Skip Navigation


International Immunology Advance Access originally published online on February 7, 2007
International Immunology 2007 19(3):287-296; doi:10.1093/intimm/dxl145
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/3/287    most recent
dxl145v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Butts, C. L.
Right arrow Articles by Sternberg, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Butts, C. L.
Right arrow Articles by Sternberg, E. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?



Progesterone inhibits mature rat dendritic cells in a receptor-mediated fashion

Cherie L. Butts1, Shetha A. Shukair1, Kristina M. Duncan1, Eve Bowers1,2, Cash Horn1, Elena Belyavskaya1, Leonardo Tonelli3 and Esther M. Sternberg1

1 Section on Neuroendocrine Immunology and Behavior, National Institute of Mental Health/National Institutes of Health, 5625 Fishers Lane, Bethesda, MD 20892, USA
2 Howard Hughes Medical Institutions, Bethesda, MD, USA
3 Department of Psychiatry, University of Maryland School of Medicine, Baltimore, MD, USA

Correspondence to: E. M. Sternberg; E-mail: sternbee{at}mail.nih.gov


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
A variety of extraimmune system factors, including hormones, play a critical role in regulating immunity. Progesterone has been shown to affect immunity in rodents and humans, mainly at concentrations commensurate with pregnancy. These effects are primarily mediated via the progesterone receptor (PR), which acts as a transcription factor, although non-genomic effects of PR activation have been reported. In this study, we evaluated the effects of progesterone on rat dendritic cells (DCs) at ranges encompassing physiologic and pharmacologic concentrations to determine whether progesterone plays a role in modulating DC-mediated immune responses. DCs were derived by culturing rat bone marrow cells in granulocyte macrophage colony-stimulating factor and IL-4. Cells were analyzed for expression of PR using FACS analysis, real-time reverse transcriptase–PCR and fluorescent microscopy. Progesterone treatment of LPS-activated, mature bone marrow-derived dendritic cells (BMDCs) suppressed production of the pro-inflammatory response-promoting cytokines tumor necrosis factor-{alpha} and IL-1ß in a dose-dependent manner but did not affect production of the pro-inflammatory response-inhibiting cytokine IL-10. Treatment of cells with progesterone also resulted in down-regulation of co-stimulatory molecule CD80 and MHC class II molecule RT1B expression. In addition, progesterone inhibited DC-stimulated proliferation of T cells. Suppression of pro-inflammatory response-promoting cytokine production by progesterone was prevented using the PR antagonist RU486. There was no dose-dependent effect of progesterone treatment on immature DC capacity to take up antigenic peptide. These data indicate that progesterone directly inhibits mature rat BMDC capacity to drive pro-inflammatory responses. This mechanism could contribute to or account for some of the differential expression of autoimmune/inflammatory disease in females.

Keywords: antigen presenting/processing, dendritic cells, progesterone


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Dendritic cells (DCs) are antigen-presenting cells critical for mounting a potent immune response (1). They are able to take up antigen as immature DCs, and upon stimulation with maturation agents, these cells secrete large amounts of cytokines to stimulate naive lymphocytes and promote pro-inflammatory (2), anti-inflammatory (3, 4) or tolerogenic (5, 6) responses. In addition to production of cytokines, mature DCs express high levels of MHC molecules and co-stimulatory molecules (CD80, CD86) on their surface to provide the first and second signals, respectively, that stimulate naive T cells (7). DCs are also important because of their capacity to influence the type of response elicited by Th cells in the presence of appropriate cytokines (8, 9, 10) or chemokines (11) in the microenvironment. They are thought to be crucial in amelioration of a number of disease states (1214), initiate strong immune responses against pathogens (11, 15) and are being used for development of vaccines (16, 17, 18). Furthermore, these cells have recently been shown to be important in the development of autoimmune diseases (19), which have a 2- to 10-fold higher incidence in females compared with males (20).

Progesterone is produced by the granulosa cells and corpus luteum of the ovary and is important for ovulation (21), uterine cell activation (22) and mammalian gland development (23) in addition to its essential role in establishment and maintenance of pregnancy (24). A number of studies have demonstrated that progesterone has immune suppressive properties (25). It is thought to contribute to susceptibility to HIV in women (26) and has been shown to increase the susceptibility to Chlamydia infection in rats (27). Progesterone has been shown to have direct effects on T lymphocytes at concentrations consistent with pregnancy, suggesting that it may play a role in preventing maternal immune responses against fetal antigens (28). It was also shown to increase the number of Langerhans cells in the human vaginal epithelium (29), although the exact functional nature of these cells was not investigated. A recent study of a subset of DCs, CD83+ DCs, derived from human decidua of pregnant women, showed an increase in CD83 and HLA-DR expression of these cells when treated with progesterone at levels similar to early pregnancy (30). Although the functional capacity of these cells was not analyzed in this study, this would suggest a role for progesterone in influencing maturation of these cells. Another recent study investigating the effects of progesterone on mouse DCs showed direct effects on maturation at concentrations commensurate with pregnancy (31).

While it is important to understand the role that progesterone might play on immunity during pregnancy, it is also necessary to understand the role that this hormone plays at levels associated with non-pregnant states to determine its effects on immune cells that might increase female susceptibility to autoimmune disease. This would seem evident as progesterone is a major hormone in women and the majority of autoimmune diseases disproportionately affect females (20), suggesting a role for sex hormones in such diseases. There are currently no thorough studies of the effects of progesterone on rat bone marrow-derived dendritic cells (BMDCs). The purpose of this study was to define the effects of progesterone on the function of cultured BMDCs and to determine whether these effects were mediated via the progesterone receptor (PR). Here, we show that progesterone has a profound effect on mature DCs by modulating the ability of these cells to function as stimulators of pro-inflammatory responses at concentrations similar to that seen during the menstrual cycle as well as during pregnancy.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Animals
Female Fischer (F344/NHsd) rats (8- to 11-weeks old) were obtained from Harlan Sprague Dawley (Indianapolis, IN, USA). Animals were maintained in pathogen-free facilities, and all procedures were performed on approved protocols in accordance with the National Institute of Mental Health (NIMH) Animal Care and Use Committee.

Reagents
Recombinant granulocyte macrophage colony-stimulating factor (rGM-CSF) and recombinant IL-4 (rIL-4) were obtained from PeproTech (Rocky Hill, NJ, USA). FITC–dextran, propidium iodide, LPS from Escherichia coli and RU486 (mifepristone) were purchased from Sigma (St Louis, MO, USA).

Antibodies
Antibodies that recognize and bind to amino acid residues 346–367 of the rat glucocorticoid receptor (GR) (100 µg ml–1, diluted 1:5000) and amino acid residues 533–547 of the rat PR (100 µg ml–1, diluted 1:5000) were purchased from Affinity Bioreagents (Golden, CO, USA). Antibodies to rat CD4 (clone OX35) (0.1 mg ml–1), CD80 (clone 3H5) (0.1 mg ml–1) and MHC class II RT1B (clone OX6) (0.1 mg ml–1) were purchased from BD Biosciences (San Diego, CA, USA). Antibodies to rat CD11c (0.2 mg ml–1) were obtained from eBioscience (San Diego, CA, USA). Isotype control antibodies included the following: purified mouse IgG (PR control) (0.1 mg ml–1, diluted 1:5000) (BD Biosciences); purified rabbit IgG (GR control) (1 mg ml–1, diluted 1:50 000) (R&D Systems, Minneapolis, MN, USA); mouse IgG1 (CD4, CD80 and RT1B control) (0.1 mg ml–1) (BD Biosciences) and Armenian hamster IgG (CD11c control) (0.2 mg ml–1) (eBioscience).

Isolation of bone marrow cells
Animals were sacrificed by decapitation to obtain femurs and tibias, which were collected in RPMI 1640 (Mediatech, Herndon, VA, USA) containing 10% charcoal-stripped serum (CSS) (Biomeda, Foster City, CA, USA) and 2% L-glutamine and 2% penicillin–streptomycin (both from Sigma) (henceforth referred to as conditioned medium). CSS was used as a replacement for fetal bovine serum as some components of serum have been shown to demonstrate hormone-mimicking properties. Muscle and connective tissues were removed from the bone, and bone marrow cells were flushed out with PBS (pH 7.4). Bone marrow cells were passed through a 70-µm cell strainer (Becton-Dickinson, San Diego, CA, USA) to remove debris. RBCs were lysed with ACK lysis buffer (BioWhittaker, Walkersville, MD, USA) containing ammonium hydroxide.

Generation of BMDCs
BMDCs were generated as previously described (32) with slight modifications. Briefly, bone marrow cells (10 x 106) were plated in six-well plates with conditioned medium supplemented with rGM-CSF (20 ng ml–1) and rIL-4 (50 ng ml–1) (both from PeproTech) at a total volume of 3 ml. On day 2, the medium containing non-adherent cells was removed, and adherent cells were washed with PBS. Fresh conditioned medium with rGM-CSF and rIL-4 was added to each well. Cultures were fed with cytokines in conditioned medium (100 µl total additional volume) again on day 4. By day 5, semi-adherent aggregates of cells had formed. Noted culturing conditions were used for all subsequent experiments.

RNA isolation and real-time reverse transcriptase–PCR
Total RNA from cultured DCs treated with LPS (for maturation) and hormones for 24 h was isolated using Trizol reagent (Invitrogen Life Technologies, Eugene, OR, USA), and further purified through 2-propanol and graded ethanols. RNA was quantified using the NanoDrop Spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). cDNA was generated using 200 ng of total RNA per sample in a reverse transcriptase (RT) reaction using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). The RT product was amplified using iQ SYBR Green Supermix (Bio-Rad) with the iQ5 Real-Time PCR Detection System (Bio-Rad). Primer sequences used were the following—18S (Fwd: CCAGTAAGTGCGGGTCATAAGC, Rev: CCATCCAATCGGTAGTAGCGAC); PR (Fwd: CTTTGTTTCCTCTGCAAAAATTG, Rev: GTATACACGTAAGGCTTTCAGAAGG); GR (Fwd: TGATGGGAATGACTTGGGC, Rev: TTGGGAAACTCCTTCTCTGTCGGG) and tumor necrosis factor-{alpha} (TNF-{alpha}) (Fwd: TCTTCTGTCTACTGAACTTCGGGG, Rev: ATGGAACTGATGAGAGGGAGCC). The expression of the target gene was normalized with respect to 18S, which served as a control gene. Relative fold induction was determined using the 2-{Delta}{Delta}Ct method.

Analysis of hormone receptor expression
Immature cultured DCs (1 x 106 per tube) were collected in polystyrene Falcon tubes (BD Biosciences) and washed with FACS buffer containing PBS (Molecular Biologicals, Inc., Columbia, MD, USA), 2% CSS (Biomeda) and 0.2% sodium azide (Sigma). Cells were centrifuged for 5 min at 2000 r.p.m. Supernatant was removed from the tubes followed by re-suspension of cells and incubation with 10 µl FITC-labeled anti-rat CD11c (eBioscience) and 10 µl PerCP-labeled anti-rat MHC class II RT1B (BD PharMingen, San Diego, CA, USA). Tubes were placed on ice for 30 min to ensure sufficient time for antibody to bind to cells. Cells were washed with FACS buffer to remove excess antibody and centrifuged for 5 min at 2000 r.p.m. Cells were then treated with Cytofix/Cytoperm solution (BD Biosciences) for 20 min to permeabilize cells and washed with Cytofix/Cytoperm wash buffer to remove excess solution. Cells were incubated with 10 µl horse serum for 10 min. Incubation of permeabilized cells with horse serum is a commonly used method for preventing non-specific binding of antibodies to intracellular protein (33). Ten microliters of purified antibodies to rat PR or GR (both from Affinity Bioreagents) was added for 10 min; separate tubes were incubated with 10 µl purified irrelevant antibodies to mouse IgG and rabbit IgG as isotype controls for PR and GR, respectively. A secondary antibody conjugated to PE was then added for an additional 10 min to each tube. All incubations were done on ice (4°C). Experiments included analysis of only one steroid hormone receptor expressed by cultured cells. Cells were collected using a BD FACSCalibur (BD Biosciences) and analyzed with FlowJo analysis software (Tree Star, Ashland, OR, USA).

Hormone treatment and stimulation of bone marrow cultures
On day 6, cells were treated with varying doses of progesterone or dexamethasone dissolved in 100% ethanol (both from Sigma). Following a 2-h treatment with hormones (to allow sufficient time for hormones to initiate effects on cells prior to maturation), LPS from E. coli (5 µg ml–1) was subsequently added to cells. This dose of LPS was determined from previous dose–response experiments in the laboratory (34) and to ensure that a sufficient amount of maturation agent was available for stimulation of immature cells. Cells not treated with LPS (remaining in immature state) were used as a control for maturation. Cells treated with ethanol alone served as a control experiment for treatment of LPS-matured cells with steroid hormones. Some cultures also received the PR and GR antagonist RU486 (10-8 M) to determine the role of the progesterone or dexamethasone receptor on the effects of progesterone and dexamethasone on cultured cells. Cultures remained incubated up to 48 h at 37°C/5% CO2 to determine hormonal effects on mature DC function.

Antigen uptake
Immature cells (2.5 x 105 per well, four wells per condition) were cultured (as described in Generation of BMDCs) in temperature-sensitive, 96-well RepCell® plates (CellSeed, Tokyo, Japan) following treatment with varying doses of progesterone associated with menstrual cycle and pregnancy concentrations and 100 ng ml–1 FITC–dextran (Sigma) for 2 h at 37°C/5% CO2. Treatment of cells without progesterone or with ethanol alone served as a control experiment for effects of progesterone treatment. Cells were then placed at 4°C for 30 min to allow detachment from temperature-sensitive plates. Cells (1 x 106 per tube) were collected in polystyrene Falcon tubes (BD Biosciences), washed with FACS buffer, collected with a BD FACSCalibur (BD Biosciences) and analyzed using FlowJo software (Tree Star).

Cytokine analysis
After treatment with hormones and LPS (5 µg ml–1) for 48 h (as described in Hormone Treatment and Stimulation of Bone Marrow Cultures), supernatants (140 µl total volume per condition) were collected from cultured cells. TNF-{alpha}, IL-1ß and IL-10 secretion were determined using the Searchlight multiplex array analysis service provided by Pierce Biotechnology, Inc. (Woburn, MA, USA). Timecourse studies (data not shown) showed little production of cytokines by LPS-matured cells after 6 h, moderate levels of cytokine production at 24 h and maximal production at 48 h. Levels of cytokines began to decrease at 72 h after LPS stimulation. This was similar to results reported in a previous study (34). Therefore, 48 h was used for cytokine production experiments and to compare cellular function under the various conditions.

Surface marker expression analysis of cultured BMDCs
Cultured cells (1 x 106 per tube) treated with progesterone or dexamethasone were collected in polystyrene Falcon tubes (BD Biosciences) and prepared for FACS analysis as previously described (see Analysis of Hormone Receptor Expression). Collected cells were pelleted followed by incubation with 10 µl FITC-labeled anti-rat CD11c (eBioscience) or Armenian hamster IgG (isotype control), PE-labeled anti-rat CD80 or mouse IgG (isotype control), PE-labeled anti-rat MHC class II RT1B or mouse IgG (isotype control) and PerCP-labeled anti-rat MHC class II RT1B or mouse IgG (isotype control). All antibodies except CD11c were from BD PharMingen. Cells were collected with a BD FACSCalibur (BD Biosciences) and analyzed using FlowJo software (Tree Star).

DC capacity to stimulate naive T lymphocytes
Capacity of LPS-matured, cultured BMDCs treated with progesterone to stimulate T cell proliferation was assessed by mixed leukocyte reaction using T cells from spleens of allogeneic, female Fischer rats housed in the same cage. Lymphocytes were enriched from rat splenocytes using a magnetic pan T cell (OX52) antibody and CD4+ cell-specific antibody (both from Miltenyi Biotec, Auburn, CA, USA) according to the manufacturer’s instructions. Briefly, cells were incubated with pan T cell antibodies at 4°C for 20 min and passed through the pre-moistened magnetic column using the QuadroMACS magnetic cell separation system for positive selection of the OX52+ T cells. Positively selected cells were then incubated with CD4 antibodies at 4°C for 20 min and placed in a separate pre-moistened magnetic column using the QuadroMACS system to isolate OX52+CD4+ T cells by positive selection. Preparations were consistently 90–95% CD4+ as assessed by flow cytometry. Allogeneic T cells were labeled with a 10-µM solution of 5,6-carboxyfluorescein diacetate succinimidyl ester (CFSE) in PBS (250 µl total) and incubated at 37°C/5% CO2 for 10 min. Cells were washed and centrifuged to remove excess CFSE. LPS-matured, cultured BMDCs were incubated for 24 h with CFSE-labeled T cells (1:10 DC to T cell) at 37°C/5% CO2 for 96 h. Mixed leukocyte reaction was performed with responders and stimulators in the presence of progesterone at different concentrations. T cells not incubated with DCs served as a control. Naive T lymphocyte proliferation was assessed after 96 h incubation with stimulator cells. Cells were collected with a BD FACSCalibur (BD Biosciences) and analyzed using FlowJo software (Tree Star).

Statistical analysis
For all statistical analysis, the level of significance was set at a probability of not >0.05 to be considered significant. Data are presented as mean values ± standard deviations. Data analysis was done using Student’s t-test. IC50 was determined using a growth formula that predicts exponential growth using existing data.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cultured DCs express steroid hormone receptors
In order to know whether progesterone could act directly on cultured DCs, it was important to determine the expression of PR in cultured cells. Immature CD11c+ BMDCs were examined for the expression of the PR as well as the GR, a steroid hormone receptor well known for its immunosuppressive effects on immune cells, using FACS analysis and fluorescent microscopy (Fig. 1). PR was found to be expressed in ~60% of cultured bone marrow DCs. Proportions of cells expressing these hormone receptors were similar to that of freshly isolated DCs from bone marrow and spleens (data not shown). Cultured cells were then treated with progesterone or dexamethasone (glucocorticoid) to identify any differences in expression of the hormone receptors at the transcriptional level with receptor activation. While GR expression increased significantly (P < 0.05) in response to LPS, PR expression did not (Fig. 2A and C). In contrast, PR expression increased significantly, ~25-fold over control levels, at the highest concentrations of progesterone tested with or without LPS treatment (Fig. 2A and B), while GR expression was not as dramatically affected by treatment with progesterone or dexamethasone (Fig. 2C and D). A timecourse experiment (6, 24, 48 and 72 h) using the various conditions showed that 24 h post-treatment provided the maximum response for the genes analyzed.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. Expression of PR (A) or GR (B) in immature, cultured BMDCs using flow cytometry. Analysis included expression of only one steroid hormone receptor on cultured cells for each experiment. Thick, blue line with no shaded area represents isotype control antibody, and thin, blue line with light blue shaded areas represents steroid hormone receptor antibody expression on CD11c BMDCs. All cells analyzed showed expression of steroid hormone receptors (n = 8) (C). Fluorescent micrographs of cells cultured in chamber slides and visualized using a convoluted microscope show PR (green) and nucleus (red) in immature BMDCs (D). Cells had not been treated with progesterone and therefore would not have translocated to the nucleus to initiate transcription of target genes.

 

Figure 2
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. mRNA expression of PR (A and B) and GR (B and D) in LPS-matured, cultured BMDCs treated with progesterone dissolved in 100% ethanol (A and C) or dexamethasone dissolved in 100% ethanol (B and D) (n = 4). Cells not treated with LPS served as controls for this experiment. Cells treated with ethanol alone (data not shown) demonstrated similar results to cells not treated with LPS. Statistical significance was determined using the Student’s t-test. *P < 0.05.

 
Antigen uptake ability by immature DCs is not significantly affected by progesterone
One of the major functions of DCs is the capacity to take up antigenic material when these cells are in an immature state. Immature cells scavenge the environment for antigenic particulates that can be taken up using their Fc receptors and, once the antigen is engulfed, these cells have the capacity to process antigen for presentation to naive lymphocytes following stimulation with maturation agents. In order to determine the effects of progesterone on antigen uptake by immature BMDCs, cells were cultured in the presence of progesterone or dexamethasone with FITC–dextran, which served as an antigen, to assess the effects of these steroid hormones on the functionality of immature BMDCs. Antigen uptake was assessed using flow cytometry (Table 1). Similar numbers of cultured DCs were able to take up FITC–dextran in the absence of progesterone or in concentrations ranging from that seen during the follicular and luteal phases of the menstrual cycle (10–10 and 10–9 M), with the highest numbers of cells taking up antigen at pregnancy levels (10–7 M). Statistically significant effects of progesterone on the number of immature DC taking up antigenic material were identified only at the pregnancy-associated concentrations of the hormone. Treatment of immature, cultured BMDCs with dexamethasone resulted in an increase in the proportions of cells taking up antigenic peptide. In addition, there was a significant decrease in viability of cells treated with dexamethasone at the 10–7 M concentration, which might account for the similar proportions of cells taking up antigen at the 10–8 M concentration.


View this table:
[in this window]
[in a new window]

 
Table 1. Effects of progesterone and dexamethasone treatment on uptake of antigen (FITC–dextran) by immature cultured rat BMDCs

 
Progesterone suppresses pro-inflammatory response-promoting cytokine production in cultured BMDCs
In order to examine the effects of progesterone on mature BMDCs, we first determined the ability of these cells to produce cytokines. For these experiments, secreted levels of cytokines that promote or inhibit pro-inflammatory responses were measured in the presence of progesterone or dexamethasone. The bacterial cell wall LPS from E. coli was used as an activating agent for the BMDCs. Maximal cytokine production was observed between 24 and 48 h, and cytokine levels began to drop at 72 h (data not shown). Therefore, 48-h timepoints were used for analysis of cytokine production by cultured cells. As shown in Fig. 3(A), progesterone in a dose-dependent manner (IC50 = 1.3 x 10–8) suppressed the ability of cultured, mature BMDCs to produce TNF-{alpha}, a cytokine that is important in inducing pro-inflammatory immune responses. TNF-{alpha} is a known target gene for PR; therefore, we also examined another pro-inflammatory response-promoting cytokine to see if progesterone would have effects on secretion of other cytokines. Figure 3(C) shows that progesterone also suppressed secretion of the pro-inflammatory response-promoting cytokine IL-1ß (IC50 = 1.5 x 10–9). The immunosuppressive hormone dexamethasone also suppressed TNF-{alpha} in a dose-dependent manner (IC50 = 6.8 x 10–10), as expected (Fig. 3B). Dexamethasone suppression of TNF-{alpha} production was more potent compared with progesterone, both in terms of maximal suppression and IC50 dose, although progesterone did not fully suppress TNF-{alpha} production at any dose examined. In order to determine if this effect was mediated through the steroid hormone receptors, cells were also treated with the PR and GR antagonist RU486. RU486 completely prevented progesterone suppression of TNF-{alpha} and IL-1ß secretion, indicating that this inhibition is most likely mediated through PR. RU486 added to cultures treated with dexamethasone did not completely reverse dexamethasone-mediated cytokine suppression, suggesting that higher concentrations of RU486 might be needed for this effect. In order to determine whether differences in expression of TNF-{alpha} resulted from changes at the transcriptional level, we used real-time RT–PCR to measure changes in expression of TNF-{alpha} at the level of transcription in response to progesterone (Fig. 3D). Progesterone was able to decrease expression of TNF-{alpha} mRNA in a dose-dependent manner. We also examined the ability of progesterone to affect BMDC production of IL-10, a cytokine believed to inhibit pro-inflammatory responses (35). As shown in Fig. 4(A), progesterone did not show a dose-dependent effect on secretion of IL-10 by these cells. Dexamethasone treatment of cultured BMDCs did induce a dose-dependent increase in IL-10 production (Fig. 4B), which is consistent with the known anti-inflammatory effects of this glucocorticoid hormone. These results indicate that progesterone is able to directly inhibit production of pro-inflammatory response-promoting cytokines (TNF-{alpha} and IL-1ß) without affecting production of pro-inflammatory response-inhibiting cytokines (IL-10) by these cells.


Figure 3
View larger version (32K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. LPS-induced production of pro-inflammatory response-promoting cytokines TNF-{alpha} and IL-1ß by cultured rat BMDCs treated with progesterone or dexamethasone. BMDCs matured using LPS from Escherichia coli (5 µg ml–1) and treated with progesterone showed a dose-dependent effect on secretion of TNF-{alpha} (A) and IL-1ß (C) at 48 h after treatment. Similar dose-dependent effects on TNF-{alpha} secretion were also shown upon treatment of BMDCs with dexamethasone (B). Cells not treated with LPS or only treated with hormones or RU486 served as a control. Cells treated with ethanol alone (data not shown) demonstrated similar results as cells not treated with LPS. Real-time PCR showed that this dose-dependent effect on BMDCs by progesterone was also at the level of transcription (D). Data are presented as mean values ± standard deviations. Data analysis was done using Student’s t-test. *P < 0.05.

 

Figure 4
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. Production of the pro-inflammatory response-inhibiting cytokine IL-10 by cultured, mature rat BMDCs after 48 h treatment with LPS. BMDCs matured using LPS from Escherichia coli(5 µg ml–1) and treated with progesterone (A) do not show dose-dependent effects on IL-10 secretion. Treatment with dexamethasone (B) shows an expected dose-dependent increase on IL-10 production by these cells. Data are presented as mean values ± standard deviations. Data analysis was done using Student’s t-test. *P < 0.05.

 
Progesterone down-regulates BMDC expression of cell-surface markers that stimulate naive lymphocytes
We next investigated the effects of progesterone on the ability of mature, LPS-activated BMDCs to express cell-surface markers that are important for stimulation of naive lymphocytes. MHC class II molecules and co-stimulatory molecules are up-regulated during maturation of DCs and are important to provide the first and second signals, respectively, to stimulate naive lymphocytes. Therefore, we measured expression of the MHC class II molecule RT1B, one of the most common MHC class II molecules expressed by immature and mature rat DCs (32), and the co-stimulatory molecule CD80 on mature BMDCs with progesterone treatment after 48 h stimulation, as this was the same timepoint used for measurement of cytokine production. As shown in Fig. 5, LPS treatment of cultured BMDCs up-regulated expression of CD80 and RT1B. Addition of progesterone resulted in a dose-dependent down-regulation of expression of CD80 in cultured BMDCs at all concentrations of the steroid hormone assessed (Fig. 5A), including levels commensurate with physiological (luteal phase) levels of the hormone (10–9 M). As expected, treatment of BMDCs with dexamethasone also down-regulated CD80 in a dose-dependent manner (Fig. 5C). Progesterone suppressed expression of RT1B, but only at the highest dose of progesterone examined (10–7 M) (Fig. 5B). This concentration is consistent with the levels of progesterone seen during pregnancy. In contrast, dexamethasone suppressed the expression of RT1B at all levels examined (Fig. 5D).


Figure 5
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5. Expression of cell-surface markers by BMDCs matured using LPS from Escherichia coli(5 µg ml–1). Cell-surface expression of CD80 (A and C) and MHC class II molecule RTIB (B and D) in cultured rat BMDCs stimulated with LPS and treated with progesterone (A and B) and dexamethasone (C and D) demonstrates dose-dependent effects at 48 h after treatment. Cells not treated with LPS or hormones served as a control. Cells treated with ethanol alone (data not shown) demonstrated similar results as cells not treated with LPS. Data are presented as mean values ± standard deviations. Data analysis was done using Student’s t-test. *P < 0.05.

 
Progesterone prevents BMDC activation of T cells
One of the hallmarks of mature DC function is their capacity to stimulate naive T lymphocytes and induce proliferation of these cells. In order to determine whether the effects of progesterone on cultured, LPS-activated BMDCs would affect the ability of these cells to stimulate T cells, we co-cultured BMDCs with CD4+ allogeneic T cells in the presence of LPS and concentrations of progesterone seen during the luteal phase of the menstrual cycle and during pregnancy. As shown in Fig. 6, CD4+ allogeneic T cells cultured in the presence of LPS-activated, mature BMDCs showed an increase in proliferation of naive T lymphocytes. Addition of progesterone at increasing concentrations (10-9 and 10-7 M) resulted in a dose-dependent decrease in T cell proliferation, indicating that progesterone is able to inhibit the ability of mature BMDCs to stimulate naive T lymphocyte activation.


Figure 6
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6. LPS-matured, cultured BMDC ability to stimulate T cell proliferation. BMDCs matured using LPS from Escherichia coli(5 µg ml–1) and treated with progesterone were incubated with CFSE-labeled CD4+ allogeneic T cells from female rats. Progesterone was washed from cultures prior to addition of T cells to ensure a DC-specific effect of progesterone on T cell proliferation. Results showed a dose-dependent effect on the ability to stimulate proliferation of CFSE-labeled CD4+ T cells only at the pregnancy-associated concentrations of progesterone (data are representative of four separate experiments).

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
DCs are immune cells that play an important role in mounting strong host immune responses to pathogens and serve as the interface between innate and adaptive immunity (36). Factors that control these cells can ultimately drive the direction of immune responses or prevent an immune response from being mounted. Progesterone is a steroid hormone present in pregnant and non-pregnant females in plasma concentrations ranging from 10–9 M in the non-pregnant state (luteal phase of menstrual cycle) to 10–7 M during pregnancy. While progesterone is thought to affect the severity of certain autoimmune diseases (3740), the exact mechanisms of its effects on these diseases have not been thoroughly investigated. In this study, we examined the effects of progesterone concentrations spanning those found in pregnant and non-pregnant females to ascertain its effects on cultured rat BMDC function.

Progesterone had the greatest effect on functional capacity of LPS-activated, mature BMDCs. Progesterone, even at physiological concentrations, suppressed LPS-induced secretion of the pro-inflammatory response-promoting cytokines TNF-{alpha} and IL-1ß. Progesterone also inhibited the ability of mature BMDCs to express cell-surface markers, including the co-stimulatory molecule CD80 and the MHC class II molecule RT1B, which are associated with DC activation. The dose-dependent effect of progesterone on TNF-{alpha} production is consistent with previous studies showing that TNF-{alpha} is one of the target genes of PR in macrophages (41). Dexamethasone, a known immunosuppressive agent, was more potent than progesterone in suppressing TNF-{alpha} and IL-1ß secretion. The magnitude of suppression of pro-inflammatory response-promoting cytokines by progesterone was ~100-fold less than that of dexamathasone. Furthermore, the PR and GR antagonist RU486 was able to prevent progesterone-induced inhibition of TNF-{alpha} and IL-1ß production by BMDCs and inhibited some of the suppressive effects of dexamethasone, indicating that the effects of these hormones on cultured BMDCs are mediated through their receptors. Progesterone down-regulated expression of CD80 on cultured BMDCs at all concentrations examined, but only down-regulated RT1B expression at the highest concentrations of progesterone, commensurate with pregnancy. Progesterone also decreased the capacity of cultured BMDCs to stimulate allogeneic T lymphocytes in a dose-dependent manner. These results suggest that progesterone could play a role in preventing DC promotion of pro-inflammatory responses and activation of naive lymphocytes or could drive tolerogenic responses by these cells, in both non-pregnant and pregnant states.

In contrast to the effects of progesterone on mature BMDCs, progesterone had a weaker effect on the functional capacity of immature BMDCs to take up antigen. As there was essentially no effect of progesterone on immature BMDC activity, RU486 was not added to the cultures to identify its effect on reversing progesterone modulation of immature DC activity. A significant effect was observed only at the highest concentrations of progesterone, similar to levels seen during pregnancy. This effect of progesterone at pregnancy-associated concentrations is consistent with the previously reported non-genomic effects of progesterone on endometrial stromal cells (42). The weaker effect on immature BMDC capacity may be related to the specific genes that are targeted by progesterone when it functions as a transcription factor and may not include genes that affect the capacity of these cells to take up antigen. Progesterone also had no effect on production of the pro-inflammatory response-inhibiting cytokine IL-10. Our findings are in contrast to a report by Huck et al. (43) that showed an increase in IL-10 levels in response to progesterone treatment of human PBMCs. Possible factors contributing to this discrepancy include species differences, differences in response of different cell types and the fact that responses of cells from male and female subjects were analyzed together in this study. Similarly, species differences and combining data from male and female animals could also account for the discrepancy between our findings and the increased intracellular IL-10 production in response to progesterone in DCs from mouse spleens reported by Yang et al. (44).

Taken together, our findings indicate that progesterone can inhibit pro-inflammatory immune responses by limiting the functional capacity of mature DCs in rats at concentrations of the hormone similar to pregnant and non-pregnant states. These findings suggest that progesterone should be considered as one of several factors contributing to the shift away from Th1 responses during pregnancy and also could account for some of the differences in autoimmune susceptibility in females in general. Finally, since DCs play an important role in host–pathogen responses, these data may have implications for the use of progesterone and PR agonists in inflammatory or infectious conditions.


    Acknowledgements
 
The authors would like to thank Emily Danoff, Christopher Harris and Casey Ellis for contributing to the completion of this work. This work was supported by the Intramural Research Program of the NIMH/National Institutes of Health (NIH) and by a biodefense grant from the National Institute of Allergy and Infectious Diseases/NIH Intramural Research Program.


    Abbreviations
 
BMDC, bone marrow-derived dendritic cell
CFSE, 5,6-carboxyfluorescein diacetate succinimidyl ester
CSS, charcoal-stripped serum
DC, dendritic cell
GR, glucocorticoid receptor
NIH, National Institutes of Health
NIMH, National Institute of Mental Health
PR, progesterone receptor
rGM-CSF, recombinant granulocyte macrophage colony-stimulating factor
rIL, recombinant IL
RT, reverse transcriptase
TNF-{alpha}, tumor necrosis factor-{alpha}

    Notes
 
Transmitting editor: W. Stober

Received 22 August 2006, accepted 21 December 2006.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Banchereau J and Steinman RM. (1998) Dendritic cells and the control of immunity. Nature 392:245.[CrossRef][Medline]
  2. Rimoldi M, Chieppa M, Larghi P, Vulcano M, Allavena P, Rescigno M. (2005) Monocyte-derived dendritic cells activated by bacteria or by bacteria-stimulated epithelial cells are functionally different. Blood 106:2818.[Abstract/Free Full Text]
  3. Riboldi E, Musso T, Moroni E, et al. (2005) Cutting edge: proangiogenic properties of alternatively activated dendritic cells. J. Immunol. 175:2788.[Abstract/Free Full Text]
  4. Zeyda M, Saemann MD, Stuhlmeier KM, et al. (2005) Polyunsaturated fatty acids block dendritic cell activation and function independently of NF-kappaB activation. J. Biol. Chem. 280:14293.[Abstract/Free Full Text]
  5. Zhang Z, Li S, Zhang L, et al. (2005) The characteristics of tolerogenic plasmacytoid dendritic cells stimulated with interleukin-3. Transplant. Proc. 37:7.[CrossRef][Web of Science][Medline]
  6. Jiang H, Hou L, Qiao H, et al. (2004) Administration of tolerogenic dendritic cells induced by interleukin-10 prolongs rat splenic allograft survival. Transplant. Proc. 36:3255.[CrossRef][Web of Science][Medline]
  7. Kalady MF, Onaitis MW, Emani S, Abdel-Wahab Z, Tyler DS, Pruitt SK. (2004) Sequential delivery of maturation stimuli increases human dendritic cell IL-12 production and enhances tumor antigen-specific immunogenicity. J. Surg. Res. 116:24.[CrossRef][Web of Science][Medline]
  8. Moser M and Murphy KM. (2000) Dendritic cell regulation of TH1-TH2 development. Nat. Immunol. 1:199.[CrossRef][Web of Science][Medline]
  9. Zhou LJ and Tedder TF. (1995) A distinct pattern of cytokine gene expression by human CD83+ blood dendritic cells. Blood 86:3295.[Abstract/Free Full Text]
  10. Kelsall BL, Stuber E, Neurath M, Strober W. (1996) Interleukin-12 production by dendritic cells. The role of CD40-CD40L interactions in Th1 T-cell responses. Ann. N. Y. Acad. Sci. 795:116.[Medline]
  11. Pulendran B. (2005) Variegation of the immune response with dendritic cells and pathogen recognition receptors. J. Immunol. 174:2457.[Abstract/Free Full Text]
  12. Nikolic T, Geutskens SB, van Rooijen N, Drexhage HA, Leenen PJ. (2005) Dendritic cells and macrophages are essential for the retention of lymphocytes in (peri)-insulitis of the nonobese diabetic mouse: a phagocyte depletion study. Lab. Investig. 85:487.[CrossRef][Web of Science][Medline]
  13. Healey GD, Elvin SJ, Morton M, Williamson ED. (2005) Humoral and cell-mediated adaptive immune responses are required for protection against Burkholderia pseudomallei challenge and bacterial clearance postinfection. Infect. Immun. 73:5945.[Abstract/Free Full Text]
  14. Nehete PN, Nehete BP, Manuri P, Hill L, Palmer JL, Sastry KJ. (2005) Protection by dendritic cells-based HIV synthetic peptide cocktail vaccine: preclinical studies in the SHIV-rhesus model. Vaccine 23:2154.[CrossRef][Web of Science][Medline]
  15. Kelsall BL, Biron CA, Sharma O, Kaye PM. (2002) Dendritic cells at the host-pathogen interface. Nat. Immunol. 3:699.[CrossRef][Web of Science][Medline]
  16. Kuipers H and Lambrecht BN. (2005) Modification of dendritic cell function as a tool to prevent and treat allergic asthma. Vaccine 23:4577.[CrossRef][Web of Science][Medline]
  17. Frankenberger B, Regn S, Geiger C, et al. (2005) Cell-based vaccines for renal cell carcinoma: genetically-engineered tumor cells and monocyte-derived dendritic cells. World J. Urol. 23:166.[CrossRef][Web of Science][Medline]
  18. Mizumoto N, Gao J, Matsushima H, Ogawa Y, Tanaka H, Takashima A. (2005) Discovery of novel immunostimulants by dendritic cell-based functional screening. Blood 106:3082.[Abstract/Free Full Text]
  19. Chen M, Wang YH, Wang Y, et al. (2006) Dendritic cell apoptosis in the maintenance of immune tolerance. Science 311:1160.[Abstract/Free Full Text]
  20. Butts C and Sternberg E. (2004) Different approaches to understanding autoimmune rheumatic diseases: the neuroimmunoendocrine system. Best Pract. Res. Clin. Rheumatol. 18:125.[CrossRef][Medline]
  21. Graziano V, Check JH, Dietterich C, Choe JK, Yuan W. (2005) A comparison of luteal phase support in graduated estradiol/progesterone replacement cycles using intramuscular progesterone alone versus combination with vaginal suppositories on outcome following frozen embryo transfer. Clin. Exp. Obstet. Gynecol. 32:93.[Medline]
  22. Mizutani T, Sugihara A, Honma H, Komura H, Nakamuro K, Terada N. (2005) Effect of steroid add-back therapy on the proliferative activity of uterine leiomyoma cells under gonadotropin-releasing hormone agonist therapy. Gynecol. Endocrinol. 20:80.[Web of Science][Medline]
  23. Bachelot A and Binart N. (2005) Corpus luteum development: lessons from genetic models in mice. Curr. Top. Dev. Biol. 68:49.[Web of Science][Medline]
  24. Lydon JP, DeMayo FJ, Funk CR, et al. (1995) Mice lacking progesterone receptor exhibit pleiotropic reproductive abnormalities. Genes Dev. 9:2266.[Abstract/Free Full Text]
  25. Stites DP and Siiteri PK. (1983) Steroids as immunosuppressants in pregnancy. Immunol. Rev. 75:117.[CrossRef][Web of Science][Medline]
  26. Mingjia L and Short R. (2002) How oestrogen or progesterone might change a woman's susceptibility to HIV-1 infection. Aust. N. Z. J. Obstet. Gynaecol. 42:472.[CrossRef][Web of Science][Medline]
  27. Kaushic C, Zhou F, Murdin AD, Wira CR. (2000) Effects of estradiol and progesterone on susceptibility and early immune responses to Chlamydia trachomatis infection in the female reproductive tract. Infect. Immun. 68:4207.[Abstract/Free Full Text]
  28. Miyaura H and Iwata M. (2002) Direct and indirect inhibition of Th1 development by progesterone and glucocorticoids. J. Immunol. 168:1087.[Abstract/Free Full Text]
  29. Wieser F, Hosmann J, Tschugguel W, Czerwenka K, Sedivy R, Huber JC. (2001) Progesterone increases the number of Langerhans cells in human vaginal epithelium. Fertil. Steril. 75:1234.[CrossRef][Web of Science][Medline]
  30. Ivanova E, Kyurkchiev D, Altankova I, Dimitrov J, Binakova E, Kyurkchiev S. (2005) CD83 monocyte-derived dendritic cells are present in human decidua and progesterone induces their differentiation in vitro. Am. J. Reprod. Immunol. 53:199.
  31. Liang J, Sun L, Wang Q, Hou Y. (2006) Progesterone regulates mouse dendritic cells differentiation and maturation. Int. Immunopharmacol. 6:830.[CrossRef][Web of Science][Medline]
  32. Talmor M, Mirza A, Turley S, Mellman I, Hoffman LA, Steinman RM. (1998) Generation or large numbers of immature and mature dendritic cells from rat bone marrow cultures. Eur. J. Immunol. 28:811.[CrossRef][Web of Science][Medline]
  33. Zhong H, De Marzo AM, Laughner E, et al. (1999) Overexpression of hypoxia-inducible factor 1alpha in common human cancers and their metastases. Cancer Res. 59:5830.[Abstract/Free Full Text]
  34. Lapointe R, Toso JF, Butts C, Young HA, Hwu P. (2000) Human dendritic cells require multiple activation signals for the efficient generation of tumor antigen-specific T lymphocytes. Eur. J. Immunol. 30:3291.[CrossRef][Web of Science][Medline]
  35. Banchereau J, Paczesny S, Blanco P, et al. (2003) Dendritic cells: controllers of the immune system and a new promise for immunotherapy. Ann. N. Y. Acad. Sci. 987:180.[Web of Science][Medline]
  36. Munz C, Steinman RM, Fujii S. (2005) Dendritic cell maturation by innate lymphocytes: coordinated stimulation of innate and adaptive immunity. J. Exp. Med. 202:203.[Abstract/Free Full Text]
  37. Leker RR, Karni A, Brenner T, Weidenfeld J, Abramsky O. (2000) Effects of sex hormones on experimental autoimmune myasthenia gravis. Eur. J. Neurol. 7:203.[CrossRef][Web of Science][Medline]
  38. Buggage RR, Matteson DM, Shen de F, Sun B, Tuaillon N, Chan CC. (2003) Effect of sex hormones on experimental autoimmune uveoretinitis (EAU). Immunol. Investig. 32:259.[CrossRef][Web of Science][Medline]
  39. Pelfrey CM, Moldovan IR, Cotleur AC, Zamor N, Rudick RA. (2005) Effects of sex hormones on costimulatory molecule expression in multiple sclerosis. J. Neuroimmunol. 167:190.[CrossRef][Web of Science][Medline]
  40. Cutolo M, Sulli A, Capellino S, et al. (2004) Sex hormones influence on the immune system: basic and clinical aspects in autoimmunity. Lupus 13:635.[Abstract/Free Full Text]
  41. Tibbetts TA, Conneely OM, O'Malley BW. (1999) Progesterone via its receptor antagonizes the pro-inflammatory activity of estrogen in the mouse uterus. Biol. Reprod. 60:1158.[Abstract/Free Full Text]
  42. Vallejo G, Ballare C, Baranao JL, Beato M, Saragueta P. (2005) Progestin activation of non-genomic pathways via crosstalk of PR with ER{beta} induces proliferation of endometrial stromal cells. Mol. Endocrinol. 19:3023.[Abstract/Free Full Text]
  43. Huck B, Steck T, Habersack M, Dietl J, Kammerer U. (2005) Pregnancy associated hormones modulate the cytokine production but not the phenotype of PBMC-derived human dendritic cells. Eur. J. Obstet. Gynecol. Reprod. Biol. 122:85.[CrossRef][Web of Science][Medline]
  44. Yang L, Li X, Zhao J, Hou Y. (2006) Progesterone is involved in the maturation of murine spleen CD11c-positive dendritic cells. Steroids 71:922.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
A. S. Tait, C. L. Butts, and E. M. Sternberg
The role of glucocorticoids and progestins in inflammatory, autoimmune, and infectious disease
J. Leukoc. Biol., October 1, 2008; 84(4): 924 - 931.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/3/287    most recent
dxl145v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (14)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Butts, C. L.
Right arrow Articles by Sternberg, E. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Butts, C. L.
Right arrow Articles by Sternberg, E. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?