Skip Navigation


International Immunology Advance Access originally published online on January 6, 2007
International Immunology 2007 19(2):185-192; doi:10.1093/intimm/dxl135
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/2/185    most recent
dxl135v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Konno, A.
Right arrow Articles by Candotti, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Konno, A.
Right arrow Articles by Candotti, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Japanese Society for Immunology. 2007. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

The expression of Wiskott–Aldrich syndrome protein (WASP) is dependent on WASP-interacting protein (WIP)

Akihiro Konno1,3, Martha Kirby1, Stacie A. Anderson1, Pamela L. Schwartzberg2 and Fabio Candotti1

1 Genetics and Molecular Biology Branch
2 Genetic Disease Research Branch, National Human Genome Research Institute, National Institutes of Health, 49 Convent Drive, Bethesda, MD 20892, USA
3 Present address: Yamagata Prefectural Central Hospital, Department of Pediatrics, 1800 Aoyagi, Oaza, Yamagata, Yamagata 990-2292, Japan

Correspondence to: F. Candotti; E-mail: fabio{at}nhgri.nih.gov


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The Wiskott–Aldrich syndrome protein (WASP) is a key molecule for transduction of extracellular signals that induce a variety of critical biological events involving actin cytoskeleton rearrangement. Among the cellular partners of WASP, the Wiskott–Aldrich syndrome protein-interacting protein (WIP) has been speculated to play a critical role in the pathophysiology of Wiskott–Aldrich syndrome since WASP mutation hot spots map to the WIP-binding region. The notion that WIP promotes WASP function, however, conflicts with evidence that WIP inhibits WASP-mediated actin polymerization and IL-2 production and suggests a complex regulation of WASP function by WIP. Here we show that WASP gene transfer results in high WASP expression only when WIP is concomitantly expressed in K562 cells. Furthermore, WIP-knockdown experiments demonstrated that T cells with reduced WIP expression show a concordant reduction of WASP levels. Mapping studies using WIP mutants showed that the minimal WIP region able to rescue WASP expression in WIP-knockdown cells was the WASP-binding domain. However, expression of such a minimal domain of WIP failed to rescue WASP-dependent, nuclear factor of activated T-cells-mediated IL-2 transcriptional activity. These results demonstrate that expression of WIP is necessary for functional WASP expression in human cells and provide a new paradigm for understanding the function of these two molecules.

Keywords: post-translational regulation, Wiskott–Aldrich syndrome, Wiskott–Aldrich syndrome protein, Wiskott–Aldrich syndrome protein-interacting protein


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The Wiskott–Aldrich syndrome (WAS) is a rare disorder characterized by thrombocytopenia variably associated to eczema and increased susceptibility to infections, autoimmunity and lymphoid malignancies (1, 2). The disease is caused by mutations of the gene encoding the Wiskott–Aldrich syndrome protein (WASP) (3) which is expressed in hematopoietic cells where it plays a key regulatory role in cytoskeletal dynamics (46). WASP and its ubiquitously expressed homolog, neural Wiskott–Aldrich syndrome protein (N-WASP) (7), are composed of several domains through which they interact with a variety of proteins and act as links between extracellular signals and the actin cytoskeleton. WASP has an N-terminal Ena/Vasp homology 1 domain (EVH1), also named Wiskott–Aldrich syndrome protein homology 1 domain (WH1), a Cdc42/Rac GTPase-binding domain (GBD) and a proline-rich region. The C-terminal portion of WASP contains a WH2 domain and an acidic region that mediate interactions with G-actin and the Arp2/3 complex, respectively. In addition, the GBD and acidic regions of WASP are involved in intramolecular interactions that impart a closed, inactive conformation to the protein (8).

One of the WASP critical partners is the Wiskott–Aldrich syndrome protein-interacting protein (WIP), a widely expressed protein that regulates polymerization and stability of F-actin and that binds to the WH1 domain of WASP through its C-terminal end (9, 10). Both WASP and WIP belong to evolutionarily conserved families of proteins that regulate the cytoplasmic pool of actin monomers by binding G-actin through WH2 domains and activating the actin filament nucleator complex Arp2/3 (1113). As such, WASP and WIP have overlapping functions as also demonstrated by the similar phenotype observed in the relative gene-targeted mouse models (1416). The interaction between WASP and WIP has been the object of several studies that have indicated an important role of WIP for WASP function. WASP mutations that impair its interaction with WIP have been shown in WAS patients (10, 17) and a large fraction of known WAS-causing mutations, including several hot spots, involve the WIP-binding EVH1 domain of WASP (18), thus suggesting a key role of such domains. In support of the importance of WIP for WASP function is also the evidence that WIP–WASP interaction is necessary for proper recruitment of WASP to the immunological synapse and consequent F-actin polymerization after TCR engagement (19). However, biochemical studies have shown that WIP also inhibits N-WASP function by antagonizing its activation mediated by Cdc42. These findings suggested that WIP interaction may stabilize N-WASP and WASP in their inactive conformation (20). However, the apparently ambivalent promoting and inhibiting effects of WIP on WASP function remain puzzling. Here we present results that indicate the presence of WIP is necessary for WASP expression and activity in human cells. These findings help reconcile the contrasting lines of evidence linking WIP to WASP function and open new research opportunities to improve our understanding of actin-dependent cell biology processes.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Flow cytometry
Cells were fixed, permeabilized (Invitrogen-CALTAG, Carlsbad, CA, USA) and stained with anti-WASP antibody B-9 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) followed by PE-conjugated goat anti-mouse antibody (Biosource International, Camarillo, CA, USA). Immunofluorescence and GFP expression were analyzed with a FACScan and CellQuest software. Cell sorting was performed with a FACSVantage cell sorter (BD Biosciences, San Jose, CA, USA).

Expression constructs and transfections
The pGCWASP vector (21) was used as WASP expression construct. The WIP cDNA was isolated by reverse transcription (RT)–PCR from PBMCs of a healthy donor and ligated into pcDNA3.1 (Invitrogen-CALTAG). His-tagged constructs were generated by PCR amplification using the WIP cDNA as template, followed by ligation into pcDNA4/HisMax A (Invitrogen-CALTAG). Construct sequences were confirmed by direct sequencing. Transfections were carried out with a Nucleofector (Amaxa Inc., Gaithersburg, MD, USA) and procedures recommended by the manufacturer. Stable transfectants were obtained by selecting transfected cells with Geneticin® (Invitrogen-CALTAG, 1 mg ml–1) for 14 days.

Western blot analysis
Cell lysates were separated on an 8% polyacrylamide gel or a NuPAGE 12% Bis–Tris gel (Invitrogen-CALTAG) and transferred onto Immobilon-P membranes (Millipore, Billerica, MA, USA). Primary antibodies used were anti-WASP 3F3-A5 (22), anti-WASP B-9, anti-WIP G-20 (both from Santa Cruz Biotechnology), anti-{alpha}-tubulin B-5-1-2 (Sigma-Aldrich, St Louis, MO, USA) and anti-Xpress (Invitrogen-CALTAG).

Quantitative RT–PCR assays
After extracting total RNA with RNeasy (QIAGEN, Valencia, CA, USA), cDNA was generated using Superscript First Strand Synthesis (Invitrogen-CALTAG). Quantitation of WASP, WIP and GAPDH mRNAs was performed with the Platinum Quantitative PCR SuperMix-UDG kit (Invitrogen-CALTAG) using an ABI Prism 7700 Sequence Detector (Applied Biosystems, Foster City, CA, USA). Primers and probes used were as follows—WASP forward: ACCAGCGACTCTTTGAGATGC, WASP reverse: AGCGCCAGGTACAGCTGAA, WASP probe: FAM-CGAAAATGCTTGACGCTGGCCAC-TAMRA, WIP forward: GCAAACTGGCAAGAAACGAAA, WIP reverse: AGACGAGCAGGCAAAGATCAC, WIP probe: FAM-CCACCACTCCCTCCCATCCCG-TAMRA, GAPDH forward: GAAGGTGAAGGTCGGAGTC, GAPDH reverse: AAGATGGTGATGGGATTTC, GAPDH probe: TET-CAAGCTTCCCGTTCTCAGCC-TAMRA.

RNA interference
Complimentary oligonucleotides designed against WIP mRNA sequences (shWIP61.4: 5'-tgtgggtgggaatcggtaagaaacgaatttcttaccgattcccacccattttttc-3' and 5'-tcgagaaaaaatgggtgggaatcggtaagaaattcgtttcttaccgattcccaccc-3', and shWIP63.5: 5'-tgtttcttaccgattcccacccacgaatgggtgggaatcggtaagaaattttttc-3' and 5'-tcgagaaaaaatttcttaccgattcccacccattcgtgggtgggaatcggtaagaa-3') were annealed and ligated into HpaI–XhoI site of LentiLox3.7 [kindly provided by Van L. Parijs (23)] downstream of the U6 promoter. Lentiviral particles were generated as described (23) and used to transduce JTAg cells (24). Cells were analyzed for GFP expression starting on day 4 after transduction to reduce the possibility of artifacts due to pseudo-transduction (25) and were maintained in culture for long-term monitoring of GFP expression or sorted to obtain homogeneous populations expressing GFP.

Luciferase assays
JTAg cells transduced with WIP short hairpin RNA (shRNA) lentiviral vectors were transfected with nuclear factor of activated T-cells (NFAT)-luciferase reporter (3 µg) and pRL-TK (300 ng) plasmids with or without 8 µg of expression vectors containing truncated WIP constructs. After transfection (24–36 h), the cells were aliquoted and stimulated with 200 ng ml–1 immobilized OKT3 (eBioscience, San Diego, CA, USA), 10 ng ml–1 phorbol myristate acetate (PMA) (Sigma-Aldrich) and 500 ng ml–1 A23187 [GenBank] (Sigma-Aldrich), or cultured without stimulation. After 6 h, cells were harvested and analyzed for luciferase activity using the dual reporter assay system (Promega, Madison, WI, USA). Results from three independent experiments were subjected to one-way analysis of variance followed by Tukey post hoc comparisons.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Although preferentially expressed in hematopoietic cells (22, 26), WASP is not detectable in the erythroleukemic line K562 (22), making these cells a good model for studies of WASP biology. Nonetheless, efforts to express exogenous WASP in K562 cells by retroviral-mediated gene transfer and standard transfection methods reproducibly resulted in very low levels of WASP expression despite detectable WASP mRNA levels (Fig. 1A and data not shown). These observations suggested that WASP might be regulated by post-transcriptional mechanisms such as translation or protein–protein interaction. Of interest, we observed that WIP was also not expressed in K562 cells (Fig. 1B). Because WASP expression is readily detectable in human B and T cell lines (21, 27) and WIP is known to be expressed at high levels in lymphoid tissues (9), we hypothesized that, in K562 cells, WASP expression levels could be limited by inadequate expression of WIP. To test this hypothesis, K562 single-cell clones stably transfected with pGCWASP were additionally transfected with WIP-expressing constructs and analyzed for expression of WASP by FACS®. As shown in Fig. 1(A), the negligible WASP expression of the WASP-transfected K562 cell clone K562/WASP#20 was markedly increased after WIP transfection. These results were reproduced in two other independent cell clones, as well as in bulk transfected K562 cells (data not shown). WIP and WASP levels were also assessed by western blot, which confirmed that only K562 cells transfected with both WASP and WIP expressed substantial levels of WASP (Fig. 1B). These results indicated that expression of WIP is necessary for detectable levels of WASP expression in K562 cells.


Figure 1
View larger version (40K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1. WASP gene transfer leads to high WASP expression only in the presence of WIP. (A) Erythroleukemic K562 cells were stably transfected with WASP-expressing constructs and single-cell cloned. The cell clone K562/WASP#20 was additionally transfected with WIP-expressing vectors or control vectors. These cells were fixed, permeabilized and stained with anti-WASP antibodies for flow cytometric analysis of WASP expression. Unmodified parental K562 (shadowed histograms) were used as negative control and EBV-transformed B cells from a healthy donor (HBC) served as a positive control. (B) K562 cells and K562/WASP#20 cells were transfected with WIP expression constructs or control vectors. Cell lysates were then subjected to western blot analysis of WIP and WASP expression. Expression of {alpha}-tubulin was assessed as loading control.

 
We next asked if reduction of WIP expression would result in decreased WASP levels. Lentiviral vectors producing shRNA specific for WIP mRNA and expressing GFP were transduced into JTAg cells that were then sorted on the basis of GFP expression. Cells transduced with two different WIP shRNA (shWIP61.4 and shWIP63.5) and a GFP control vector (LL3.7) expressed comparable GFP intensity, indicating similar transduction efficiency (Fig. 2A).


Figure 2
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2. Knock down of WIP mRNA reduces WASP but not N-WASP expression levels. (A) Two shRNA lentiviral vectors (shWIP61.4 and shWIP63.5) and a control vector lacking stem loop sequences (LL3.7) were transduced in JTAg cells that were then sorted on the basis of EGFP expression. Parenteral JTAg cells (dashed histogram) are shown as a negative control. (B) cDNAs from LL3.7 cells, shWIP61.4 cells and shWIP63.5 cells were analyzed by quantitative PCR for expressions of WIP, WASP and GAPDH. WIP and WASP mRNA expression levels in shWIP61.4 and shWIP63.5 cells were normalized by GAPDH expression and expressed as percentage of LL3.7 control cells. Data are shown as mean ± SD. (C) JTAg, LL3.7, shWIP61.4 and shWIP63.5 cells were subjected to western blot analysis of WIP, WASP and {alpha}-tubulin expression. Similarly, shWIP61.4 and shWIP63.5 cells transfected with WIP-expressing constructs were also analyzed. (D) Western blot analysis of N-WASP expression performed using lysates from JTAg, LL3.7, shWIP61.4 and shWIP63.5 cells.

 
By quantitative RT–PCR, in cells expressing shWIP61.3 and shWIP63.5 shRNAs, WIP mRNA expression levels were reduced to 22 and 45% of control, respectively (Fig. 2B). WIP expression was also similarly suppressed in these cells (Fig. 2B and C). Reprobing of the same membrane with anti-WASP antibodies demonstrated reduction of WASP expression that correlated with WIP down-regulation (Fig. 2C). Importantly, no effects on WASP mRNA levels were induced by shRNA (Fig. 2B).

To rule out the possibility that WIP shRNA constructs affected other unidentified protein resulting in WASP down-regulation, we performed WIP gene transfer into WIP-knockdown cells. Because the WIP-knockdown-targeting sequence is located downstream of the WIP mRNA stop codon, gene-silencing effects are not expected on constructs expressing WIP cDNAs that lack such target sequence. As expected, WIP cDNA transfection rescued both WIP and, more importantly, WASP expression (Fig. 2C). These results clearly show that in Jurkat cells WIP is required for WASP expression at the post-transcriptional level.

As mentioned, N-WASP is a ubiquitously expressed, close homolog of WASP (7) that also binds WIP (28). However, WIP-knockdown cells showed no reduction of N-WASP levels (Fig. 2D), suggesting that N-WASP expression is independent from WIP.

Deletion of the WASP and WIP genes impairs T cell proliferation, cytokine production and IL-2 transcription (1416). In addition, WASP plays an important role in TCR-induced NFAT-mediated transcription (29). To further characterize the effects of WIP knockdown, we tested the degree of activation of NFAT transcription in response to TCR stimulation. WIP shRNA cells were transfected with a reporter gene driven by the NFAT-responsive element followed by TCR stimulation. As shown in Fig. 3A, in WIP-knockdown cells, NFAT-dependent transcription was affected and the reduction of NFAT activity correlated with the decrease of WIP and WASP expression. Reduced NFAT transcription in WIP-knockdown cells after stimulation was a specific feature of CD3 stimulation, since activation with PMA and A23187 [GenBank] yielded conserved and strong responses.


Figure 3
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3. WIP-knockdown cells exhibit impaired NFAT-mediated transcriptional activity after TCR stimulation and selective proliferative disadvantage. (A) LL3.7, shWIP61.4 and shWIP63.5 cells were co-transfected with plasmids containing the luciferase reporter gene driven by the NFAT-responsive element and pRL-TK as an internal control. After 24 h, cells were stimulated with immobilized anti-CD3 antibody or PMA plus A23187 or cultured without stimulation for 6 h. Lysates were then analyzed for luciferase activity. Relative increase of normalized luciferase activity is shown. Data represent means ± SD from three independent experiments. (B) JTAg cells transduced with shWIP61.4 and shWIP63.5 WIP-knockdown lentiviral vectors and LL3.7 control vector were maintained in culture and percentage of EGFP-expressing cells was monitored over time.

 
Based on the selective accumulation of WASP-expressing T cells in vivo observed in WAS patients with somatic mosaicism and revertant T lymphocytes (3033), we hypothesized that the WIP-knockdown cells may have a selective growth disadvantage compared with unmodified counterparts. To test this hypothesis, after transduction with WIP shRNA, JTAg cells were kept in culture and monitored periodically for GFP expression. We found that the ratio of GFP-positive cells transduced with shWIP61.4 decreased over time, while cells transduced with shWIP63.5 showed only marginal reduction of the percentage of GFP-positive cells compared with control LL3.7 cells (Fig. 3B). These results could be taken to indicate that only marked reduction of WIP expression will cause growth disadvantage in vitro. Our observations that N-WASP expression was not affected in shWIP61.3- and shWIP63.5-transduced cells argue for the specificity of the RNA sequence targeted by our silencing constructs (Fig. 2D). However, we cannot formally rule out that the observed reduction in percentage of GFP-positive cells may be due to toxic effects of non-specific gene silencing in sh61.4-transduced cells.

To identify the region of WIP necessary for WASP expression, a series of WIP deletion mutants were constructed that represented known domains of WIP (Fig. 4A) (13, 19, 20, 34, 35). These constructs were transfected into shWIP61.4 WIP-knockdown cells and the expression of mutant WIP proteins was confirmed by western blot (Fig. 4B). Protein extracts from the same cells were then analyzed for WASP expression. WASP expression was restored in cells transfected with full-length WIP cDNA and WIP mutants containing the WASP-binding domain (Fig. 4C). Interestingly, the region of WIP that binds to WASP was the minimal required segment that rescued WASP expression. These results indicate that WASP expression depends exclusively on the WASP-binding domain of WIP.


Figure 4
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4. The WASP-binding domain of WIP is the minimal region necessary for WASP expression. (A) Schematic representation of wild-type WIP and His-tagged WIP mutants used in this study. Known regions of WIP interaction with partner molecules are indicated. (B) shWIP61.4 cells were transfected with WIP mutants and analyzed by western blot using anti-Xpress antibody. (C) The same cell lysates as in (B) in addition to lysates from shWIP61.4 cells transfected with control vectors and LL3.7 control cells were analyzed by western blot for WASP expression. Re-blotting for tubulin expression was used as loading control. (D) Cells were co-transfected with the indicated WIP constructs, luciferase reporter gene driven by the NFAT-responsive element and pRL-TK as an internal control. After 24 h, cells were stimulated with immobilized anti-CD3 antibody or cultured without stimulation for 6 h. Lysates were then analyzed for luciferase activity. Relative increase of normalized luciferase activity after stimulation was calculated. Data represent means ± SD from three independent experiments. Asterisks indicate significant difference with P <0.05. NS; not significant.

 
Lastly, we examined the effects of WIP mutant expression on NFAT-mediated transcriptional activity. Cells transduced with shWIP61.4 were co-transfected with WIP mutants and an NFAT-responsive luciferase reporter plasmid, and then cultured with or without TCR stimulation. Expression of full-length WIP and a WIP mutant lacking the first N-terminal 120 amino acids resulted in an increase of NFAT-dependent luciferase activity (Fig. 4D). No statistically significant differences among shWIP61.4 cells transfected with control vector and the remaining WIP mutants were observed. These results suggest that although WASP expression is critical for TCR-induced, NFAT-mediated transcription, the presence of WIP domains containing only the WASP-, Nck- and CrkL-binding sites are not sufficient to induce productive signaling through this pathway.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The interaction between WASP and WIP is known to be required for mediating TCR signals (19, 36) and has been postulated to play a pathogenetic role in WAS (10, 17). Our findings demonstrate that WIP is required for WASP expression in human cells and suggest that preservation of adequate WASP expression levels may be a fundamental contribution of WIP to WASP function. Dependence of WASP expression on WIP is also consistent with the findings that all T cell abnormalities in WASP-knockout mice were observed in WIP-deficient mice, but not vice versa (16).

Although WIP is necessary for WASP/N-WASP function, WIP also inhibits WASP/N-WASP activity presumably by stabilizing WASP/N-WASP in their autoinhibited conformation (19, 20). These apparent contradictory lines of evidence may be reconciled by our findings that suggest stabilization of WASP by WIP binding may be the mechanism by which WIP enables WASP expression and therefore its function. In a model that can be proposed based on previous findings and our results, following TCR ligation, WASP is recruited to the immunological synapse and released from WIP inhibition (19), which results in Arp2/3 activation and local actin polymerization. The signal may be terminated by the degradation of free WASP or its re-association with WIP and the consequent return to an inactive state. Therefore, instability of free WASP may be a mechanism contributing to homeostasis of actin polymerization.

The evidence of WIP requirement for WASP expression confirms recent findings in yeast (37) and Caenorhabditis elegans (38), and may have significant implications for our understanding of the biological function of WASP, as well as provide some insights into the clinical aspects of WAS. Most WAS patients with mild phenotype have missense mutations that often involve the WIP-binding region of WASP and present conserved but reduced amounts of WASP expression (18, 39, 40). The association between mild WAS clinical phenotype and mutations affecting the WASP–WIP interaction may be explained by the fact that these mutations mainly cause a reduction of WASP expression and have only minor effects on its biological function.

In addition, our observations suggest that WIP mutations should be considered as a cause of WAS phenotype in patients with reduced WASP in the presence of normal WASP sequence and mRNA expression. Indeed, patients with clinical presentation of WAS in the absence of detectable mutations of WASP have been reported (41). On the other hand, since only the WASP-binding region of WIP is required for WASP expression (Fig. 4C), WIP mutations that do not affect this region would result in conserved WASP expression levels, but may cause impaired immune function due to reduced TCR-mediated IL-2 production.

The dependence of WASP expression on WIP may facilitate gene therapy approaches for WAS. Gene-correction experiments have been carried out in patients' cells and in WASP-knockout mice (21, 27, 4253). Most of these experiments used viral vectors or constructs with strong ubiquitous promoters. However, in no occasion has over-expression of exogenous WASP been observed. These findings may be attributable to regulation of WASP expression levels by endogenous WIP, which would reduce the risk of toxicity due to over-expression of ectopic WASP (54).

Since WIP-knockdown cells exhibited levels of WASP mRNA comparable to controls, the observed decreased WASP levels in these cells may be due to either reduced translation of WASP mRNA or diminished WASP stability within the cell. Recent data have shown that WIP also associates with Syk and inhibits its degradation by calpain and the proteasome in murine bone marrow-derived mast cells (55). Therefore, WIP could similarly protect WASP from protease degradation. Interestingly, WASP sensitivity to calpain is much higher than N-WASP (56), which may explain the lack of effects of WIP knockdown on N-WASP expression (Fig. 2D).

While we could not demonstrate rescue of WASP expression in WIP-knockdown cells cultured in the presence of various protease inhibitors (ALLN, E64d, calpeptin, MG132, alone or in combination), such experiments are dependent of many variables, including rate of protein turnover, sensitivity to protease inhibitors and cellular toxicity of the inhibitors themselves. Our failure to show rescue of WASP expression by protease inhibitors could be simply due to the cell type used (JTAg) and does not preclude different results in alternative models. Further studies are needed to define the precise mechanisms how WIP promotes stability of WASP.

WASP and WIP have many binding partners and belong to complex signaling pathways (9, 19, 20, 35, 39). All of these players must function in harmony for efficient and controlled transduction of extracellular signals to actin. Our results may help reconcile some of the available data and provide an explanation of the seemingly contrasting evidence of WIP dual role in enhancing and inhibiting WASP-mediated actin polymerization and IL-2 production (16). Finally, our findings provide a new avenue for further studies of the role of WASP in TCR-mediated events, provide insights for further understanding of clinical aspects of WAS and have implications for the development of gene therapy for this disease.


    Acknowledgements
 
The authors are grateful to Donn Stewart, David L. Nelson and Christopher Silvin for helpful discussions. This research was supported by the Intramural Research Program of the National Human Genome Research Institute, National Institutes of Health.


    Abbreviations
 
EVH1, Ena/Vasp homology 1 domain
GBD, GTPase-binding domain
N-WASP, neural Wiskott–Aldrich syndrome protein
PMA, phorbol myristate acetate
RT, reverse transcription
shRNA, short hairpin RNA
WAS, Wiskott–Aldrich syndrome
WASP, Wiskott–Aldrich syndrome protein
WH1, Wiskott–Aldrich syndrome protein homology 1 domain
WIP, Wiskott–Aldrich syndrome protein-interacting protein

    Notes
 
Transmitting editor: W. Strober

Received 7 September 2006, accepted 24 November 2006.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Ochs HD. (1998) The Wiskott-Aldrich syndrome. Springer Semin. Immunopathol. 19:435.[CrossRef][Web of Science][Medline]
  2. Schurman SH and Candotti F. (2003) Autoimmunity in Wiskott-Aldrich syndrome. Curr. Opin. Rheumatol. 15:446.[CrossRef][Web of Science][Medline]
  3. Derry JM, Ochs HD, Francke U. (1994) Isolation of a novel gene mutated in Wiskott-Aldrich syndrome. Cell 78:635.[CrossRef][Web of Science][Medline]
  4. Badour K, Zhang J, Siminovitch KA. (2003) The Wiskott-Aldrich syndrome protein: forging the link between actin and cell activation. Immunol. Rev. 192:98.[CrossRef][Web of Science][Medline]
  5. Notarangelo LD and Ochs HD. (2003) Wiskott-Aldrich syndrome: a model for defective actin reorganization, cell trafficking and synapse formation. Curr. Opin. Immunol. 15:585.[CrossRef][Web of Science][Medline]
  6. Burns S, Cory GO, Vainchenker W, Thrasher AJ. (2004) Mechanisms of WASp-mediated hematologic and immunologic disease. Blood 104:3454.[Abstract/Free Full Text]
  7. Miki H, Miura K, Takenawa T. (1996) N-WASP, a novel actin-depolymerizing protein, regulates the cortical cytoskeletal rearrangement in a PIP2-dependent manner downstream of tyrosine kinases. EMBO J. 15:5326.[Web of Science][Medline]
  8. Kim AS, Kakalis LT, Abdul-Manan N, Liu GA, Rosen MK. (2000) Autoinhibition and activation mechanisms of the Wiskott-Aldrich syndrome protein. Nature 404:151.[CrossRef][Medline]
  9. Ramesh N, Anton IM, Hartwig JH, Geha RS. (1997) WIP, a protein associated with Wiskott-Aldrich syndrome protein, induces actin polymerization and redistribution in lymphoid cells. Proc. Natl Acad. Sci. USA 94:14671.[Abstract/Free Full Text]
  10. Stewart DM, Tian L, Nelson DL. (1999) Mutations that cause the Wiskott-Aldrich syndrome impair the interaction of Wiskott-Aldrich syndrome protein (WASP) with WASP interacting protein. J. Immunol. 162:5019.[Abstract/Free Full Text]
  11. Machesky LM and Insall RH. (1998) Scar1 and the related Wiskott-Aldrich syndrome protein, WASP, regulate the actin cytoskeleton through the Arp2/3 complex. Curr. Biol. 8:1347.[CrossRef][Web of Science][Medline]
  12. Yarar D, To W, Abo A, Welch MD. (1999) The Wiskott-Aldrich syndrome protein directs actin-based motility by stimulating actin nucleation with the Arp2/3 complex. Curr. Biol. 9:555.[CrossRef][Web of Science][Medline]
  13. Kinley AW, Weed SA, Weaver AM, et al. (2003) Cortactin interacts with WIP in regulating Arp2/3 activation and membrane protrusion. Curr. Biol. 13:384.[CrossRef][Web of Science][Medline]
  14. Snapper SB, Rosen FS, Mizoguchi E, et al. (1998) Wiskott-Aldrich syndrome protein-deficient mice reveal a role for WASP in T but not B cell activation. Immunity 9:81.[CrossRef][Web of Science][Medline]
  15. Zhang J, Shehabeldin A, da Cruz LA, et al. (1999) Antigen receptor-induced activation and cytoskeletal rearrangement are impaired in Wiskott-Aldrich syndrome protein-deficient lymphocytes. J. Exp. Med. 190:1329.[Abstract/Free Full Text]
  16. Anton IM, de la Fuente MA, Sims TN, et al. (2002) WIP deficiency reveals a differential role for WIP and the actin cytoskeleton in T and B cell activation. Immunity 16:193.[CrossRef][Web of Science][Medline]
  17. Luthi JN, Gandhi MJ, Drachman JG. (2003) X-linked thrombocytopenia caused by a mutation in the Wiskott-Aldrich syndrome (WAS) gene that disrupts interaction with the WAS protein (WASP)-interacting protein (WIP). Exp. Hematol. 31:150.[CrossRef][Web of Science][Medline]
  18. Jin Y, Mazza C, Christie JR, et al. (2004) Mutations of the Wiskott-Aldrich syndrome protein (WASP): hotspots, effect on transcription, and translation and phenotype/genotype correlation. Blood 104:4010.[Abstract/Free Full Text]
  19. Sasahara Y, Rachid R, Byrne MJ, et al. (2002) Mechanism of recruitment of WASP to the immunological synapse and of its activation following TCR ligation. Mol. Cell 10:1269.[CrossRef][Web of Science][Medline]
  20. Martinez-Quiles N, Rohatgi R, Anton IM, et al. (2001) WIP regulates N-WASP-mediated actin polymerization and filopodium formation. Nat. Cell Biol. 3:484.[CrossRef][Web of Science][Medline]
  21. Candotti F, Facchetti F, Blanzuoli L, Stewart DM, Nelson DL, Blaese RM. (1999) Retrovirus-mediated WASP gene transfer corrects defective actin polymerization in B cell lines from Wiskott-Aldrich syndrome patients carrying ‘null’ mutations. Gene Ther. 6:1170.[CrossRef][Web of Science][Medline]
  22. Stewart DM, Treiber-Held S, Kurman CC, Facchetti F, Notarangelo LD, Nelson DL. (1996) Studies of the expression of the Wiskott-Aldrich syndrome protein. J. Clin. Invest. 97:2627.[Web of Science][Medline]
  23. Rubinson DA, Dillon CP, Kwiatkowski AV, et al. (2003) A lentivirus-based system to functionally silence genes in primary mammalian cells, stem cells and transgenic mice by RNA interference. Nat. Genet. 33:401.[CrossRef][Web of Science][Medline]
  24. Dombroski D, Houghtling RA, Labno CM, et al. (2005) Kinase-independent functions for Itk in TCR-induced regulation of Vav and the actin cytoskeleton. J. Immunol. 174:1385.[Abstract/Free Full Text]
  25. Haas DL, Case SS, Crooks GM, Kohn DB. (2000) Critical factors influencing stable transduction of human CD34(+) cells with HIV-1-derived lentiviral vectors. Mol. Ther. 2:71.[CrossRef][Web of Science][Medline]
  26. Parolini O, Berardelli S, Riedl E, et al. (1997) Expression of Wiskott-Aldrich syndrome protein (WASP) gene during hematopoietic differentiation. Blood 90:70.[Abstract/Free Full Text]
  27. Wada T, Jagadeesh GJ, Nelson DL, Candotti F. (2002) Retrovirus-mediated WASP gene transfer corrects Wiskott-Aldrich syndrome T cell dysfunction. Hum. Gene Ther. 13:1039.[CrossRef][Web of Science][Medline]
  28. Volkman BF, Prehoda KE, Scott JA, Peterson FC, Lim WA. (2002) Structure of the N-WASP EVH1 domain-WIP complex: insight into the molecular basis of Wiskott-Aldrich syndrome. Cell 111:565.[CrossRef][Web of Science][Medline]
  29. Silvin C, Belisle B, Abo A. (2001) A role for Wiskott-Aldrich syndrome protein in T-cell receptor-mediated transcriptional activation independent of actin polymerization. J. Biol. Chem. 276:21450.[Abstract/Free Full Text]
  30. Wada T, Schurman SH, Otsu M, et al. (2001) Somatic mosaicism in Wiskott–Aldrich syndrome suggests in vivo reversion by a DNA slippage mechanism. Proc. Natl Acad. Sci. USA 98:8697.[Abstract/Free Full Text]
  31. Wada T, Konno A, Schurman SH, et al. (2003) Second-site mutation in the Wiskott-Aldrich syndrome (WAS) protein gene causes somatic mosaicism in two WAS siblings. J. Clin. Invest. 111:1389.[CrossRef][Web of Science][Medline]
  32. Konno A, Wada T, Schurman SH, et al. (2004) Differential contribution of Wiskott-Aldrich syndrome protein to selective advantage in T- and B-cell lineages. Blood 103:676.[Abstract/Free Full Text]
  33. Wada T, Schurman SH, Jagadeesh GJ, Garabedian EK, Nelson DL, Candotti F. (2004) Multiple patients with revertant mosaicism in a single Wiskott-Aldrich syndrome family. Blood 104:1270.[Abstract/Free Full Text]
  34. Anton IM, Saville SP, Byrne MJ, et al. (2003) WIP participates in actin reorganization and ruffle formation induced by PDGF. J. Cell Sci. 116:2443.[Abstract/Free Full Text]
  35. Anton IM, Lu W, Mayer BJ, Ramesh N, Geha RS. (1998) The Wiskott-Aldrich syndrome protein-interacting protein (WIP) binds to the adaptor protein Nck. J. Biol. Chem. 273:20992.[Abstract/Free Full Text]
  36. Savoy DN, Billadeau DD, Leibson PJ. (2000) Cutting edge: WIP, a binding partner for Wiskott-Aldrich syndrome protein, cooperates with Vav in the regulation of T cell activation. J. Immunol. 164:2866.[Abstract/Free Full Text]
  37. Rajmohan R, Meng L, Yu S, Thanabalu T. (2006) WASP suppresses the growth defect of Saccharomyces cerevisiae las17Delta strain in the presence of WIP. Biochem. Biophys. Res. Commun. 342:529.[CrossRef][Web of Science][Medline]
  38. Sawa M and Takenawa T. (2006) Caenorhabditis elegans WASP-interacting protein homologue WIP-1 is involved in morphogenesis through maintenance of WSP-1 protein levels. Biochem. Biophys. Res. Commun. 340:709.[CrossRef][Web of Science][Medline]
  39. Thrasher AJ. (2002) WASp in immune-system organization and function. Nat. Rev. Immunol. 2:635.[CrossRef][Web of Science][Medline]
  40. Imai K, Morio T, Zhu Y, et al. (2004) Clinical course of patients with WASP gene mutations. Blood 103:456.[Abstract/Free Full Text]
  41. MacCarthy-Morrogh L, Gaspar HB, Wang YC, et al. (1998) Absence of expression of the Wiskott-Aldrich syndrome protein in peripheral blood cells of Wiskott-Aldrich syndrome patients. Clin. Immunol. Immunopathol. 88:22.[CrossRef][Web of Science][Medline]
  42. Huang MM, Tsuboi S, Wong A, et al. (2000) Expression of human Wiskott-Aldrich syndrome protein in patients' cells leads to partial correction of a phenotypic abnormality of cell surface glycoproteins. Gene Ther. 7:314.[CrossRef][Web of Science][Medline]
  43. Dupre L, Aiuti A, Trifari S, et al. (2002) Wiskott-Aldrich syndrome protein regulates lipid raft dynamics during immunological synapse formation. Immunity 17:157.[CrossRef][Web of Science][Medline]
  44. Jones GE, Zicha D, Dunn GA, Blundell M, Thrasher A. (2002) Restoration of podosomes and chemotaxis in Wiskott-Aldrich syndrome macrophages following induced expression of WASp. Int. J. Biochem. Cell Biol. 34:806.[CrossRef][Web of Science][Medline]
  45. Dupre L, Trifari S, Follenzi A, et al. (2004) Lentiviral vector-mediated gene transfer in T cells from Wiskott-Aldrich syndrome patients leads to functional correction. Mol. Ther. 10:903.[CrossRef][Web of Science][Medline]
  46. Klein C, Nguyen D, Liu CH, et al. (2003) Gene therapy for Wiskott-Aldrich syndrome: rescue of T-cell signaling and amelioration of colitis upon transplantation of retrovirally transduced hematopoietic stem cells in mice. Blood 101:2159.[Abstract/Free Full Text]
  47. Strom TS, Gabbard W, Kelly PF, Cunningham JM, Nienhuis AW. (2003) Functional correction of T cells derived from patients with the Wiskott-Aldrich syndrome (WAS) by transduction with an oncoretroviral vector encoding the WAS protein. Gene Ther. 10:803.[CrossRef][Web of Science][Medline]
  48. Strom TS, Turner SJ, Andreansky S, et al. (2003) Defects in T-cell-mediated immunity to influenza virus in murine Wiskott-Aldrich syndrome are corrected by oncoretroviral vector-mediated gene transfer into repopulating hematopoietic cells. Blood 102:3108.[Abstract/Free Full Text]
  49. Charrier S, Stockholm D, Seye K, et al. (2005) A lentiviral vector encoding the human Wiskott-Aldrich syndrome protein corrects immune and cytoskeletal defects in WASP knockout mice. Gene Ther. 12:597.[CrossRef][Web of Science][Medline]
  50. Martin F, Toscano MG, Blundell M, et al. (2005) Lentiviral vectors transcriptionally targeted to hematopoietic cells by WASP gene proximal promoter sequences. Gene Ther. 12:715.[CrossRef][Web of Science][Medline]
  51. Dupre L, Marangoni F, Scaramuzza S, et al. (2006) Efficacy of gene therapy for Wiskott–Aldrich syndrome using a WAS promoter/cDNA-containing lentiviral vector and nonlethal irradiation. Hum. Gene Ther. 17:303.[CrossRef][Web of Science][Medline]
  52. Dewey RA, Avedillo Diez I, Ballmaier M, et al. (2006) Retroviral WASP gene transfer into human hematopoietic stem cells reconstitutes the actin cytoskeleton in myeloid progeny cells differentiated in vitro. Exp. Hematol. 34:1161.[CrossRef][Medline]
  53. Charrier S, Dupre L, Scaramuzza S, et al. Lentiviral vectors targeting WASP expression to hematopoietic cells, efficiently transduce and correct cells from WAS patients. Gene Ther. Epub ahead of print, Oct 19.
  54. Symons M, Derry JM, Karlak B, et al. (1996) Wiskott-Aldrich syndrome protein, a novel effector for the GTPase CDC42Hs, is implicated in actin polymerization. Cell 84:723.[CrossRef][Web of Science][Medline]
  55. Kettner A, Kumar L, Anton IM, et al. (2004) WIP regulates signaling via the high affinity receptor for immunoglobulin E in mast cells. J. Exp. Med. 199:357.[Abstract/Free Full Text]
  56. Shcherbina A, Miki H, Kenney DM, Rosen FS, Takenawa T, Remold-O'Donnell E. (2001) WASP and N-WASP in human platelets differ in sensitivity to protease calpain. Blood 98:2988.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
BloodHome page
H. Falet, M. P. Marchetti, K. M. Hoffmeister, M. J. Massaad, R. S. Geha, and J. H. Hartwig
Platelet-associated IgAs and impaired GPVI responses in platelets lacking WIP
Blood, November 19, 2009; 114(21): 4729 - 4737.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Le Bras, M. Massaad, S. Koduru, L. Kumar, M. K. Oyoshi, J. Hartwig, and R. S. Geha
WIP is critical for T cell responsiveness to IL-2
PNAS, May 5, 2009; 106(18): 7519 - 7524.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Krzewski, X. Chen, and J. L. Strominger
WIP is essential for lytic granule polarization and NK cell cytotoxicity
PNAS, February 19, 2008; 105(7): 2568 - 2573.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Tsuboi and J. Meerloo
Wiskott-Aldrich Syndrome Protein Is a Key Regulator of the Phagocytic Cup Formation in Macrophages
J. Biol. Chem., November 23, 2007; 282(47): 34194 - 34203.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Dong, G. Patino-Lopez, F. Candotti, and S. Shaw
Structure-Function Analysis of the WIP Role in T Cell Receptor-stimulated NFAT Activation: EVIDENCE THAT WIP-WASP DISSOCIATION IS NOT REQUIRED AND THAT THE WIP NH2 TERMINUS IS INHIBITORY
J. Biol. Chem., October 12, 2007; 282(41): 30303 - 30310.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/2/185    most recent
dxl135v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Konno, A.
Right arrow Articles by Candotti, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Konno, A.
Right arrow Articles by Candotti, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?