International Immunology Advance Access originally published online on November 27, 2006
International Immunology 2007 19(1):81-92; doi:10.1093/intimm/dxl124
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The superantigen-induced polarization of T cells in rat peripheral lymph nodes is influenced by genetic polymorphisms in the IL-4 and IL-6 gene clusters
1 Functional and Applied Anatomy, Medical School Hannover, Carl-Neuberg-Strasse 1, 30625 Hannover, Germany
2 Center of Surgery, Medical School Hannover, Carl-Neuberg-Strasse 1, 30625 Hannover, Germany
3 Institute of Immunology, RWTH University Aachen, Aachen, Germany
4 Present address: Anatomie II, OE 4120, Medizinische Hochschule Hannover, Carl-Neuberg-Strasse 1, 30625 Hannover, Germany
Correspondence to: U. Bode; E-mail: bode.ulrike{at}mh-hannover.de
| Abstract |
|---|
|
|
|---|
In recent years, it has become clear that the polarization of T cells depends on the genetic background. However, due to the complexity of the genetic background of each animal, a direct comparison of the phenotype is difficult. In this study, a new rat strain LEW.BN-4-10 carrying the chromosomal regions on chromosomes 4 and 10, which harbor IL-6 and IL-4 gene clusters of BN, has been bred on the genetic background of LEW. It was asked whether these two gene clusters influence the polarization of T cell responses. As a model, the Mycoplasma arthritidis mitogen (MAM)-induced inflammation was used focusing on the microenvironment of the draining lymph node (LN). The effect of differences in these regions was tested by comparing LEW.BN-4-10 and LEW rats under steady-state conditions and upon injection of MAM into the forepaw. Under steady-state conditions, the two strains showed differences in the dendritic cell (DC) subset composition. When MAM was injected, the number of T cells in LEW.BN-4-10 rats producing Th2 cytokines such as IL-4 and IL-13 was significantly increased compared with LEW. The data suggest that these differences in the microenvironments in LN of LEW and LEW.BN-4-10 rats resulted in different susceptibility to the disease (increase of cells in LN and paw swelling). In addition, deviations in the distribution and function of injected effector T cells were found in the LN of LEW and LEW.BN-4-10 rats after MAM treatment. The data indicate that the IL-6 and IL-4 gene clusters are involved in polarizing T cell responses in vivo.
Keywords: cytokines, dendritic cells, inflammation, lymph nodes, T cells
| Introduction |
|---|
|
|
|---|
In vivo antigens are captured by antigen-presenting cells (APCs), transported to the draining lymph node (LN) and then presented by APC, including dendritic cells (DCs). T cells which enter the LN via the blood stream and recognize the presented antigen are stimulated and expand (1). The direction of an initiated immune response is dependent on the type of Th: The development of these functionally distinct T cell subsets (Th1 and Th2) is genetically and epigenetically (2, 3) controlled and influenced by several factors such as cytokines that are present in the T cell microenvironment during antigen presentation and initiation of T cell responses. Th1, which produce predominantly IFN-
and IL-2, activate macrophages. A Th2 response is characterized by IL-4 and IL-13 production and initiates B cell activation resulting in antibody response. In recent years, it has become clear that the polarization of T cell responses is eminent for the outcome of a disease. In the mouse model, BALB/c mice, which develop predominantly Th2 responses, got the disease after Leishmania major infection. C57/Bl6 mice and other mouse strains, which are known to develop Th1 responses, are resistant against the L. major infection (4). Similar to BALB/c and C57/Bl6 mice, in the rat model, LEW and BN rats differ in their polarization of initiated immune responses (5): LEW rats predominantly develop Th1 responses and are therefore susceptible to experimental autoimmune encephalomyelitis (EAE) but resistant to HgCl2-induced nephritis. BN rats are susceptible to Th2-dependent systemic autoimmunity (5, 6). In addition to the well-understood role of the MHC and its various molecular components in the development of different immune responses, polymorphisms in many other regions of the genome have been demonstrated to influence immune responses. Studies on the genetics of EAE in the rat model have identified the regions on chromosome 4 containing the IL-6 gene and on chromosome 10, a region harboring a cluster of cytokine genes including IL-4, IL-5 and IL-13 as well as genes encoding IFN regulatory factor-1 (IRF-1) (5). The IL-6 gene encodes a cytokine that appears to be required for the establishment of the Th2 profile and to down-regulate Th1 cytokine production. The regions of chromosome 10 are homologous to a locus controlling Th1/Th2 differentiation on mouse chromosome 11 (7).
Superantigens (Sags) are characterized by their ability to cross-link MHC class II molecules on APCs with the TCR on T lymphocytes binding outside the antigen-specific groove of the MHC class II and the TCR molecules. Sags bring these two critical molecules together in order to activate >220% of the whole T cell pool (8). In rats, Mycoplasma arthritidis can cause a severe arthritis and the disease is associated with conjunctivitis, urethritis, lethargy and paralysis. Mycoplasma arthritidis secretes Mycoplasma arthritidis mitogen (MAM) and it has been shown that in arthritis-resistant BALB/c mice it elicits a Th2 cytokine profile after injection and re-challenge, whereas the arthritis-susceptible C3H/HeJ mice produced over-expression of IL-12 and a Th1 response to MAM in vivo (9). MAM has been shown to produce highly divergent responses in the LEW and BN strains (10, 11), whereas LEW is a high responder, BN shows only very low reactivity (12).
Therefore, in this study, a new strain LEW.BN-4-10 carrying these chromosomal regions on chromosomes 4 and 10 of BN on the genetic background of LEW has been bred. It represents a model of reduced genetic complexity because other immunologically relevant parts of the genome including the MHC are identical. Thus, in contrast to the complex differences of LEW and BN in the new strain LEW.BN-4-10, the influence of these chromosomal regions of BN on polarization of T cells can be directly investigated. In the current study, different aspects of modifying immune reactions were combined by analyzing how polymorphisms of isolated regions on chromosomes 4 and 10 influence the polarization of a Sag-induced immune response. It was asked how these polymorphisms induce changes in the microenvironment of the LN after MAM-induced immune response. Therefore, the response to MAM in the new rat strain LEW.BN-4-10 was compared with that in the LEW strain. In contrast to most other studies (9, 13), MAM was administered at peripheral sites to induce a local immune response in the draining LN. The advantage of this experimental design is that the local microenvironment of the draining LN can be directly compared with the non-inflamed site. Under these conditions, it was analyzed how DC and the cytokine response are affected by the IL-6 and IL-4 gene clusters resulting in differences in the polarization of the T cell response in the draining LN. In addition, it was tested whether MAM exposure results in functional differences of the draining LN such as distribution of effector T cells in vivo.
| Methods |
|---|
|
|
|---|
Rats
Rats from the standard inbred strains LEW/Ztm, LEW.BN-4-10/Won and LEW.7B/Won were bred and maintained at the Central Animal Laboratory of the Medical School Hannover. Male animals weighing 180220 g were used for this study.
Breeding of LEW.BN-4-10 rats
Studies in the strains LEW and BN have documented that genetic polymorphisms in defined segments of chromosomes 4 and 10 are relevant for differences in immunological responsiveness between these strains (7). Based on this observation, a strain carrying the respective chromosomal regions of the BN strain on the LEW genetic background was generated. The protocol consisted of serial backcrossing with typing for markers identifying the regions to be transferred [D10Mit10 (27.184 Mb), D10Mgh10 (36.254 Mb), IL-4 (39.07 Mb), D10Mit3 (41.339 Mb) and D10Mgh7 (56.170 Mb) encompassing at least 29 Mb on chromosome 10 as well as D4Wox32 (18.832 Mb), D4Mgh14 (36.592 Mb) and D4Mgh2 (36.611 Mb) encompassing at least 36 Mb on chromosome 4]. Animals of the first and second back-cross generation were also typed for RT1, RT3 and RT6, also known to differ between the two parental strains. Animals carrying the BN alleles of these genes were not used for further breeding in order to speed up the elimination of BN-derived polymorphic genes other than the two regions of interest. From the N5 generation a homozygous strain was derived by intercrossing and selection of animals displaying only the BN genotype in the two distinct chromosomal segments. The resulting strain was then maintained by inbreeding. The animals used had been inbred for at least 10 generations. The new strain has been given the preliminary name LEW.BN-4-10 as a short version of the systemic name LEW.BN (D10Mit10-D10Mgh7)(D4Mgh2-D4Wox32)/Won.
Amplification of microsatellite markers
Genomic DNA was prepared from ear specimens according to standard procedures. From an amount of 100 ng of genomic DNA alleles of the microsatellite markers were amplified. The following primer pairs were usedD10Mit10 (forward TTAAAGAGCATCGTTACCTTCTTG and reverse TCCTTTGAAACAAAGTATTGAAAA, annealing: 50°C), D10Mgh10 (forward ATCGTACACACATTCTGTCTCCA and reverse AATTGTTTCTGTTCTGTGCACG, annealing: 60°C), D10Mit3 (forward GTCCAATGTGATGTAGGAAGAGG and reverse TTCCAAAAACATAATGCACACA, annealing: 60°C), D10Mgh7 (forward TAACGCCTCTGGCCTCTG and reverse TCCACAGTGGCTTTTCTCCT, annealing: 55°C), IL-4 intron 2 (forward CCTACCCAGCCTTGACACG and reverse GCAAAAGCCTCTCAGCCT, annealing: 61°C), D4Wox32 (forward CCTGAGATGGGGGTGAGAG and reverse GGATGCTCGGGGTTTGTG, annealing: 55°C), D4Mgh2 (forward CTGCCTTAAACTTCTCCCTATAAA and reverse GGGTTGGAGGGTATGACTTT, annealing: 57°C) and D4Mgh14 (forward TCATGCGGGTGCTTATGTAG and reverse GACTTGATACAATGAAAGCAGAAA, annealing: 57°C). The final concentrations per PCR assay were 0.3 µM of each primer, 200 µM of each deoxynucleoside triphosphate, 1.5 mM MgCl2 in Taq polymerase buffer and 2 U of Taq polymerase (Qiagen). Amplifications were conducted in a GeneAmp PCR System 9600 (PerkinElmer). After an initial denaturation step at 94°C for 3 min, 35 amplification cycles were performed each consisting of 20 s at 94°C, 60 s at the appropriate annealing temperature, 60 s at 72°C and ending with a final elongation step of 5 min at 72°C. One-third of the PCR products was fractionated in horizontal ethidium bromide-stained 2.7 or 4% agarose gels. For the CT microsatellite located within intron 2 of the IL-4 gene, PCR products were radioactively labeled using
-P-32dCTP during the amplification process and were size fractionated in polyacrylamide under denaturating conditions with 8 M urea according to standard procedures.
Production of recombinant MAM
We amplified the MAM gene (mam) from the M. arthritidis Jasmin strain (ATCC 14124; American Type Culture Collection, Rockville, MD, USA) by PCR. The UGA codons at positions 132, 177 and 178 were converted to UGG codons through PCR using mutagenic primers. Mam was directly cloned into the protein fusion expression plasmid vector pGEX4T1 (Amersham, Heidelberg, Germany) without any additional residues. Green fluorescent protein (GFP) and MAM-GFP constructs were cloned in the same way. Purification and cleavage of the glutathione-S-transferaseMAM fusion protein were carried out in accordance with the manufacturer's instructions.
Antibodies
R73 (biotinylated; Serotec, Oxford, UK), R78 (kindly provided by T. Hünig Würzburg), Ox39 (PE conjugated; Serotec), W3/25 (biotinylated; Serotec), Ox8 (biotinylated; Serotec) and Marm (biotinylated; Serotec) were used to identify surface molecules. Anti-5-bromo-2-deoxyuridine (BrdU) [Becton Dickinson (BD) Biosciences, Heidelberg, Germany] was applied to detect incorporated BrdU. Intracellular cytokines were identified via DB-1 (anti-IFN-
; Serotec) and Ox81 (anti-IL-4; Serotec), anti-IL-2, anti-IL-6 and anti-IL-13 (Biosource International, Camarillo, CA, USA) as well as anti-tumor necrosis factor-
(Biotrend Chemikalien GmbH, Cologne, Germany) and anti-IL-10 (BD Biosciences).
Antibodies to phenotype DC sub-populations
For DC phenotyping the following antibodies were used (14): CD25 (Ox39; Serotec), CD4 (W3/25; Serotec), CD8 (Ox8; Serotec), CD11c (Serotec) and B7.1 (BD Biosciences). Dilutions applied were used as described before (15).
MAM-induced local immune response
To define the optimal dose of MAM, LEW rats were treated with various doses (16 µg) and were then sacrificed 3 days later. MAM dissolved in PBS was injected subcutaneously into the forepaw of LEW or LEW.BN-4-10 rats. The other forepaw was treated with the same volume of PBS. The axillary lymph nodes (axLNs) as the draining LN of the MAM- and PBS-treated forepaw were removed. To ensure that the effect was only produced by MAM, GFP and MAM-GFP were injected into each forepaw and the same analyses of the draining LN were done. Since the same purification procedure was performed for GFP and MAM-GFP, differences in the axLN of the drained LN were only caused by MAM. Compared with the GFP-treated side, the MAM-treated side showed paw swelling, 2-fold cell increase in the draining LN and activation of Vß8.2 T cells as shown in Figs 4 and 7 (n = 3, data not shown).
|
|
Migration of injected effector T cells after MAM treatment
LN T cells from LEW.7B cells were activated via TCR and CD28 stimulation in vitro as previously described (16). Then, at least 50 x 106 to 100 x 106 effector T cells were injected intravenously into MAM-treated recipients (LEW and LEW.BN-4-10 rats). After 2 days, recipients were treated again with 2 µg MAM. Injected cells were detected by the mAb His41 against the LEW.7B phenotype via flow cytometry (17).
Phenotype analysis of subsets and proliferation by flow cytometry
Cell suspensions were prepared from the axLN of the MAM- and PBS-treated side. To analyze the subset, their phenotype and their proliferation by flow cytometry, three-color staining was performed as previously described (16, 18).
Identification of DCs and their phenotype
DCs were isolated by treatment of the LN with 2 mg/ml collagenase D (Hoffmann La Roche, Basel, Switzerland) for 30 min at 37°C. The enzyme activity was stopped by adding 10 mM EDTA to the cell suspension. The tissue debris were removed by filtering the cell suspension through a nylon filter. The cells were washed and then stained for analysis by flow cytometry. The DCs were identified within the T and B cell negative population (Ox12 and R73, PE conjugated; Serotec) by MHC class II (Ox6, FITC conjugated; Serotec) and rat-specific 
-integrin expression (Ox62, biotinylated, Serotec and PerCP, BD Biosciences). 
-Integrin is specifically expressed on rat DC (19). The phenotype of DC was characterized by using various surface molecules specific for DC by four-color staining (allophycocyanine; BD Biosciences) and analysis by a FACSCalibur flow cytometer (BD Biosciences).
MAM binding on MHCII++/
-integrin+/cells
The axLNs of LEW and LEW.BN-4-10 rats were treated as described above. Then, the cells were washed and incubated with antibodies against T and B cells (R73 and Ox12; Serotec). For negative selection, magnetic beads were used coupled with anti-goatanti-mouse antibodies (Miltenyi, Bergisch-Gladbach, Germany). Thus, the DCs from mesenteric lymph node (MLN) and axLN were isolated by negative selection using the MACS technique following the instructions provided by Miltenyi. Afterwards, the cells were incubated either with GFP (0.25 µg/ml) or MAM-GFP (0.5 µg/ml) for 1 h in the dark, stained for their MHCII and 
-integrin expression and then submitted to FACS analysis.
Intracellular cytokine staining
To analyze the percentage of lymphocytes expressing various cytokines, 2 x 106 cells per well from the axLN of the PBS- and MAM-treated side were cultured for 6 h in medium, containing RPMI 1640 (Biochrome, Berlin, Germany), 100 U/ml penicillin/streptomycin (Biochrome), 20 mM glutamine (Biochrome), 20 mM HEPES (ICN Biomedicals GmbH, Eschwege, Germany) and 2-mercaptoethanol (Merck, Darmstadt, Germany). At the beginning of the culture, 1 ng/ml phorbol myristate actetate (Sigma, Taufkirchen, Germany) and 250 ng ml1 ionomycin were added. Then cells were fixed with 2% formaldehyde and stained as described before (20).
Data analysis
Calculations, statistical analysis and graphs were done with the software GraphPad Prism 3.0 (GraphPad Software Inc., San Diego, CA, USA).
| Results |
|---|
|
|
|---|
Rat strain congenic for IL-4 and IL-6 gene clusters
F1 (LEW x BN) animals were backcrossed with LEW for further four generations before heterozygous animals were intercrossed to achieve homozygous animals and in order to maintain the new congenic rat strain designated LEW.BN-4-10 (short form). Using this approach, BN-specific coding and non-coding sequences were reduced from 50% in F1 animals via 25 to 12.5%, 6.25% and finally down to 3.125%. To speed up diluting BN-derived genomic sequences, RT1, RT3 and RT6 known to differ between LEW and BN were used as expressed genetic markers. Only those animals that did not carry BN alleles within the first or second back-cross generation were selected for further backcrossing. In order to transfer the entire chromosomal regions of interest, microsatellite markers were used. As shown (Fig. 1A), LEW.BN-4-10 carries the IL-4 gene cluster, located on chromosome 10, and the IL-6 gene cluster, located on chromosome 4. Typing analyses showed that in LEW.BN-4-10 the centromeric part of chromosome 4 originated from BN, while the telomeric part derived from LEW (Fig. 1A).
|
Under steady-state conditions the T cell phenotype and subset composition of LEW.BN-4-10 were comparable to LEW
The breeding procedure of LEW and BN rats resulted in a new strain LEW.BN-4-10 having the genetic background of LEW and the IL-4 and IL-6 gene clusters from BN. The success of the breeding was checked by application of microsatellites within these clusters (Fig. 1A).
First, the question was addressed whether the new congenic rat strain exhibited differences in its lymphocyte composition, as it has been described that the parental strains LEW and BN exhibit particular differences in the subset composition of LN cells. To this end several lymphocyte populations were determined. The CD8+ T cell population was much smaller in BN than in LEW while the CD4+ CD45RC T cell population was greater in BN. Like LEW, LEW.BN-4-10 showed a mostly similar distribution of CD8+ and CD4+ CD45RC T cells and thus differed significantly from BN (Fig. 1B and C). In addition, the subset composition of blood leukocytes of LEW.BN-4-10 and LEW rats was very similar too (Fig. 1D).
The cytokine response of T cells in axLN of LEW.BN-4-10 rats, which was analyzed using intracellular staining and FACS analysis, did not significantly differ from that of LEW under steady-state conditions (data not shown). Mostly, similar cytokine response patterns were observed in the MLN of LEW and LEW.BN-4-10 rats.
Overall, the phenotype of LEW.BN-4-10 as determined by the lymphocyte sub-populations and cytokine response patterns of local LN cells under steady-state conditions tended to represent the LEW phenotype.
LEW and LEW.BN-4-10 differed in their DC sub-population (MHC class II++) in the axLN under steady-state conditions
The DC populations in the axLN were identified in the new strain and the parental strains under steady-state conditions. The T and B cell negative fractions (Fig. 2A), representing the APC, were stained for their MHC class II and 
-integrin expression. Concerning the expression of these molecules, two sub-populations of DC were differentiated in the axLN: MHC class II++/
-integrin+/ (MHCII++/
+/) [Fig. 2A (1)] and MHC class II+/
-integrin+ (MHCII+/
+) [Fig. 2A (2)]. In LEW.BN-4-10, these two DC populations were significantly increased in comparison to LEW (Fig. 2A and B). In BN, the subset composition of DC was completely different: MHCII++/
+/ cells [Fig. 2A and B (1)] were only marginally present, whereas most DCs were found in the MHCII+/
+ population [Fig. 2A and B (2)]. The surface expression of DC markers was analyzed on these cells by four-color flow cytometry. In LEW.BN-4-10 rats, the phenotype of these cells was found to differ from the corresponding cells of LEW rats (Fig. 2C). In detail, CD8 and CD80 expressions were significantly higher among MHCII++/
+/ in LEW.BN-4-10 rats. In contrast, CD80 and IL-2R were lower among MHCII+/
+ of LEW.BN-4-10 rats (Fig. 2C). In BN, expression of surface markers CD8, CD11c, CD80 and IL-2R on DC differed significantly from LEW and LEW.BN-4-10 (e.g. CD80 expression: LEW 51 ± 3%, LEW.BN-4-10 77 ± 3% and BN 35 ± 8% on MHCII++/
+/ cells).
|
MAM treatment affected the presence and the phenotype of DC in the draining LN
Next, the immune response was analyzed in the rat strains LEW and LEW.BN-4-10 following local treatment with the Sag MAM. The Sag MAM was injected into one forepaw of LEW and LEW.BN-4-10 rats. The other paw was treated with PBS and thus served as control.
Interestingly, the MHCII++/
+/ cells (1) of both strains bound MAM nearly 100% (Fig. 3).
|
However, only in LEW animals was the MHCII++/

+/ cell population increased after MAM treatment, while in animals of the LEW.BN-4-10 strain no increase was found (Fig. 4A).
Analyzing the phenotype of DC and activation markers revealed that within the MHCII++/
+/ cell population of LEW and LEW.BN-4-10, CD80 was neither up-regulated nor down-regulated. However, in some cells the IL-2R was up-regulated after MAM treatment (Fig. 4B). The percentage of the MHCII+/
+ sub-population expressing the CD80 activation marker was reduced in LEW rats whereas in animals of LEW.BN-4-10 it was slightly increased (Fig. 4B).
Increased proliferation and activation in the LN of the MAM-treated side
It was analyzed how the treatment with MAM affected the phenotype of the T and B cell composition and their activation within the two strains. Three and four days after injection, the number of T lymphocytes increased 2- to 3-fold in the LN of the MAM-treated side, whereas the B cell number was only slightly increased at these time points (Fig. 5A). The number of Vß8.2+ T cells and in addition that of Vß8.2+ T cells expressing IL-2R were increased (Fig. 5A and B). In the congenic strain LEW.BN-4-10, an increase of T cells and Vß8.2+ T cells similar to that detected in LEW was not observed at the same time point after MAM challenge. Interestingly, the percentage of Vß8.2+ T cells expressing IL-2R was increased in LEW.BN-4-10 animals too, indicating that some activation occurred but obviously different than in LEW animals.
|
The cytokine response pattern was different in LEW and LEW.BN-4-10 after MAM treatment
Subsequently, it was studied how the cytokine response of LEW and LEW.BN-4-10 rats changed differently during an immune response against MAM. Interestingly, in LEW rats the numbers of both CD4+ and CD8+ T cells producing IFN-
, IL-6, IL-10, IL-2, IL-4 and IL-13 were significantly increased in the draining LN of the MAM-treated side compared with the PBS-treated side (Fig. 6A and B, data not shown for CD8+ T cells). Surprisingly, in LEW.BN-4-10 rats, the number of CD4+ and CD8+ T cells producing IL-13 increased significantly, whereas the synthesis of the other cytokines was comparable to that in the LN of the PBS-treated side (Fig. 6B, data not shown for CD8+ T cells). Focusing on the percentage of cytokine-producing Vß8.2 cells, the data showed that only IL-13-producing Vß8.2 T cells increased after MAM treatment in LEW.BN-4-10 rats and not in LEW rats (data not shown). However, during the immune response to MAM, the percentage of CD4+ T cells producing IL-4, IL-13 and IL-2 reached a significantly higher level in LEW.BN-4-10 rats than in LEW rats, whereas IL-6- and IFN-
-producing CD4+ T cells were comparable in both strains (Fig. 7B). The CD8+ cells also showed different patterns: While the percentage of CD8+ T cells producing IFN-
increased during MAM injection in the draining LN of LEW rats, in LEW.BN-4-10 rats the percentage of IFN-
-producing CD8+ T cells declined and IL-13-producing CD8+ T cells increased (Fig. 7C).
|
Taken together, the data show that LEW and LEW.BN-4-10 strains exhibited different MAM-induced cytokine response patterns in the draining LN.
This is underlined by preliminary data analyzed by real-time PCR: While the expression of IL-4 and IL-6 mRNA was down-regulated after MAM injection in LEW rats, in LEW.BN-4-10 rats IL-4 and IL-6 mRNA expression was comparable in the LN of the PBS- and MAM-treated side (data not shown).
Differential phenotypic changes in the LN of LEW and LEW.BN-4-10 rats after MAM treatment resulted in a different extent of the immune reaction in these strains
The functional consequences of the differential phenotypic changes in LEW and LEW.BN-4-10 rats after MAM treatment were considered. Four days after injection, joint swelling of the MAM-treated side was seen significantly more in LEW than in LEW.BN-4-10 rats (Fig. 8A). The cell number increased 2- to 3-fold in the LN of LEW rats compared with the PBS-treated paw (Fig. 8B). Cell numbers of the axLN of the PBS-treated side were identical with those found in untreated animals (data not shown). However, in the MAM-treated LN of LEW.BN-4-10 rats, there was no increase of cells (Fig. 8B), indicating that the differential phenotype of LEW and LEW.BN-4-10 after MAM treatment is involved in the polarization of the immune response.
|
A population of polyclonally activated effector T cells was injected into MAM-treated LEW and LEW.BN-4-10 rats and their distribution was followed. The data show that the cell number of effector T cells in the LN of the MAM-treated side of LEW rats was increased compared with the numbers in the PBS-treated LN (Fig. 8C). Effector T cells migrating through LEW.BN-4-10 recipients failed to accumulate in the LN of the MAM-treated side.
| Discussion |
|---|
|
|
|---|
In the current study a new rat strain LEW.BN-4-10 was generated, which harbors IL-6 and IL-4 gene clusters of BN on the genetic background of LEW. Under steady-state conditions, the cytokine response, T cell subset and leukocyte composition of this new strain in LN and blood were comparable to LEW. In contrast, leukocyte subsets in BN rats were completely different from LEW which is consistent with studies by Fournie et al. (5). The great difference in the phenotype and in the immune responses against different antigens and microbes mediated by Th1 or Th2 between LEW and BN reflects the complex differences of the genotype of both strains. Therefore, the LEW.BN-4-10 strain is a suitable model of reduced genetic complexity because other immunologically relevant parts of the genome including the MHC are identical. It has been shown that the IL-6 and IL-4 gene clusters of LEW are involved in the susceptibility to EAE (7). The two gene clusters are probably involved in the polarization of Th1/Th2 direction. However, direct evidences are so far missing. Therefore, it was of great interest how both the IL-6 and IL-4 gene clusters of BN were able to polarize T cell responses. The effects described in this study were the result of both clusters. However, whether only the IL-4 or IL-6 gene cluster determined these differences can only be answered in rat strains congenic for only one cytokine gene cluster. Generation of these strains has begun. In addition, since the IRF-1 genes and their products are involved in Th1 differentiation by affecting the response of CD4+ T cells to IL-12 (21), it is possible that the described differences are only made by the transferred IRF-1 genes from BN. The generation of a rat strain congenic for IRF-1 genes would be useful.
Under steady-state conditions, the phenotype of most immune competent cells in LEW and LEW.BN-4-10 was comparable. However, the phenotype and the presence of the DC subset MHCII++/
+/ cells differed in the two strains. Nevertheless, nearly all MHCII++/
+/ cells of both strains can bind MAM-GFP to a high extent suggesting that this sub-population is the main population for activation of T cells in this model.
Thus, the current study shows that even under steady-state conditions highly potent APCs are present in the microenvironment of the LN. In contrast to LEW rats, most MHCII++/
+/ cells of LEW.BN-4-10 were matured (CD80 expression) and
60% were CD8 positive. Since CD8
+ DCs have cytotoxic activities (22), MHCII++/
+/ cells with their high CD8
expression probably mediate apoptosis of those T cells that were in direct or indirect contact with these cells. Early studies reported that macrophages from BN rats had suppressive activities on stimulated T cells compared with those of LEW rats (23), resulting in a low response of BN T cells to MAM, and also to other T cell mitogens, such as PHA and Con A (12, 24). Therefore, the data suggest that the differences in the DC subsets in LEW and LEW.BN-4-10 are involved in the different response to MAM resulting in a bias of Th1/Th2 polarization.
In the current study, MAM was used to introduce an immune response in vivo. Since in vivo only minor numbers of antigen-specific T cells are generated during an immune response, the detection of these cells is difficult (25). Sags, e.g. MAM, are able to activate many T cells and therefore initiate a rigorous immune response (8), which can be detected in vivo (9). In addition, in contrast to using an adjuvant (e.g. Freud's adjuvant) the effect and mechanism of Sags are much better characterized (10). We used the Sag MAM, because it is known that MAM is most effective in rats in comparison to other Sags, e.g. Staphylococcus enterotoxin A (10). Vß8.2 T cells responded to MAM, although other reactive populations were found (26). The infection with M. arthritidis, which secrets MAM, results in joint swelling and arthritis and has an optimal read out for the outcome of the disease. Interestingly, in earlier studies it was shown that LEW is a high responder and BN is a low responder to MAM (11). This is not due to differences in the MHC haplotypes, implying a role for non-MHC genes such as the IL-6 and IL-4 gene clusters.
When MAM was used to introduce an immune response in the draining LN, an increase of matured DCs and T cells, e.g. Vß8.2. cells, was detected in LEW, but not in the new strain LEW.BN-4-10. Furthermore, in LEW, an overall increase of cytokine-producing T cells was seen, while in LEW.BN-4-10, a selective induction of Th2 cytokine producers was observed. These data show that in LEW rats a strong immune response against MAM was initiated, which was not the case in LEW.BN-4-10 rats. This suggests that the polymorphisms in the isolated regions in chromosomes 4 and 10 induce tolerance against MAM.
The following scenarios in the LN can be proposed after MAM injection: In LEW, the MHCII++/
+/ DCs with bound MAM entered and matured in the draining LN, which was measured by an increase of these cells in the LN of the MAM-treated side (Fig. 3A). Release of chemokines and cytokines resulted in an increased influx of T cells into the LN (Fig. 4A). Then, interaction of these DCs with T cells led to the activation of many T cells, which resulted in the overall cytokine release (Figs 6 and 7) and therefore in the induction of an immune response against MAM. In LEW.BN-4-10, the matured and probably cytotoxic MHCII++/
+/ DCs were also activated by MAM binding but the release of chemokine and cytokines to recruit T cells failed, which was seen by the lacking increase of T cells in the LN of the MAM-treated side (Fig. 5B). However, activation of Vß8.2 T cells occurred and Th2 cytokine release was seen (Figs 5B, 6 and 7). Thus, two aspects may be important for the induction of the low response in LEW.BN-4-10 rats: the phenotype and the increased presence of MHCII++/
+/ DCs and the release of Th2 cytokines in the MAM-drained LN.
The minor induction of an immune response was also visible by a minor paw swelling of the injected side and a minor increase of cells in the LN of the MAM-treated side. This suggests that the LEW.BN-4-10 animals were not as susceptible to the disease as LEW rats. Both strains not only differed in their susceptibility to MAM, the current study also shows that effector T cells failed to migrate in the LN of the MAM-treated side of LEW.BN-4-10 rats, whereas in LEW rats an accumulation of effector T cells was seen. Since effector T cells are important for the induction of the disease and the extent of an inflammation (27), the lacking influx of effector T cells into the MAM-drained area of LEW.BN-4-10 additionally influences the non-susceptibility of the disease.
In conclusion, differences in the susceptibility to diseases such as EAE, Leishmania and MAM infection were seen both in mouse and rat models with complex genetic variability between the strains (4, 5, 9). In these models, the Th1 and Th2 polarization influences the susceptibility to the disease. By using the new strain LEW.BN-4-10, we clearly demonstrated that a susceptible MHCII haplotype is necessary for the response to a Sag, but that immune responsive genes such as the IL-4/IL-6 gene clusters are responsible for the Th1/Th2 polarization towards inflammation or tolerance. Taking this into account, the described association between certain MHC haplotypes and the Sag-induced diseases may be found on the immune responsive genes in linkage disequilibrium with these haplotypes.
| Acknowledgements |
|---|
The comments of Anke Lührmann (Hannover, Germany) and Jürgen Westermann (Lübeck, Germany) have been of great help. We thank M. Leiß, Dräger Medical Ag & Co., Lübeck, Germany, for donating a Dräger Vapor 19.n anesthetic vaporizer. The authors also wish to thank S. Fiedler and F. Weidner for excellent technical assistance, L. Hänisch for breeding the LEW.BN-4-10 rats as well as S. Fryk for correction of the English. The work was supported by grants of the Deutsche Forschungsgemeinschaft to U.B. (BO1288/1-1) and J.H./K.W. (SFB566, A8).
| Abbreviations |
|---|
| APC, antigen-presenting cell |
| axLN, axillary lymph node |
| BrdU, 5-bromo-2-deoxyuridine |
| DC, dendritic cell |
| EAE, experimental autoimmune encephalomyelitis |
| GFP, green fluorescent protein |
| IRF-1, IFN regulatory factor-1 |
| LN, lymph node |
| MAM, Mycoplasma arthritidis mitogen |
| MLN, mesenteric lymph node |
| Sag, superantigen |
| Notes |
|---|
Transmitting editor: T. Hünig
Received 21 February 2006, accepted 24 October 2006.
| References |
|---|
|
|
|---|
- von Andrian UH and Mempel TR. (2003) Homing and cellular traffic in lymph nodes. Nat. Rev. Immunol. 3:867.[CrossRef][Web of Science][Medline]
- Agarwal S and Rao A. (1998) Modulation of chromatin structure regulates cytokine gene expression during T cell differentiation. Immunity 9:765.[CrossRef][Web of Science][Medline]
- Lee DU, Agarwal S, Rao A. (2002) Th2 lineage commitment and efficient IL-4 production involves extended demethylation of the IL-4 gene. Immunity 16:649.[CrossRef][Web of Science][Medline]
- Sacks D and Noben-Trauth N. (2002) The immunology of susceptibility and resistance to Leishmania major in mice. Nat. Rev. Immunol. 2:845.[CrossRef][Web of Science][Medline]
- Fournie GJ, Cautain B, Xystrakis E, et al. (2001) Cellular and genetic factors involved in the difference between Brown Norway and Lewis rats to develop respectively type-2 and type-1 immune-mediated diseases. Immunol. Rev. 184:145.[CrossRef][Web of Science][Medline]
- Fournie GJ, Saoudi A, Druet P, Pelletier L. (2002) Th2-type immunopathological manifestations induced by mercury chloride or gold salts in the rat: signal transduction pathways, cellular mechanisms and genetic control. Autoimmun. Rev. 1:205.[CrossRef][Medline]
- Roth MP, Viratelle C, Dolbois L, et al. (1999) A genome-wide search identifies two susceptibility loci for experimental autoimmune encephalomyelitis on rat chromosomes 4 and 10. J. Immunol. 162:1917.
[Abstract/Free Full Text] - Proft T and Fraser JD. (2003) Bacterial superantigens. Clin. Exp. Immunol. 133:299.[CrossRef][Web of Science][Medline]
- Mu HH, Sawitzke AD, Cole BC. (2000) Modulation of cytokine profiles by the mycoplasma superantigen Mycoplasma arthritidis mitogen parallels susceptibility to arthritis induced by M. arthritidis. Infect. Immun. 68:1142.
[Abstract/Free Full Text] - Cole BC and Atkin CL. (1991) The Mycoplasma arthritidis T-cell mitogen, MAM: a model superantigen. Immunol. Today 12:271.[CrossRef][Web of Science][Medline]
- Cole BC. (1991) The immunobiology of Mycoplasma arthritidis and its superantigen MAM. Curr. Top. Microbiol. Immunol. 174:107.[Medline]
- Moritz TF, Giebler DF, Gunther EF, Nicklas WF, Kirchner H. (1984) Lymphoproliferative responses of spleen cells of inbred rat strains to Mycoplasma arthritidis mitogen. Scand. J. Immunol. 20:365.[CrossRef][Web of Science][Medline]
- Mu HH, Sawitzke AD, Cole BC. (2001) Presence of Lps(d) mutation influences cytokine regulation in vivo by the Mycoplasma arthritidis mitogen superantigen and lethal toxicity in mice infected with M. arthritidis. Infect. Immun. 69:3837.
[Abstract/Free Full Text] - Bode U, Wonigeit K, Pabst R, Westermann J. (1997) The fate of activated T cells migrating through the body: rescue from apoptosis in the tissue of origin. Eur. J. Immunol. 27:2087.[Web of Science][Medline]
- Klonz A, Wonigeit K, Pabst R, Westermann J. (1996) The marginal blood pool of the rat contains not only granulocytes, but also lymphocytes, NK-cells and monocytes: a second intravascular compartment, its cellular composition, adhesion molecule expression and interaction with the peripheral blood pool. Scand. J. Immunol. 44:461.[CrossRef][Web of Science][Medline]
- Bode U, Sahle A, Sparmann G, Weidner F, Westermann J. (2002) The fate of effector T cells in vivo is determined during activation and differs for CD4+ and CD8+ cells. J. Immunol. 169:6085.
[Abstract/Free Full Text] - Kampinga J, Kroese FG, Pol GH, et al. (1990) RT7-defined alloantigens in rats are part of the leucocyte common antigen family. Scand. J. Immunol. 31:699.[CrossRef][Web of Science][Medline]
- Bode U, Sparmann G, Westermann J. (2001) Gut-derived effector T cells circulating in the blood of the rat: preferential re-distribution by TGFbeta-1 and IL-4 maintained proliferation. Eur. J. Immunol. 31:2116.[CrossRef][Web of Science][Medline]
- Turnbull E and MacPherson G. (2001) Immunobiology of dendritic cells in the rat. Immunol. Rev. 184:58.[CrossRef][Web of Science][Medline]
- Bode U, Duda C, Weidner F, et al. (1999) Activated T cells enter rat lymph nodes and Peyer's patches via high endothelial venules: survival by tissue-specific proliferation and preferential exit of CD8+ T cell progeny. Eur. J. Immunol. 29:1487.[CrossRef][Web of Science][Medline]
- Kroger A, Koster M, Schroeder K, Hauser H, Mueller PP. (2002) Activities of IRF-1. J. Interferon Cytokine Res. 22:5.[Web of Science][Medline]
- Morelli AE and Thomson AW. (2003) Dendritic cells: regulators of alloimmunity and opportunities for tolerance induction. Immunol. Rev. 196:125.[CrossRef][Web of Science][Medline]
- Raff HV and Hinrichs DJ. (1977) Suppressor cell influence in selected strains of inbred rats. II. Macrophage-associated suppression of cell-mediated immune responsiveness. Cell. Immunol. 29:109.[CrossRef][Web of Science][Medline]
- Newlin CM and Gasser DL. (1973) Genetic control of the in vitro responses of rat peripheral blood lymphocytes to phytohemagglutinin and concanavalin A. J. Immunol. 110:622.
[Abstract/Free Full Text] - Westermann J, Sollner S, Ehlers EM, Nohroudi K, Blessenohl M, Kalies K. (2003) Analyzing the migration of labeled T cells in vivo: an essential approach with challenging features. Lab. Investig. 83:459.[Web of Science][Medline]
- Kreiss M, Asmuss A, Krejci K, et al. (2004) Contrasting contributions of complementarity-determining region 2 and hypervariable region 4 of rat BV8S2+ (Vbeta8.2) TCR to the recognition of myelin basic protein and different types of bacterial superantigens. Int. Immunol. 16:655.
[Abstract/Free Full Text] - Dooms H and Abbas AK. (2002) Life and death in effector T cells. Nat. Immunol. 3:797.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
M. Ahrendt, S. I. Hammerschmidt, O. Pabst, R. Pabst, and U. Bode Stromal Cells Confer Lymph Node-Specific Properties by Shaping a Unique Microenvironment Influencing Local Immune Responses J. Immunol., August 1, 2008; 181(3): 1898 - 1907. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








