Skip Navigation


International Immunology Advance Access originally published online on March 15, 2007
International Immunology 2007 19(5):583-590; doi:10.1093/intimm/dxm023
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/5/583    most recent
dxm023v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lindsey, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lindsey, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Japanese Society for Immunology. 2007. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Dexamethasone-induced Ras-related protein 1 is a potential regulatory protein in B lymphocytes

JW Lindsey

Department of Neurology, University of Texas-Houston Medical School, 6431 Fannin Street, Suite 7.044, Houston, TX 77030, USA

Correspondence to: J. W. Lindsey; E-mail: john.w.lindsey{at}uth.tmc.edu


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Dexamethasone-induced Ras-related protein 1 (RASD1) is a protein of the Ras family which probably has a regulatory function. We demonstrate that Rasd1 mRNA is expressed in mouse lymph node cells in response to inhibitory stimuli. Rasd1 mRNA is present at very low levels in freshly isolated cells, but it is rapidly up-regulated in culture and is expressed at elevated levels in cells whose proliferation is blocked by exposure to homogenized brain tissue. The cells expressing Rasd1 mRNA are positive for MHC class II and B220 and negative for Thy-1. Expression of Rasd1 mRNA is very low in B cell-deficient mice. We conclude that Rasd1 mRNA is expressed by B lymphocytes derived from lymph node cells in response to inactivating or inhibitory stimuli. It may play a role in regulating B lymphocyte activity and proliferation.

Keywords: B cells, immune regulation, Ras proteins


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Immune responses in the brain must be tightly regulated to prevent damage to this vitally important organ. Homogenized brain tissue inhibits antigen-driven proliferation of lymph node cells in vitro, and this activity in culture may be relevant to the regulation of immune responses in the intact brain (1). We performed microarray experiments to measure the effects of exposure to brain homogenate (BH) on mRNA expression in lymph node cells. We found that exposure to BH up-regulated expression of the Rasd1 mRNA.

Dexamethasone-induced Ras-related protein 1 (RASD1) is a member of the Ras family of proteins, which plays a central role in intracellular signaling (2). Murine Rasd1 mRNA was discovered using differential display techniques to find mRNA induced in cultured corticotroph cells by exposure to dexamethasone (Dex) (3). The closely related human homolog, also known as activator of G protein signaling or AGS1, was identified in a genetic screen for non-receptor proteins which activate G proteins (4). It is also induced by corticosteroids (5). Rasd1 mRNA is found in many tissues including brain, heart, liver and kidney (3, 5, 6). It is present in bone marrow, but is reported to be absent or at very low levels in spleen, lymph node and peripheral blood leukocytes (6, 7).

The existing knowledge of RASD1 suggests that it has a regulatory or inhibitory role, in spite of the fact that it activates G proteins (8). Its induction in corticotroph cells by corticosteroids suggests that it may play a role in the negative feedback loop controlling adrenocorticotropic hormone (ACTH) secretion (9). Transfection of several different cell lines with a RASD1 expression vector inhibited their growth and survival, suggesting that RASD1 may be important in preventing aberrant cell growth (7). This function might be particularly relevant for the immune system. In other cell culture systems, RASD1 inhibits signal transduction through several different G protein-coupled receptors (1013).

A role for RASD1 in immune regulation has not been previously suggested. In this work, we demonstrate that Rasd1 mRNA is expressed at low levels in freshly isolated lymph node cells, but is rapidly up-regulated in response to inhibitory stimuli. We suggest that RASD1 is potentially an important regulator of immune responses and that Rasd1 expression is a potential marker for inhibited cells.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice
The majority of experiments were done with outbred ICR female mice weighing 21–24 g (Harlan Sprague Dawley, Houston, TX, USA). We chose this strain because it has a vigorous in vitro proliferative response, and we felt that results consistently obtained in an outbred strain are more likely to be relevant to normal immune regulation than results from an inbred strain. Experiments with B cell-deficient mice used female B6.129S2-Igh-6tmlCgn/J mice with C57BL/6 mice as controls (Jackson Laboratory, Bar Harbor, ME, USA). These mice were 6–8 weeks old at immunization. All experiments were approved by the Animal Welfare Committee of the University of Texas Health Science Center at Houston.

Brain Homogenate
Naive ICR mice were euthanized with CO2 narcosis and perfused through the heart with 10 ml saline. The brain was removed, weighed and homogenized in a Dounce homogenizer in 10 mM HEPES at a concentration of 125 mg wet tissue ml–1. The homogenate was centrifuged 5 min at 14 000 x g, and the supernatant was discarded. The sediment was re-suspended in PBS with 10 mM MgCl2, and incubated at 37°C for 45 min with 250 U ml–1 DNAse, 200 µg ml–1 RNAse and protease inhibitors (Sigma, St Louis, MO, USA). After enzyme treatment, the sediment was washed twice to remove nucleic acids and nucleases, and re-suspended in the original volume of HEPES.

Proliferation assays
To induce antigen-specific cells, mice were injected subcutaneously over the scapula and in the flank with 0.1 ml of an emulsion containing 0.2 mg ovalbumin (OVA) (Sigma), 0.2 mg Mycobacterium tuberculosis, 0.05 ml of PBS and 0.05 ml of incomplete Freund's adjuvant (Difco, Detroit, MI, USA). Ten to thirty days later the mice were sacrificed, and the axillary, inguinal and paraaortic lymph nodes were removed. Lymph nodes were ground between two glass slides to create a single-cell suspension, washed once with Hanks’ balanced salt solution and re-suspended in RPMI 1640 media supplemented with penicillin, streptomycin, 2-mercaptoethanol and 5% FCS (all from Sigma). Lymph node cells were cultured in triplicate in 96-well round-bottomed plates at 2 x 105 cells per well with a total volume of 0.2 ml per well. Cells were cultured with no antigen, OVA at 0.5 mg ml–1, BH at 0.75 mg wet tissue ml–1 or with both OVA and BH. Dex (Sigma) was used at 10 nM with OVA, and pertussis toxin (PTX) (List Biological Laboratories, Campbell, CA, USA) was used at concentrations ranging from 1 to 1000 ng ml–1. After 2 days, 1 µCi of tritiated thymidine was added. Plates were harvested a day later using a semi-automated cell harvester, and incorporated radioactivity was counted on a scintillation counter. Assay results are reported as counts per minute (c.p.m.).

Reverse transcription–PCR to confirm presence of Rasd1 mRNA
Lymph node cells were cultured overnight with OVA + BH, and the RNA was extracted, reverse transcribed to cDNA and then amplified with two different sets of primers specific for the Rasd1 sequence. The first set amplified a 422-bp segment with the forward primer being GATCCGCGGCGAAGTCTACC and the reverse primer GGTGCAAGTCGGGGCTCATCTCG (9). The second set amplified 858 bp which included the entire protein coding sequence with the forward primer CAATGAAACTGGCCGCGATGATC and the reverse primer CTCCTAACTGATGACACAGCGC (11). After overnight incubation, the cells were collected and RNA was extracted using Trizol (Invitrogen, Carlsbad, CA, USA). Reverse transcription (RT) was done in 10 µl reactions containing 5 µl RNA, 100 U SuperScript II reverse transcriptase, 5 U RNAse inhibitor, 3 µg random hexamers and 1 mM diethylnitrophyenyl thiophosphates (dNTPs) (all reagents from Invitrogen). Samples were incubated at 42°C for 1 h, then at 95°C for 5 min and then chilled on ice. PCR was done in 25 µl reactions on a 96-well Stratagene (La Jolla, CA, USA) thermal cycler with 5 µl cDNA, 1.25 U Taq DNA polymerase (Invitrogen), 12.5 pmol forward and reverse primers, 1.5 mM MgCl2 and 0.2 mM dNTPs with 35 cycles of 95°C for 1 min, 55°C for 1 min and 72°C for 1.5 min. PCR products were visualized on 1% agarose gels stained with ethidium bromide.

Quantitative Polymerase Chain Reaction (QPCR)
Lymph node cells were obtained as described above, split into aliquots and cultured with various antigens for various times, depending on the purpose of the experiment. The combinations of antigens and time points used in each experiment are described in the results. The concentrations of cells, OVA, BH and Dex were the same as for the proliferation assays, but the large aliquots of cells were cultured in six-well plates or petri dishes rather than 96-well plates. For each batch of cells used for Quantitative Polymerase Chain Reaction (QPCR), we performed a concurrent proliferation assay with the same antigens to confirm that the cells had the expected proliferative response. Typically, each aliquot of cells for QPCR contained from 5 x 106 to 15 x 106 cells. A plate containing BH with no cells was included to control for possible contamination with residual RNA or DNA in the BH. After incubation for the desired time, both the adherent and non-adherent cells were collected. The non-adherent cells were re-suspended by pipetting and removed from the plate. After removal of the non-adherent cells and the media, adherent cells were lysed by the addition of 2 ml Trizol to the plate. The non-adherent cells were spun down, and the pellet was lysed by the addition of the Trizol from the plate. The lysed specimens were frozen at –80 until the results of the proliferation assay were available. Later, the samples were thawed, chloroform was added to cause phase separation and the aqueous phase containing RNA was removed. This was combined with five of six volumes of isopropanol, and total RNA was purified using RNeasy mini columns (Qiagen) following the manufacturer’s instructions. After elution from the column, RNA was treated for 30 min at 37°C with 1 U RNAse-free DNAse (Roche, Indianapolis, IN, USA) to digest any contaminating genomic DNA.

Quantitative real-time RT–PCR was performed utilizing the 7700 Sequence Detector (Applied Biosystems, Foster City, CA, USA). For murine Rasd1 (accession no. NM_009026), the sequences were GTCAAATCGGATTCCTGGACT for the forward primer and CAGGGAGGGAAGGAGAAGG for the reverse primer. The probe sequence was CGTGCCACAGGAGCGCCAATT. For murine ß-actin (accession no. NM_007393), the sequences were GCTCTGGCTCCTAGCACCAT for the forward primer, CCACCGATCCACACAGAGTAC for the reverse primer and ATCAAGATCATTGCTCCTCCTGAGCGC for the probe. The probes utilized the 6-FAM reporter and BHQ1 FRET quencher. Complementary DNA was synthesized in 10 µl total volume by the addition of 6 µl per well RT master mix consisting of 400 nM assay-specific reverse primer, 500 µM deoxynucleotides, Stratascript buffer and 10 U Stratascript reverse transcriptase (Stratagene) to a 96-well plate followed by a 4-µl volume of sample. Each sample was measured in triplicate plus a control without reverse transcriptase. Each plate also contained an assay-specific sDNA (synthetic amplicon oligo) standard spanning a 5-log range and a no-template control. Each plate was covered with Biofilm A (MJR, Waltham, MA, USA) and incubated in a thermocycler (MJR) for 30 min at 50°C followed by 72°C for 10 min. Subsequently, 40 µl of a PCR master mix [300 nM forward and reverse primers for Rasd1 and 400 nM primers for actin, 100 nM fluorogenic probe, 5 mM MgCl2 and 200 µM deoxynucleotides, PCR buffer and 1.25 U Taq polymerase (Continental Laboratory Products, San Diego, CA, USA)] was added directly to each well of the cDNA plate. RT master mixes and all RNA samples were pipetted by a Tecan Genesis RSP 100 robotic workstation (Tecan US, Research Triangle Park, NC, USA) and PCR master mixes were pipetted utilizing a Biomek 2000 robotic workstation (Beckman, Fullerton, CA, USA). Each assembled plate was then covered with an optically clear film (Applied Biosystems) and run in the 7700 Sequence Detector using the following cycling conditions: 95°C, 1 min; 40 cycles of 95°C, 12 s and 60°C, 1 min. The resulting data were analyzed using SDS software (Applied Biosystems) with ROX (Invitrogen) as the reference dye. The ß-actin and Rasd1 transcript levels were measured in each sample. The final data were normalized to ß-actin and are presented as the number of transcripts of Rasd1 per 106 transcripts of ß-actin.

Separation of different cell types with magnetic beads for QPCR
Magnetic beads bound to antibodies specific for Thy-1.2, B220 and rat IgG were obtained from Dynal (Oslo, Norway). The anti-rat IgG beads were incubated with a monoclonal rat antibody specific for a non-polymorphic epitope on mouse MHC class II I-A antigen (Southern Biotech, Birmingham, AL, USA) followed by incubation with normal mouse serum to block non-specific binding. Cells were cultured overnight with OVA + BH as described above, re-suspended by vigorous pipetting and spun down. Cells were re-suspended at 5 x 106 ml–1 in PBS with 0.1% BSA with 107 beads ml–1. Cells and beads were incubated 30 min at 4°C with constant mixing, and then the bound cells were removed with a magnet and washed once. Bound cells were lysed by the addition of 1 ml Trizol, and the beads were removed from the lysate with the magnet. Unbound cells were spun down and lysed in 1 ml Trizol. RNA from both bound and unbound cells was extracted and used for QPCR. The Thy-1 antigen is expressed in brain as well as on T cells; so in the experiments with the anti-Thy-1.2 beads, we used BH from AKR/J mice (Jackson Laboratory) which have the Thy-1.1 antigen. RNA was also extracted from the adherent cells which were lysed by addition of Trizol to the plate.

Separation of cell types with magnetic beads for proliferation
To determine the relative contributions of T cells and B cells to the proliferative response, we depleted T cells or B cells before and after culture. For depletion of T cells, we used the anti-Thy-1 beads described above. For depletion of B cells, we used the anti-rat IgG beads coupled to a rat anti-mouse CD19 mAb (Southern Biotech). For depletion after culture, cells were cultured for the usual 3 days with OVA in a 96-well plate, re-suspended by pipetting, collected into a 4-ml tube and split into aliquots. One aliquot was depleted of T cells, one was depleted of B cells, one was incubated with control beads (Cellection biotin beads, Dynal) and one was kept as a control. We then counted the radioactivity incorporated in the unbound cells. For depletion before culture, cells were prepared for tissue culture as usual, T or B cells were depleted with the magnetic beads and the remaining cells were put into culture with and without OVA.

Western blot
Lymph node cells were cultured with OVA in RPMI-5 with no antigen for various periods of time. Cells were collected by centrifugation, washed once with Hanks’ and then lysed in 50 µl western lysis buffer for 107 cells. For a positive control, a lysate of fresh heart tissue was made by homogenizing fresh mouse heart tissue in lysis buffer at 0.1 g ml–1. Lysed tissues were centrifuged for 10 min at 14 000 x g and the sediment was discarded. Lysates were run on a 15% polyacrylamide gel using 75–150 µg protein per lane for the lymph node cells and 30 µg protein per lane for the heart lysate. The gel was equilibrated in transfer buffer and transferred to a nitrocellulose membrane by electrophoresis at 100 V for 1 h. The membrane was washed twice, incubated with blocking buffer for 1 h, washed three times, incubated 1 h with blocking buffer containing 2 µg ml–1 of a polyclonal, affinity purified goat anti-RASD1 antibody (Abcam, Cambridge, MA, USA), washed three times, incubated with a 1:5000 dilution of a rabbit anti-goat IgG antibody conjugated to HRP (Abcam) and then washed four times. Bound antibody was then visualized with the ECL western blotting system according to the manufacturer’s instructions (Amersham Biosciences, Little Chalfont, England). All washes were for 10 min in 10 mM Tris, 150 mM NaCl and 0.05% Tween, pH 7.5. Blocking buffer was wash buffer with 2.5% non-fat dry milk. Transfer buffer was 25 mM Tris, 192 mM glycine and 20% methanol. Western lysis buffer was 150 mM NaCl, 50 mM Tris HCl, 1 mM EDTA, 1% Triton X-100, 1% sodium deoxycholate and SDS 0.1%, pH 7.4


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
PCR for Rasd1 mRNA
We initially identified Rasd1 mRNA as being up-regulated in lymph node cells after exposure to BH in culture using microarrays to compare mRNA expression between cells exposed to BH and control cells. We verified the presence of Rasd1 mRNA in lymph node cells cultured with BH using standard RT–PCR with two different sets of primers. We obtained PCR products of the expected size with both sets (data not shown).

QPCR for Rasd1 mRNA
After demonstrating that Rasd1 mRNA was indeed present, we proceeded to measure the amounts of Rasd1 mRNA with QPCR. We began with lymph node cells from OVA-immunized mice which were cultured with no antigen, BH, OVA or OVA + BH. For each condition, we measured the expression of Rasd1 mRNA after overnight culture and the proliferative response at 3 days. The proliferation results are shown in Fig. 1(a). As expected, there was little proliferation without antigen, and proliferation increased several fold over background with OVA. As reported previously, the addition of BH suppressed the proliferative response to near background.


Figure 1
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Proliferation and Rasd1 mRNA expression in lymph node cells cultured with different antigens. Results are from five individual mice with the results from each mouse denoted by a distinct symbol and line. Cells were cultured with no antigen (no Ag), BH, OVA or OVA + BH. (a) Proliferative response. Ordinate is proliferation in c.p.m. in thousands. Cells proliferate to OVA, but BH blocks proliferation. (b) Rasd1 mRNA expression. Ordinate gives number of molecules of Rasd1 mRNA per 106 molecules of actin mRNA. Rasd1 expression increases with BH.

 
The concentration of Rasd1 mRNA in each of these conditions is shown in Fig. 1(b). The concentration is given as the number of molecules of Rasd1 mRNA per 106 ß-actin mRNA molecules in the same sample. Rasd1 mRNA expression is relatively low in the no antigen or OVA cells, but increases with exposure to BH. The amount of Rasd1 mRNA in the OVA + BH cells was at least twice that of the OVA cells in each case. The relative increase of Rasd1 expression (OVA + BH divided by OVA) was 3.4 ± 1.1 (results given as mean ± SD here and throughout the results section). The absolute increase in Rasd1 mRNA (OVA + BH minus OVA) was 293 ± 60 (P = 0.0004, paired t-test). Rasd1 mRNA also increased in the BH cells compared with the no antigen cells.

The use of actin as the basis for comparison is necessary to control for variability in the RNA extraction, but assumes that actin remains fairly stable. Our data demonstrate this is a reasonable assumption. The actin mRNA increased slightly over baseline with OVA stimulation and decreased slightly with exposure to BH. The amount of actin mRNA in cells exposed to OVA + BH was 81 ± 7% of the amount in the OVA cells.

We included two types of controls. To verify that the BH itself did not contain appreciable residual RNA, we performed QPCR on samples of BH incubated without cells. The amount of actin mRNA in BH cultured with no cells was 0.38 ± 0.25% of that in cells cultured with BH, and the amount of Rasd1 mRNA was 1.3 ± 1.3% (n = 4). The QPCR method is very sensitive to contamination with genomic DNA, so we included a control without reverse transcriptase for each sample. In most cases, there was no detectable signal. For the 20 Rasd1 measurements shown in Fig. 1(b), only four contained detectable Rasd1 genomic DNA. The signal from genomic DNA never exceeded 1.5% of the signal from the corresponding reverse-transcribed sample.

QPCR demonstrates close correlation between Rasd1 mRNA and proliferation
The correlation between Rasd1 expression and proliferation was interesting, so we extended these results. We cultured cells from five additional mice with OVA or OVA + BH, and measured proliferation at 3 days and Rasd1 mRNA expression after overnight incubation. In Fig. 2, we have plotted proliferation versus Rasd1 mRNA. This figure includes data from the five mice in the previous figure plus the five additional animals. High levels of Rasd1 mRNA are associated with low proliferation, whereas low levels of Rasd1 are associated with higher proliferation. Cells with Rasd1 >400 did not proliferate. If the non-proliferating cells with Rasd1 >400 are excluded, the correlation coefficient for Rasd1 mRNA and c.p.m. is –0.93. The values >400 are excluded from the calculation to avoid a floor effect since c.p.m. cannot be negative.


Figure 2
View larger version (6K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Proliferation as a function of Rasd1 mRNA concentration. Ordinate is proliferation in c.p.m. in thousands. Abscissa is molecules of Rasd1 mRNA per 106 molecules of actin mRNA. Cells were stimulated with OVA or with OVA + BH. Low levels of Rasd1 mRNA correlate with higher proliferation. The correlation coefficient for points with Rasd1 <400 is –0.93.

 
Time course
We next investigated the time course of Rasd1 mRNA expression. We cultured cells with OVA or OVA + BH, and collected them and extracted RNA after 0, 1.5, 3 and 18 h in culture. Rasd1 mRNA was normally undetectable in freshly isolated lymph node cells. In four of five samples, there was no Rasd1 mRNA, and the fifth had only 2.8 molecules per million molecules of actin. But Rasd1 mRNA was rapidly up-regulated in culture (Fig. 3). In cells cultured with OVA, it was highly expressed after 90 min of culture, and then decreased in concentration. In cells cultured with OVA + BH, it is even more strongly up-regulated at 90 min, and it continued to be expressed at high levels after overnight culture.


Figure 3
View larger version (9K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Time course of Rasd1 expression. Abscissa is time in tissue culture in hours. The time points are 0, 1.5, 3 and 18 h. Ordinate gives number of molecules of Rasd1 mRNA per 106 molecules of actin mRNA. Values plotted are the mean of four different experiments. Error bars indicate standard deviation. Cells were cultured with either OVA or OVA + BH. Cells cultured with OVA + BH have consistently higher expression of Rasd1; the difference between OVA and OVA + BH is statistically significant at 1.5 h (P = 0.048, paired t-test) and 18 h (P = 0.046).

 
The high level of expression continues for at least another 24 h. In a subsequent experiment with cells from four animals, the mean Rasd1 mRNA in cells cultured with OVA + BH was 442 at 16 h and 455 at 40 h. The corresponding values for cells cultured with OVA were 231 at 16 h and 172 at 40 h.

Cell type-expressing Rasd1 mRNA
We used mAbs bound to magnetic beads to define the cell type-expressing Rasd1. After overnight culture, non-adherent cells were collected and separated with magnetic beads, and Rasd1 mRNA was measured in both the bound and the unbound cells. Rasd1 mRNA was not found in Thy-1 cells, but was found in cells expressing the B220 or MHC class II antigens (Table 1).


View this table:
[in this window]
[in a new window]

 
Table 1 Cell-surface markers and Rasd1 expression

 
The bead separation was possible only for the non-adherent cells. We also measured the expression of Rasd1 in the adherent cells. The amount of actin mRNA in the adherent cells was only 1.5 ± 0.7% of the total, and the Rasd1 mRNA concentration per 106 actin was 144 ± 148 compared with 258 ± 156 in the non-adherent cells (n = 4). We conclude that the adherent cells were a minor fraction of the total cells and do not have increased expression of Rasd1 compared with the non-adherent cells.

Rasd1 mRNA in B cell-deficient mice
To further investigate the cell type-expressing Rasd1 mRNA, we performed an experiment comparing B cell-deficient mice with control mice of the same strain (Fig. 4). Lymph node cells from C57BL/6 mice cultured with OVA + BH had expression of Rasd1 mRNA similar to the ICR mice, with marked expression after 90 min which remained elevated after overnight culture. The B cell-deficient mice had only minimal expression of Rasd1 at either time points, with the maximum expression at 90 min being 22 copies per million actin. This supports the idea that the majority of Rasd1 is expressed in B cells.


Figure 4
View larger version (9K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Rasd1 expression in B cell-deficient and control mice. Cells from B cell-deficient or control mice were cultured with OVA + BH for either 90 min or 18 h. There were four different B cell-deficient mice, two at each time point, and four controls. Each data point represents results from a single mouse. Rasd1 is expressed at very low levels in the B cell-deficient mice.

 
Importance of B cells for proliferation in culture
Since Rasd1 mRNA appeared to be up-regulated in B cells, we determined the importance of B cells for the in vitro proliferative response using three complementary approaches. In the first series of experiments, we cultured whole lymph node cells with OVA for the standard 3-day period. Before counting the incorporated radioactivity, we removed CD19+ or Thy-1+ cells with magnetic beads. Control beads without specific antibody removed 7.1 ± 5.9% of the radioactivity. The amount of radioactivity in the CD19-depleted cells was 46.1 ± 13.5% of the control bead-depleted cells, while the amount of radioactivity in the Thy-1-depleted cells was 48.9 ± 13.9% (n = 6). This indicates that both B and T cells are proliferating, and the response is about equally divided between the two types of cells. There also appears to be some non-specific binding, since both types of beads deplete slightly >50% of the activity. Since we have controlled for non-specific losses during the bead depletion procedure, there may be some adherence of activated cells to other cells which are specifically bound to the beads.

In a second set of experiments, we depleted CD19+ or Thy-1+ cells from the whole lymph node cells first and then cultured for 3 days with no antigen or OVA. The c.p.m. in the CD19– cells was 39.5 ± 12.4% of the c.p.m. in the whole cells, and the Thy-1– cells had a c.p.m. which was 29.1 ± 6.6% of the whole cells (n = 6). Removal of either B or T cells before culture greatly reduced the proliferation.

In the third set of experiments, we compared the responses of the B cell-deficient and control mice (Fig. 5). Lymph node cells from B cell-deficient mice had a lower background proliferation with no antigen, but still had a significant antigen-stimulated proliferative response and robust suppression with BH.


Figure 5
View larger version (8K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Proliferative response of B cell-deficient and control mice. Cells were cultured with no antigen (no Ag), OVA or OVA + BH. Cells from B cell-deficient mice proliferated somewhat less vigorously than control mice, but the difference is not significant. Proliferation in both B cell-deficient and control mice suppresses well with BH. n = 6 for the B cell deficient and 5 for the controls.

 
From these three sets of experiments, we conclude that B cells are not required for antigen-driven proliferation in vitro, nor are they required for the suppressive effect of BH. But they do play an important part in the proliferative response. They are responder cells which are dividing themselves, and they may also stimulate the proliferation of T cells.

Rasd1 with DEX
Since Rasd1 was originally described as an mRNA which was induced with Dex (3), we determined whether it was up-regulated in lymph node cells exposed to Dex. Cells were cultured with either OVA or OVA + Dex. The concentration of Dex used was sufficient to completely block proliferation. In preliminary experiments with overnight culture, the amount of actin mRNA was very low in cells cultured with Dex. Since the amount of Rasd1 mRNA is standardized to the amount of actin in the same sample, this made the results uninterpretable. In subsequent experiments, we took samples for mRNA extraction at 1.5 and 3 h when actin mRNA expression was still comparable. We found an increase of Rasd1 in both cells cultured with OVA and in cells cultured with OVA + Dex, but no significant difference in expression between the two (Table 2). Either lymph node cells do not up-regulate Rasd1 in response to Dex, or the expression induced by the transition to tissue culture is already maximal and the effect of Dex is masked.


View this table:
[in this window]
[in a new window]

 
Table 2 Effect of Dex

 
Effects of PTX
Since RASD1 affects G proteins, its effects may be blocked by PTX. Therefore, we determined whether PTX blocked the effects of BH on the proliferative response. As previously described, PTX can either stimulate or suppress lymphocyte proliferation depending on the concentration (14). In our experiments, PTX at 1 ng ml–1 inhibited proliferation to 69 ± 15% of proliferation with OVA alone, and at 1000 ng ml–1 increased proliferation to 180 ± 68% (n = 8). But regardless of its effects on proliferation to OVA, PTX had minimal effects on brain suppression. Suppression with 1 ng ml–1 of PTX was 103 ± 16% of control, and suppression with 1000 ng ml–1 PTX was 83 ± 22% of control.

Western blot for RASD1
We attempted to demonstrate the presence of the RASD1 protein in lymph node cells using western blots. We used protein lysates from cells cultured with no antigen for 2, 6 and 24 h. We also included freshly isolated cells as a negative control. We could detect a band at the appropriate molecular weight in the heart lysate, but could not detect RASD1 in the lysates from lymph node cells at any time point (Fig. 6). Of note is the fact that there are no published studies reporting detection of native RASD1 with either of the two commercially available antibodies, and the manufacturer of the antibody does not report positive results in any tissues but heart. Although the band seen in the heart lysate is at the correct molecular weight for RASD1, the antibody binds several other proteins as well.


Figure 6
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Western blot. H is heart lysate run as a positive control. Lanes a–h are cell lysates from two different mice after 0, 2, 6 or 24 h in culture. Lanes a and b are from 0 h, c and d are from 2 h, e and f are from 6 h and g and h are from 24 h. Lanes a, c, e and g are from mouse 1 and lanes b, d, f and h are from mouse 2. The numbers denote the approximate molecular weight in kilodaltons. There is a strong band at approximately the expected molecular weight of RASD1 in the heart lysate. The lysates of the lymph node cells do not show a clear band at the proper molecular weight at any time point.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
This is the first report that Rasd1 mRNA is expressed in lymph node cells. Interestingly, Rasd1 mRNA is not expressed at baseline, but is induced by two stimuli which inhibit or suppress the lymph node cells. The first stimulus is the transition from the intact lymph node to tissue culture. When the lymph node cells are made into a single-cell suspension and put into culture, they lose the soluble trophic factors and the cell-surface contacts present in the intact lymph node. This abrupt loss of trophic signals should inactivate many cells, and Rasd1 mRNA is rapidly up-regulated at the same time. The second inhibitory stimulus is the presence of BH in the culture media. The mechanism of action of the BH is unknown, but it may be a physiologically relevant signal important for normal immune regulation. The BH blocks the proliferation of cells in culture, and it also increases and prolongs the expression of Rasd1 mRNA.

Rasd1 mRNA is probably expressed in B lymphocytes. The cells expressing Rasd1 are positive for B220 and MHC class II, and Rasd1 mRNA levels are very low in B cell-deficient mice. Thus RASD1 may play a role in intracellular regulatory pathways in B lymphocytes, and it may be a useful marker for inactivated B cells. The importance of B cells for the in vitro proliferative response was demonstrated by our depletion experiments, and the induction of Rasd1 could possibly mediate the inhibition of B cell proliferation with exposure to BH. But it cannot account for the inhibitory activity of BH on T cells since lymph node cells from the B cell-deficient mice expressed little Rasd1 but were still inhibited by BH.

We were able to demonstrate changes in the Rasd1 mRNA, but were not able to demonstrate the presence of the RASD1 protein. This may be because the protein is expressed transiently or in low concentrations, the protein turns over rapidly, or the protein is not expressed at all. Also, the protein activity is isoprenylation dependent (10, 15), so it is possible that the active protein is not solubilized by the western lysis buffer. It may also be due to deficiencies in the antibody. The commercially available antibody is obtained from goats immunized with a 13mer peptide. On western blot, this antibody does detect a band at the appropriate molecular weight in heart lysate, but the identification of this band as RASD1 is presumptive. And as expected for an antibody against a peptide, it also binds a number of other proteins. There are currently no published reports of the native RASD1 protein being detected with this or any other antibody.

The function of RASD1 in leukocytes is unknown, but a regulatory or inhibitory role would be consistent with what is known about its effects in other cell types. Transfection of Rasd1 inhibits the growth and survival of several cultured cell lines, including a fibroblast cell line and several different tumor cell lines (7). The fact that Rasd1 is up-regulated by corticosteroids in corticotroph cells of the pituitary suggests that it might be part of the negative feedback loop regulating ACTH secretion by these cells (3). The mouse protein inhibits cAMP-stimulated secretion in corticotroph cells and blocks signal transduction from the formyl peptide receptor (10, 11). The human protein was originally described as an activator of G protein signaling, but it blocks potassium channel activation via the G protein-coupled M2 muscarinic acetylcholine receptor (12). RASD1 also blocks different types of signal transduction through the dopamine D2L receptor in cultured HEK293 cells (13). The RASD1 protein probably has a number of different functions in different cell types. In addition to corticotroph cells, Rasd1 mRNA has been found in numerous tissues and has been reported to be a critical regulator of the circadian clock (3, 5, 16, 17). Expression levels are reported to be affected by several different stimuli, including desiccation stress, neonatal alcohol exposure and brain death (1820).

Overall, the available data suggest that RASD1 plays a role in regulatory or inhibitory pathways, but its actual function in lymph node cells remains to be determined. It could cause apoptosis or growth arrest as it does in cultured cell lines (7). It could also cause cells to become anergic, down-regulate effector mechanisms such as cytokine secretion or activate a self-tolerance pathway.

At present, we can say that Rasd1 mRNA is expressed by B cells in response to inhibitory stimuli in culture. Expression of the Rasd1 mRNA may be a useful marker for inactive or inhibited cells, and the RASD1 protein may play an important role in regulating the activity of B cells.


    Acknowledgements
 
This work was supported in part by the Clayton Foundation for Research. We thank Richard Dorin for helpful advice and Peter Davies, Nancy Shipley and Greg Shipley of the Quantitative Genomics Core Laboratory at University of Texas Health Science Center at Houston for their assistance.


    Abbreviations
 
ACTH, adrenocorticotropic hormone
BH, brain homogenate
c.p.m., counts per minute
Dex, dexamethasone
dNTP, diethylnitrophyenyl thiophosphate
OVA, ovalbumin
PTX, pertussis toxin
RASD1, dexamethasone-induced Ras-related protein 1
RT, reverse transcription
QPCR, quantitative polymerase chain reaction

    Notes
 
Transmitting editor: L. Steinman

Received 6 December 2005, accepted 5 February 2007.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Lindsey JW. An alkali-soluble factor present in normal brain tissue inhibits antigen-specific lymphocyte proliferation. J. Neuroimmunol. (2000) 103:76.[CrossRef][Web of Science][Medline]
  2. McCormick F. Ras-related proteins in signal transduction and growth control. Mol. Reprod. Dev. (1995) 42:500.[CrossRef][Web of Science][Medline]
  3. Kemppainen RJ, Behrend EN. Dexamethasone rapidly induces a novel ras superfamily member-related gene in AtT-20 cells. J. Biol. Chem. (1998) 273:3129.[Abstract/Free Full Text]
  4. Cismowski MJ, Takesono A, Ma C, et al. Genetic screens in yeast to identify mammalian nonreceptor modulators of G-protein signaling. Nat. Biotechnol. (1999) 17:878.[CrossRef][Web of Science][Medline]
  5. Tu Y, Wu C. Cloning, expression and characterization of a novel human Ras-related protein that is regulated by glucocorticoid hormone. Biochim. Biophys. Acta (1999) 1489:452.[Medline]
  6. Fang M, Jaffrey SR, Sawa A, Ye K, Luo X, Snyder SH. Dexras1: a G protein specifically coupled to neuronal nitric oxide synthase via CAPON. Neuron (2000) 28:183.[CrossRef][Web of Science][Medline]
  7. Vaidyanathan G, Cismowski MJ, Wang G, Vincent TS, Brown KD, Lanier SM. The Ras-related protein AGS1/RASD1 suppresses cell growth. Oncogene (2004) 23:5858.[CrossRef][Web of Science][Medline]
  8. Blumer JB, Cismowski MJ, Sato M, Lanier SM. AGS proteins: receptor-independent activators of G-protein signaling. Trends Pharmacol. Sci. (2005) 26:470.[Medline]
  9. Brogan MD, Gehrend EN, Kemppainen RJ. Regulation of Dexras1 expression by endogenous steroids. Neuroendocrinology (2001) 74:244.[CrossRef][Web of Science][Medline]
  10. Graham TE, Key TA, Kilpatrick K, Dorin RI. Dexras1/AGS-1, a steroid hormone-induced guanosine triphosphate-binding protein, inhibits 3',5'-cyclic adenosine monophosphate-stimulated secretion in AtT-20 corticotroph cells. Endocrinology (2001) 142:2631.[Abstract/Free Full Text]
  11. Graham TE, Prossnitz ER, Dorin RI. Dexras1/AGS-1 inhibits signal transduction from the Gi-coupled formyl peptide receptor to Erk-1/2 MAP kinases. J. Biol. Chem. (2002) 277:10876.[Abstract/Free Full Text]
  12. Takesono A, Nowak MW, Cismowski M, Duzic E, Lanier SM. Activator of G-protein signaling 1 blocks GIRK channel activation by a G-protein-coupled receptor: apparent disruption of receptor signaling complexes. J. Biol. Chem. (2002) 277:13827.[Abstract/Free Full Text]
  13. Nguyen CH, Watts VJ. Dexras1 blocks receptor-mediated heterologous sensitization of adenylyl cyclase 1. Biochem. Biophys. Res. Commun. (2005) 332:913.[CrossRef][Web of Science][Medline]
  14. Robbinson D, Cockle S, Singh B, Strejan GH. Native, but not genetically inactivated, pertussis toxin protects mice against experimental allergic encephalomyelitis. Cell. Immunol. (1996) 168:165.[CrossRef][Web of Science][Medline]
  15. Nguyen CH, Watts VJ. Dexamethasone-induced Ras protein 1 negatively regulates protein kinase C {delta}: implications for adenylyl cyclase 2 signaling. Mol. Pharmacol. (2006) 69:1763.[Abstract/Free Full Text]
  16. Takahashi H, Umeda N, Tsutsumi Y, et al. Mouse dexamethasone-induced RAS protein 1 gene is expressed in a circadian rhythmic manner in the suprachiasmatic nucleus. Brain Res. Mol. Brain Res. (2003) 110:1.[Medline]
  17. Cheng HY, Obrietan K, Cain SW, et al. Dexras1 potentiates photic and suppresses nonphotic responses of the circadian clock. Neuron (2004) 43:715.[CrossRef][Web of Science][Medline]
  18. Huang Z, Tunnacliffe A. Gene induction by desiccation stress in human cell cultures. FEBS Lett. (2005) 579:4973.[CrossRef][Web of Science][Medline]
  19. Kusaka M, Yamada K, Kuroyanagi Y, et al. Gene expression profile in rat renal isografts from brain dead donors. Transplant. Proc. (2005) 37:364.[CrossRef][Web of Science][Medline]
  20. Hard ML, Abdolell M, Robinson BH, Koren G. Gene-expression analysis after alcohol exposure in the developing mouse. J. Lab. Clin. Med. (2005) 145:47.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
M. Nojima, R. Maruyama, H. Yasui, H. Suzuki, Y. Maruyama, I. Tarasawa, Y. Sasaki, H. Asaoku, H. Sakai, T. Hayashi, et al.
Genomic Screening for Genes Silenced by DNA Methylation Revealed an Association between RASD1 Inactivation and Dexamethasone Resistance in Multiple Myeloma
Clin. Cancer Res., July 1, 2009; 15(13): 4356 - 4364.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/5/583    most recent
dxm023v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lindsey, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lindsey, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?