling via TLR3 and 4 and TLR2/6, but is mediated via different upstream pathways. The MLK requirement of other TLR ligands has not been investigated fully, although preliminary studies suggest that, similar to the zymosan response, MLK inhibition does not significantly prevent p38 phosphorylation induced by the synthetic TLR7 agonist, R848 (data not shown).
Differences between signalling pathways activated via different TLRs are further reinforced by examining the selective effects of the MLK inhibitor on DC function. Thus, whereas inhibition of p38 MAPK inhibits both cell-surface phenotype changes and cytokine secretion in response to LPS, poly (I:C) and zymosan, inhibition of MLK3 blocks only the responses to LPS and poly (I:C). This is consistent with a recent study of cytokine secretion by macrophages (28).
The difference in MLK dependence of different TLR pathways remains to be explained at a molecular level. One attractive hypothesis is that these differences may reflect the utilization of different intracellular adaptor proteins by the TLRs. Analysis of mice deficient for different adaptor proteins indicates that TLR3 and TLR4, but not TLR2, possess a strong signalling requirement for the TIR-domain-containing adaptor inducing IFN-ß (TRIF) protein (33). These effects are similar to those reported in this study and suggest that TRIF-dependent MAPK activation may operate via MLK. Zymosan does not signal via TRIF, and requires the DC-associated C-type lectin (Dectin)-1 protein in synergy with TLR2 to induce TNF
(34). Stimulation by zymosan of this additional lectin-dependent pathway may therefore bypass signalling via MLK.
In conclusion, therefore, this study is the first to report involvement of the MLK family in the regulation of DC. The results are consistent with a role for MLKs as MAP3Ks, inducing the phosphorylation and activation of the downstream kinases p38 and JNK. Our previous study (10) showed that this is not a direct effect as the inhibitor does not target either of these kinases. Although the results need to be interpreted with caution, since pharmacological signalling inhibitors may have more than one effect, this upstream role seems the most logical explanation for our findings. Further functional studies to confirm this are in progress in our laboratory, but are handicapped by the cell system that we are investigating: DCs are very sensitive to intracytoplasmic dsRNA, making experiments with siRNA more difficult than with other primary cell types and/or established cell lines.
Furthermore, the demonstration that some PRR ligands use MLKs to activate their respective intracellular pathways, and others do not, may well provide an important and new perspective on DC activation pathways and their relevance. The identity of the PRR agonist is one of several factors important in determining the Th1/Th2 balance of the resulting immune response, and these studies imply that the differential involvement of the MLKs as signal transduction proteins may be one way to regulate the polarity of this outcome(35–37). In fact, both functional studies and transcriptional profiling (38–40) have documented that the response to different pathogens in DC involves a common core response, but also a degree of plasticity capable of tailoring the response to the pathogen. The present study highlights the possibility that MLKs are one of the steps which define the downstream consequences of signalling via mediated different PRRs and that therefore MLKs may prove attractive as targets for selective immuno-modulation at the interface between innate and adaptive immunity.
| Acknowledgements |
|---|
The Medical Research Council, UK, partially funded this work. We would like to thank Emma Willoughby, Av Mitchison and Jurgen Roes (all at University College London) for their useful comments and critical reading of the manuscript. We are also grateful to Katherine Swensen (Department of Pharmacology and Cancer Biology, Duke University Medical Center, Durham) for much helpful advice and discussion in regarding to testing MLK3 expression and function.
| Abbreviations |
|---|
| APC, antigen-presenting cell |
| CM, complete medium |
| DC, dendritic cell |
| ECL, enhanced chemiluminescence |
| EDTA, ethylene diamine tetra-acetic acid |
| GM-CSF, granulocyte macrophage colony-stimulating factor |
| MAPK, mitogen-activated protein kinase |
| MAP3K, MAPK kinase kinase |
| MLK, mixed lineage kinase |
| PRR, pattern recognition receptor |
| TLR, toll-like receptor |
| TRIF, TIR-domain-containing adaptor inducing IFN-ß |
| Notes |
|---|
Transmitting editor: M. Feldmann
Received 25 August 2006, accepted 30 March 2007.
| References |
|---|
|
|
|---|
- Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature (1998) 392:245.[CrossRef][Medline]
- Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response. Nature (2000) 406:782.[CrossRef][Medline]
- Medzhitov R, Preston-Hurlburt P, Janeway CA Jr. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature (1997) 388:394.[CrossRef][Medline]
- Mazzoni A, Segal DM. Controlling the Toll road to dendritic cell polarization. J. Leukoc. Biol. (2004) 75:721.
[Abstract/Free Full Text] - Netea MG, van der GC, Van der Meer JW, Kullberg BJ. Toll-like receptors and the host defense against microbial pathogens: bringing specificity to the innate-immune system. J. Leukoc. Biol. (2004) 75:749.
[Abstract/Free Full Text] - Reise Sousa. Toll-like receptors and dendritic cells: for whom the bug tolls. Semin. Immunol. (2004) 16:27.[CrossRef][Web of Science][Medline]
- Yamamoto M, Takeda K, Akira S. TIR domain-containing adaptors define the specificity of TLR signaling. Mol. Immunol. (2004) 40:861.[CrossRef][Web of Science][Medline]
- Yoshimura S, Bondeson J, Foxwell BM, Brennan FM, Feldmann M. Effective antigen presentation by dendritic cells is NF-kappaB dependent: coordinate regulation of MHC, co-stimulatory molecules and cytokines. Int. Immunol. (2001) 13:675.
[Abstract/Free Full Text] - Puig-Kroger A, Relloso M, Fernandez-Capetillo O, Zubiaga A, Silva A, Bernabeu C, Corbi AL. Extracellular signal-regulated protein kinase signaling pathway negatively regulates the phenotypic and functional maturation of monocyte-derived human dendritic cells. Blood (2001) 98:2175.
[Abstract/Free Full Text] - Handley ME, Thakker M, Pollara G, Chain BM, Katz DR. JNK activation limits dendritic cell maturation in response to reactive oxygen species by the induction of apoptosis. Free Radic. Biol. Med. (2005) 38:1637.[CrossRef][Web of Science][Medline]
- Gallo KA, Johnson GL. Mixed-lineage kinase control of JNK and p38 MAPK pathways. Nat. Rev. Mol. Cell Biol (2002) 3:663.[CrossRef][Web of Science][Medline]
- Wang LH, Besirli CG, Johnson EM. MIXED-LINEAGE KINASES: a target for the prevention of neurodegeneration. Annu. Rev. Pharmacol. Toxicol. (2004) 44:451.[CrossRef][Web of Science][Medline]
- Falsig J, Porzgen P, Lotharius J, Leist M. Specific modulation of astrocyte inflammation by inhibition of mixed lineage kinases with CEP-1347. J. Immunol. (2004) 173:2762.
[Abstract/Free Full Text] - Swenson KI, Winkler KE, Means AR. A new identity for MLK3 as an NIMA-related, cell cycle-regulated kinase that is localized near centrosomes and influences microtubule organization. Mol. Biol. Cell (2003) 14:156.
[Abstract/Free Full Text] - Hirai S, Kawaguchi A, Hirasawa R, Baba M, Ohnishi T, Ohno S. MAPK-upstream protein kinase (MUK) regulates the radial migration of immature neurons in telencephalon of mouse embryo. Development (2002) 129:4483.
[Abstract/Free Full Text] - Chadee DN, Kyriakis JM. MLK3 is required for mitogen activation of B-Raf, ERK and cell proliferation. Nat. Cell Biol (2004) 6:770.[CrossRef][Web of Science][Medline]
- Handley ME, Pollara G, Chain BM, Katz DR. The use of targeted microbeads for quantitative analysis of the phagocytic properties of human monocyte-derived dendritic cells. J. Immunol. Methods (2005) 297:27.[CrossRef][Web of Science][Medline]
- Newton PJ, Weller IV, Katz DR, Chain BM. Autologous apoptotic T cells interact with dendritic cells, but do not affect their surface phenotype or their ability to induce recall immune responses. Clin. Exp. Immunol. (2003) 133:50.[CrossRef][Web of Science][Medline]
- Tibbles LA, Ing YL, Kiefer F, et al. MLK-3 activates the SAPK/JNK and p38/RK pathways via SEK1 and MKK3/6. EMBO J (1996) 15:7026.[Web of Science][Medline]
- Murakata C, Kaneko M, Gessner G, et al. Mixed lineage kinase activity of indolocarbazole analogues. Bioorg. Med. Chem. Lett. (2002) 12:147.[CrossRef][Medline]
- Liu YW, Chen CC, Tseng HP, Chang WC. Lipopolysaccharide-induced transcriptional activation of interleukin-10 is mediated by. Cell Signal (2006) 18:1492.[CrossRef][Web of Science][Medline]
- Xie J, Qian J, Wang S, Freeman ME III, Epstein J, Yi Q. Novel and detrimental effects of lipopolysaccharide on in vitro generation of immature dendritic cells: involvement of mitogen-activated protein kinase p38. J. Immunol. (2003) 171:4792.
[Abstract/Free Full Text] - Jiang Z, Mak TW, Sen G, Li X. Toll-like receptor 3-mediated activation of NF-kappaB and IRF3 diverges at Toll-IL-1 receptor domain-containing adapter inducing IFN-beta. Proc. Natl Acad. Sci. USA (2004) 101:3533.
[Abstract/Free Full Text] - Irie T, Muta T, Takeshige K. TAK1 mediates an activation signal from Toll-like receptor(s) to nuclear factor-kappaB in lipopolysaccharide-stimulated macrophages. FEBS Lett (2000) 467:160.[CrossRef][Web of Science][Medline]
- Matsuguchi T, Masuda A, Sugimoto K, Nagai Y, Yoshikai Y. JNK-interacting protein 3 associates with Toll-like receptor 4 and is involved in LPS-mediated JNK activation. EMBO J (2003) 22:4455.[CrossRef][Web of Science][Medline]
- Huang Q, Yang J, Lin Y, Walker C, Cheng J, Liu ZG, Su B. Differential regulation of interleukin 1 receptor and Toll-like receptor signaling by MEKK3. Nat. Immunol. (2004) 5:98.[CrossRef][Web of Science][Medline]
- Into T, Shibata K. Apoptosis signal-regulating kinase 1-mediated sustained p38 mitogen-activated protein kinase activation regulates mycoplasmal lipoprotein- and staphylococcal peptidoglycan-triggered Toll-like receptor 2 signalling pathways. Cell Microbiol (2005) 7:1305.[CrossRef][Web of Science][Medline]
- Ciallella JR, Saporito M, Lund S, Leist M, Hasseldam H, McGann N, Smith CS, Bozyczko-Coyne D, Flood DG. CEP-11004, an inhibitor of the SAPK/JNK pathway, reduces TNF-alpha release from lipopolysaccharide-treated cells and mice. Eur. J. Pharmacol. (2005) 515:179.[CrossRef][Web of Science][Medline]
- Lund S, Porzgen P, Mortensen AL, Hasseldam H, Bozyczko-Coyne D, Morath S, Hartung T, Bianchi M, Ghezzi P, Bsibsi M, Dijkstra S, Leist M. Inhibition of microglial inflammation by the MLK inhibitor CEP-1347. J. Neurochem. (2005) 92:1439.[CrossRef][Web of Science][Medline]
- Sun D, Ding A. MyD88-mediated stabilization of interferon-gamma-induced cytokine and chemokine mRNA. Nat. Immunol (2006) 7:375.[CrossRef][Web of Science][Medline]
- Figueroa C, Tarras S, Taylor J, Vojtek AB. Akt2 negatively regulates assembly of the POSH-MLK-JNK signaling complex. J. Biol. Chem (2003) 278:47922.
[Abstract/Free Full Text] - Chadee DN, Yuasa T, Kyriakis JM. Direct activation of mitogen-activated protein kinase kinase kinase MEKK1 by the Ste20p homologue GCK and the adapter protein TRAF2. Mol. Cell Biol (2002) 22:737.
[Abstract/Free Full Text] - Yamamoto M, Sato S, Hemmi H, et al. Role of adaptor TRIF in the MyD88-independent toll-like receptor signaling pathway. Science (2003) 301:640.
[Abstract/Free Full Text] - Rogers NC, Slack EC, Edwards AD, et al. Syk-dependent cytokine induction by Dectin-1 reveals a novel pattern recognition pathway for C type lectins. Immunity (2005) 22:507.[CrossRef][Web of Science][Medline]
- Re F, Strominger JL. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells. J. Biol. Chem (2001) 276:37692.
[Abstract/Free Full Text] - Agrawal S, Agrawal A, Doughty B, et al. Cutting edge: different Toll-like receptor agonists instruct dendritic cells to induce distinct Th responses via differential modulation of extracellular signal-regulated kinase-mitogen-activated protein kinase and c-Fos. J. Immunol (2003) 171:4984.
[Abstract/Free Full Text] - Dillon S, Agrawal A, Van Dyke T, et al. A Toll-like receptor 2 ligand stimulates Th2 responses in vivo, via induction of extracellular signal-regulated kinase mitogen-activated protein kinase and c-Fos in dendritic cells. J. Immunol (2004) 172:4733.
[Abstract/Free Full Text] - Kaisho T, Akira S. Pleiotropic function of Toll-like receptors. Microbes. Infect (2004) 6:1388.[CrossRef][Web of Science][Medline]
- Moschella F, Maffei A, Catanzaro RP, et al. Transcript profiling of human dendritic cells maturation-induced under defined culture conditions: comparison of the effects of tumour necrosis factor alpha, soluble CD40 ligand trimer and interferon gamma. Br. J. Haematol (2001) 114:444.[CrossRef][Web of Science][Medline]
- Messmer D, Messmer B, Chiorazzi N. The global transcriptional maturation program and stimuli-specific gene expression profiles of human myeloid dendritic cells. Int. Immunol (2003) 15:491.
[Abstract/Free Full Text]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





