International Immunology Advance Access originally published online on November 2, 2006
International Immunology 2007 19(1):11-18; doi:10.1093/intimm/dxl116
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Heme oxygenase-1 is not required for mouse regulatory T cell development and function
Instituto Gulbenkian de Ciência, Rua da Quinta Grande, 6, Apartado 14, 2780-901 Oeiras, Portugal
Correspondence to: J. Demengeot; E-mail: jocelyne{at}igc.gulbenkian.pt
| Abstract |
|---|
|
|
|---|
CD4 regulatory T cells (Treg) ensure peripheral tolerance to self-antigens and limit the deleterious effects associated with inflammatory and immune responses by mechanisms that remain to be fully understood. The enzyme heme oxygenase-1 (HO-1), through its known anti-inflammatory activity, is a candidate for a functional role in Treg activity. We compared wild-type and heme oxygenase-1-deficient (hmox-1/) mice in order to assess the role of HO-1 in mouse Treg development and function under physiologic conditions. The frequency of CD25+ and Foxp3+ Treg was similar in hmox-1/ and hmox-1+/+ mice. More importantly, CD4+CD25+ Treg purified from either hmox-1/ or hmox-1+/+ mice were equally efficient in controlling the proliferation in vitro and the expansion in vivo of CD4+CD25 T cells, whether or not these responder cells expressed HO-1. In addition, induction of expression of HO-1 in vivo did not affect Treg suppressor function. As shown before, expression of HO-1 was higher in Treg than in naive T cells; however, naturally activated Foxp3 T cells displayed equal amount of HO-1 mRNA as Treg. Finally, we conclude that under physiological conditions in mice, Treg development, maintenance and function are independent of HO-1 activity.
Keywords: inflammation, regulatory T cells, tolerance
| Introduction |
|---|
|
|
|---|
CD4 regulatory T cells (Treg) maintain immunological self-tolerance, dampen protective immune responses to infection and limit the deleterious effects associated with inflammatory reactions (13). The same cells control lymphopenia-induced proliferation and regulate lymphocyte homeostasis (4, 5). In addition, Treg have also been implicated in the induction of tolerance to transplanted organs (6) and to the fetus (7). In vitro inhibition of T cell proliferation assay reveals the suppressive function of Treg and is often used as a first approach to study Treg functions (8).
The high-affinity IL-2R (CD25) is the surface marker most frequently used to identify Treg (13). However, CD25 expression is not restricted to Treg as it is transiently expressed in all T cells upon activation. Moreover, a significant proportion of CD4+CD25 T cells display regulatory functions as well (4, 911). Recently, the transcription factor forkhead box P3 (Foxp3) was shown to be expressed specifically in murine Treg and to be required for their development and function (1214), providing a specific intracellular marker to identify Treg. Despite some 10 years of intense research, there is no agreement on the molecules that mediate Treg activity, although several have been shown to correlate with Treg development and/or function. These include the CTL-associated protein 4 (CTLA-4), transforming growth factor-beta (TGF-beta), IL-10, glucocorticoid-induced tumor necrosis factor receptor or CD25 itself (reviewed in 15).
The enzyme heme oxygenase-1 (HO-1) is encoded by the ubiquitous stress responsive gene hmox-1. Its expression is inducible in most cells upon exposure to a large variety of endogenous and/or xenobiotic agents (16). As shown in a growing number of experimental models, HO-1 dampens inflammation, limits tissue injury and promotes tissue repair (reviewed in 17). These activities are thought to rely on the degradation of the pro-oxidant heme into carbon monoxide, iron and biliverdin. Moreover, modulation of HO-1 expression and activity affects graft versus host disease (18), tolerance to tissue graft (1921) and allo-pregnancy (22), indicating that HO-1 down-modulates T cell-mediated immune responses.
The similarities in the anti-inflammatory functions attributed to Treg and to HO-1 enzymatic activity raised the possibility that HO-1 would be a key mediator of Treg activities. Several studies have already tested this hypothesis through the use of various in vitro assays. Thus, application of exogenous carbon monoxide to murine (23) and human (24) CD4 T cells in vitro has been shown to mimic Treg-suppressive effects. Moreover, human CD4+CD25+ cells were reported to constitutively express HO-1 (25) and forced expression of Foxp3-induced HO-1 transcription in a human T cell line (26). Finally, the suppressor activity of human Treg appeared reduced or enhanced when HO-1 expression and activity were induced or repressed, respectively (26). Whether human and mouse Treg equally require HO-1 expression to exert their suppressor function in vitro and whether this requirement is physiologically relevant remained to be assessed (27). The availability of heme oxygenase-1-deficient (hmox-1/) mice on genetic backgrounds classically used to test Treg activities prompted us to directly assess whether HO-1 acts physiologically to support Treg function in mice. We found that a functional hmox-1 allele is not required for the development of Treg or for their ability to control T cell proliferation in vitro and in vivo. Our findings, therefore, provide no evidence in support of a role for HO-1 in Treg development and function in mice.
| Methods |
|---|
|
|
|---|
Mice
Mice were bred and maintained under specific pathogen-free (SPF) conditions at the Instituto Gulbenkian de Ciência animal facility. Experimental protocols were approved by the institutional ethical comity as well as the Portuguese veterinary general division. hmox-1/ mice in the BALB/c and C57BL/6 backgrounds (backcrossed 10 generations to the respective background) were provided by Shaw-Fang Yet (Brigham and Women Hospital, Harvard Medical School, Boston, MA, USA) and introduced at the SPF facility by embryo transfer. Mice were bred as heterozygotes and yield
510% homozygous offspring (28, 29). Littermate hmox-1+/+ and hmox-1+/ were used as controls. All experiments described were performed with 2- to 3-month old mice, before the development of inflammatory lesions (29). BALB/c SCID mice were originally purchased from the Jackson Laboratory (USA).
Antibodies and reagents
Allophycocyanin-, Cy-Chrome- and PE-conjugated anti-CD4 mAb (clone RM4-5), CD45RBPE (16A) and Thy1.2FITC (53-2.1) were purchased from BD PharMingen (San Diego, CA, USA). Anti-Foxp3PE (FJK-16s) was purchased from e-biosciences (http://www.ebioscience.com). B220allophycocyanin (RA3-6B2) and CD25 (PC61)AlexaFluorTM 488 were produced at the Instituto Gulbenkian de Ciência. CoPPIX (Frontier Scientific, Inc., Logan, UT, USA) was dissolved in 0.2 N NaOH, neutralized with 0.2 N HCl, adjusted to 1 mg ml1 in H2O and sterilized by filtration. Aliquoted stocks were stored at 80°C until use. CoPPIX was administered daily (intra-peritoneally 200 µl, 5 mg kg1).
Cell preparation and flow cytometric analysis
Cells were stained as described previously (9). Briefly, single-cell suspensions that were obtained from spleen or pooled lymph nodes (LNs) (axillary, inguinal, braquial and mesenteric) were prepared in PBS 2% FCS; 0.01% sodium azide (FACS buffer). After antibody staining (25 µl antibody mixture, 20 min on ice) and washes in FACS buffer, cells were stained with propidium iodide (PI) in FACS buffer. Analyses were performed on a FACSCalibur (BD) using Cell QuestTM software, allowing the exclusion of dead cells (PI+) inside the indicated gates. Total number of cell counts was deduced from the acquisition of a fixed number of 10-µm latex beads (Coulter Corp., Miami, FL, USA) mixed with a known volume of unstained cell suspension.
Cell purification and adoptive transfer
Pooled LNs or splenocytes stained with anti-CD4PE and CD25Alexa mAbs or with anti-CD4Cy-Chrome, CD25Alexa and CD45RBPE were purified using a MoFlo high-speed cell sorter (Cytomation Inc., Fort Collins, CO, USA). Purity of cell populations was routinely >98% for CD4+CD25+ cells and >99% for CD4+CD25, CD4+CD45RBlowCD25 and CD4+CD45RBhighCD25. Purified cell populations (2.5 x 105 cells in 100 µl of PBS) were adoptively transferred into BALB/c SCID mice by intravenous administration into the retro-orbital plexus.
Cell cultures and suppression assays
All cultures were set in RPMI-1640 supplemented with 10% FCS, 100 U ml1 penicillin, 100 µg ml1 streptomycin, 50 µM 2-mercaptoethanol, 10 mM HEPES and 1 mM sodium pyruvate (all from Life Technologies, Grand Island, NY, USA). To measure cell proliferation and suppressor function, T cells were plated at 2.5 x 104 cell per well in U-shape 96-well plates for 72 h together with 105 irradiated splenocytes as antigen-presenting cells (APCs), and 0.5 µg ml1 anti-CD3 mAb (clone 145.2C11; home-made). In co-cultures of Treg and CD4+CD25 cells, only the Treg numbers varies according to the indicated ratios. Cultures were set in triplicates in a final volume of 200 µl. Proliferation was monitored by addition of [3H]thymidine (1 µCi per well; AmershamGE Healthcare, Buckinghamshire, UK) for the last 6 h of culture.
Genomic and real-time reverse transcriptionPCR
hmox-1+/+, hmox-1+/ and hmox-1/ mice were genotyped by PCR amplification of tail genomic DNA using two primer pairs specific to the mutated or wild-type allele. Primers were as follow (5'3'): mutated allele, TCTTGACGAGTTCTTCTGAG and ACGAAGTGACGCCATCTGT and wild-type allele, GGTGACAGAAGAGGCTAAG and CTGTAACTCCACCTCCAAC. For both combinations, the annealing temperature was 58°C.
Real-time reverse transcription (RT)PCRs were performed as described previously for Foxp3 (9), hypoxanthine-guanine phosphoribosyl transferase (HPRT) (9) and HO-1 (21). Briefly, total RNA was extracted from 104 to 106 cells using TriPure isolation reagent (Roche Diagnostic, Mannheim, Germany), treated with DNaseI and reverse transcribed using Superscript II RT and oligo(dT)1218 primer (Life Technologies). Real-time PCRs were performed using the QuantiTect SYBR Green PCR Master Mix (Qiagen, Valencia, CA, USA) and run on the Light Cycler system (Roche Molecular Biochemicals, Mannheim, Germany). Foxp3, HO-1 and HPRT primer pairs were (5'3'): Foxp3, TTCATGCATCAGCTCTCCACT and AAGGTGGTGGGAGGCTGA; HO-1, TCTCAGGGGGTCAGGTC and GGAGCGGTGTCTGGGATG and HPRT, CCAGCAAGCTTGCAACCTTAACCA and GTAATGATCGTCAACGGGGGAC. The standard curve method, with plasmid cDNA of each gene, was applied for quantification of the amplicons. Each sample was run in triplicates. The normalized values for mRNA were calculated as the quantity of mRNA divided by HPRT mRNA levels and converted in reference to the CD45RBhighCD25 subset (=1).
Statistical analysis
Statistical significance was determined using one-way analysis of variance, the Student's t-test and the MannWhitney U-test. P < 0.05 was considered significant.
| Results |
|---|
|
|
|---|
Enhanced expression of HO-1 in mouse naturally activated T cells
Previous reports indicated that Foxp3 expression in human T cells induces HO-1 transcription (26), although T cell activation per se also promotes HO-1 expression (25). To assess whether in mouse CD4 lymphocytes HO-1 and Foxp3 expression are correlated, BALB/c CD4 T cells were fractionated according to their expression of the activation markers CD45RB and CD25 and submitted to quantitative real-time RTPCR (Fig. 1). As expected, Foxp3 mRNAs were 10-fold more abundant in CD25+ cells than in activated/memory CD25CD45RBlow cells and barely detectable in naive CD25CD45RBhigh cells (Fig. 1, left). These results are consistent with those obtained after intracellular staining for Foxp3 (data not shown). In contrast, both subsets of naturally activated CD4 cells (CD25+ and CD25CD45RBlow) expressed equal amounts of HO-1 mRNA, that was 5-fold higher than that of naive T cells (CD25CD45RBhigh), but 20-fold lower than that of total splenocytes (Fig. 1, right). This analysis reveals that although HO-1 expression correlates with T cells activation status, Foxp3 and HO-1 expression are not directly correlated in murine CD4 T cells.
|
In vivo induction of HO-1 expression does not affect mouse Treg function
We next tested whether mouse Treg suppressor activity was enhanced when HO-1 expression was induced above steady-state level. For this purpose, mice were treated twice with CoPPIX, a chemical inducer of HO-1 expression (18), at 24 h intervals. CD4+CD25+ Treg and CD4+CD25 cells were purified 24 h thereafter. As shown previously for total CD4 T cells (21), this regimen induced significant HO-1 over-expression in CD4+CD25+ cells albeit less than in total splenocytes (Fig. 2A). When cultured with anti-CD3 and irradiated splenocytes as APCs, CD4+CD25+ cells isolated from CoPPIX-treated and control mice were equally unresponsive to TCR triggering (Fig. 2B). In cultures containing CD4+CD25 cells, Treg purified from CoPPIX-treated and control mice suppressed proliferation with similar efficiency, independently of the ratio Treg:CD4+CD25 cells (Fig. 2B). We also monitored whether induction of HO-1 expression affects the responding T cells (CD4+CD25) and the APCs in similar proliferation assay. In the absence of Treg, CD4+CD25 T cells proliferative response was not significantly modified whether T cells or APCs were isolated from treated or control mice (data not shown). Finally, the efficiency of Treg to mediate suppression was tested within each combination of cell subsets and was similar whether Treg, CD4+CD25 cells or APCs were isolated from CoPPIX-treated or control mice (data not shown). These findings indicate that induction of HO-1 expression in mouse Treg does not modify their suppressor activity.
|
hmox-1/ mice have normal frequency of Treg
To directly assess the contribution of HO-1 to mouse Treg function, we analyzed the loss of function mutant mice hmox-1/. Three-month-old BALB/c hmox-1/ mice produced in our SPF facility did not show obvious abnormalities in body weight, overall behavior and posture. However, splenomegalia was clearly noticed upon dissection. Total number of splenocytes was increased on average by a factor of three in hmox-1/, as compared with hmox-1+/ or hmox-1+/+ animals (Fig. 3). Contrary to what has been described for older mice (28), increased cellularity in hmox-1/ animals was restricted to the spleen and was not noticed in the LNs, bone marrow or thymus (data not shown). Flow cytometry analysis revealed that splenomegalia in hmox-1/ mice resulted from a proportional accumulation of hematopoietic cells including lymphocytes and RBCs (Fig. 3). The total numbers of B cells (B220+, IgM+ or IgD+) and T cells (TCR+) were increased by a factor of two in hmox-1/ versus hmox-1+/ or hmox-1+/+ animals. The frequency of activated T cells was similar for all genotypes, as assessed by the expression of CD69, CD44 or CD45RB (data not shown). The frequency of Mac-1+ cells was increased by 2- to 3-fold in hmox-1/ (10.7 ± 2.4%) versus hmox-1+/ (3.8 ± 0.2%) or hmox-1+/+ animals (3.6 ± 0.7%), resulting in a >5-fold increase in the total number of these cells (Fig. 3). As reported by others (30), serum IgM but not IgG concentration was increased in hmox-1/ versus hmox-1+/ or hmox-1+/+ mice (data not shown) while analyses of thymocytes and various LN cell populations did not reveal differences between hmox-1/, hmox-1+/ or hmox-1+/+ mice (data not shown). The frequency of Ter119+ erythrocyte precursors in the bone marrow was decreased by 2-fold in hmox-1/ versus hmox-1+/ or hmox-1+/+ mice (data not shown). A similar analysis of hmox/ C57Bl-6 mice indicated milder splenomegalia (2-fold increased cellularity) and no obvious unbalance distribution of lymphocytes subsets (data not shown).
|
Finally, using either CD25 or Foxp3 to identify Treg, the frequency of Treg in the thymus, spleen or LN was not different in hmox-1/ mice when compared with hmox-1+/ or hmox-1+/+ mice (shown for spleen, Fig. 4A). Increased splenic cellularity in hmox-1/ mice was associated with a 2-fold increase in total Treg numbers (Fig. 4B) similarly to that of conventional CD4 T cells (data not shown). These results indicate that HO-1 deficiency does not affect Treg production in the thymus or their maintenance in the periphery.
|
Expression of HO-1 by CD4 T cells is not necessary for mouse Treg suppressor function in vitro
The functional capacity of CD4+CD25+ Treg from hmox-1/ mice was first tested in vitro (Fig. 5). Treg isolated from hmox-1/ BALB/c mice did not proliferate when cultured in the presence of anti-CD3 and irradiated splenocytes (Fig. 5A). Moreover, wild-type CD4+CD25 cells proliferation was suppressed with the same efficiency irrespectively of whether Treg were purified from hmox-1/ or hmox-1+/+ BALB/c mice (Fig. 5A). In addition, cultures of CD4+CD25 cells and APCs isolated from hmox-1/ BALB/c mice were equally sensitive to the suppressive effects of Treg (Fig. 5B) and proliferated equally in the absence of Treg (Fig. 5C). Additional combinations of the three cellular subsets isolated from control or mutant BALB/c mice did not reveal difference in the proliferative responses (data not shown). To exclude that the BALB/c genetic background contains genetic elements that specifically compensate the HO-1 requirement of Treg suppressor function, the experiments described above were repeated using hmox-1/ C57BL/6 mice. Similar suppression indexes were obtained whether Treg, CD4+CD25 cells or APCs were isolated from hmox-1/ or hmox-1+/+ C57BL/6 mice, irrespectively of the co-culture combinations (Fig. 5D and data not shown). We conclude that HO-1 expression is not necessary for mouse Treg suppressor function in vitro.
|
Expression of HO-1 by mouse CD4 cells is dispensable for Treg activity in vivo
To assess whether HO-1 expression by Treg is required for their function in vivo, we tested the capacity of hmox-1/ BALB/c Treg to control lymphopenia-induced proliferation. Lymphocyte-deficient BALB/c SCID mice received wild-type syngeneic CD4+CD25 cells either alone or together with an equal number of CD4+CD25+ Treg isolated from either hmox-1+/+ or hmox-1/ BALB/c animals. The number of CD4 T cells recovered in spleen and LN was determined 4 weeks thereafter (Fig. 6A). When compared with single CD4+CD25 cell transfer, co-transfer with either hmox-1+/+ or hmox-1/ CD4+CD25+ cells resulted in a similar log reduction in the number of recovered CD4 T cells in the spleen or LN (Fig. 6A).
|
We next tested whether the control of lymphopenia-induced expansion by Treg requires the expression of HO-1 in effector T cells. Additional adoptive transfer experiments were performed using CD4+CD25 cells purified from hmox-1/ BALB/c mice and Treg (CD4+CD25+) from hmox-1+/+ BALB/c mice (Fig. 6B). In this system, Treg activity resulted also in a log reduction in the number of recovered CD4 cells in spleen and LN. Taken together, these findings demonstrate that HO-1 expression by CD4+CD25 or CD4+CD25+ is not required for Treg to exert their function in vivo.
| Discussion |
|---|
|
|
|---|
In the present study, we explored the possibility that HO-1 expression in murine CD4 cells is necessary for the development and function of Treg. This hypothesis was driven by the apparent overlap of Treg and HO-1 immunoregulatory functions in various experimental models. Previous studies using modulators of HO-1 expression and/or activity in human cells in vitro concluded that HO-1 expression is necessary for Treg to exert their suppressor function (25, 26). However, whether these conclusions apply in vivo remained to be determined. The recent availability of hmox/ mice on genetic backgrounds classically used to test Treg function (i.e. BALB/c and C57Bl/6) provides the opportunity to address the role of HO-1 for mouse Treg function under physiological conditions. Our conclusions are that HO-1 is not essential for mouse Treg development, maintenance and function.
Consistent with previous expression patterns of CD4 subsets (11), we failed to observe a direct correlation of HO-1 with Foxp3 expression. Further, using conventional drug-mediated induction of HO-1 expression, we reveal that elevated level of HO-1 expression in mouse Treg does not correlate with increased suppressor efficiency as measured in vitro. These findings contrast with previous studies reporting that Foxp3 expression induces HO-1 transcription and that modulation of HO-1 transcription affects Treg activity (25, 26). The simplest explanation for this discrepancy may be differences in experimental conditions. For example, we analyzed ex vivo unmanipulated freshly isolated cells while the previous study was essentially conducted in vitro. Perhaps more importantly, we studied LN mouse cells while the previous work addressed human peripheral blood lymphocytes and modulation of HO-1 expression may affect Treg in a species-specific and/or tissue-specific way.
To further determine whether Treg function requires HO-1 expression, we followed a classical in vivo loss of function approach, using hmox-1/ mice. We found no abnormalities of Treg development or function in these mice. The frequency of Treg in the thymus, spleen and LN was similar in hmox-1+/+ and hmox-1/ mice, indicating that Treg development (thymus) and peripheral maintenance (spleen and LN) are not dependent on HO-1 expression, in either Treg or any other cell type. Unlike null mutations of genes encoding IL-2, IL-2R or Foxp3 that affect the development and/or function of Treg (1), and as described before (28, 29), HO-1 deficiency was not associated with severe systemic lymphoproliferation early in life. Most likely, cell accumulation in the spleen is a consequence of reduced degradation of the pro-oxidant heme that normally occurs at high rate in this organ (31). In keeping with the well-established role of Treg in regulating lymphocyte homeostasis, the absence of severe systemic lymphoproliferative disease in young adult hmox-1/ mice suggested that Treg function was not dramatically reduced in these mice. Regulatory CD4 T cell subsets isolated from hmox-1/ mice inhibited T cell proliferation equally as wild-type Treg, once more suggesting that Treg development and function are independent of expression of HO-1. Noteworthy, the in vitro and in vivo assays we used to test Treg activity provide both qualitative and quantitative measurements (32) and were totally unable to demonstrate any impact of HO-1 expression in Treg activity. As an alternative test for the possible contribution of HO-1 in an inflammatory model, we tested Treg control of lymphopenia-induced proliferation, a process shown to be promoted to a large extend by colonizing microbial flora in addition to bona fide homeostatic expansion (33). Again, we failed to evidence a difference between Treg isolated from wild-type or hmox/ mice and so we can conclude that a functional HO-1 allele in either conventional CD4 T cells or Treg is not essential for mouse Treg activities.
A valid question is whether specific compensatory mechanisms in HO-1-null mutants may mask the otherwise normal contribution of HO-1 to Treg function. In this regard, it is worth noting that the two independent hmox-1 knockout alleles, hmoxtmKPoss and hmoxtmMlee engineered and published by Poss et al. (28) and Yet et al. (29), respectively, can only be maintained by heterozygote breeding and only 1020% of homozygote embryos develop to term. This characteristic appears independent of the genetic background as Hmox+/Mlee, 129sv/B6, BALB/c or C57Bl/6 (19, 29 and this work), and all yield a similar low frequency of live homozygote progenies. Both hmoxtmKPoss and hmoxtmMlee homozygote survivors show an absence of detectable HO-1 protein by western blot (28, 29) and live up to 1 year, independently of their genetic background (28, 29 and our unpublished results). The cause of early embryonic lethality and the possible compensatory mechanisms that take place in the few hmox-1/ survivors remain to be established. Whether these early developmental compensatory mechanisms participate also in late lymphocyte physiology is unlikely but cannot be formally excluded. The generation of tissue-specific inducible HO-1 knockout mice will provide the necessary tool to answer this question.
The finding that expression of HO-1 by CD4 T cells is not required for Treg function should not preclude other levels of interactions between HO-1 and Treg activities. For instance, by severely limiting effector T cell number and responses, HO-1 may participate in inverting the effector:Treg ratio in particular regimens of tolerance induction (19). It is also conceivable that the anti-inflammatory activity of HO-1 in dendritic cells and macrophages may affect the activation and expansion of Treg that normally follows microbial infection (3436). Finally, although the progressing inflammatory disease in the hmox-1/ mice may not be due to a Treg deficiency, increased Treg numbers may delay the disease. The absence of a direct correlation of the two immunoregulatory pathways controlled by Treg and HO-1 raises the possibility that they may operate independently to ensure a robust control of potentially severe deleterious inflammatory reactions. Treg would function to provide fine tuning of antigen-specific immune responses (3) while HO-1 expression in tissues, monocytes/macrophages and dendritic cells would ensure local return to homeostasis. Testing these hypotheses will await the production of alymphoid hmox-1/ mice and analysis of chimeras in which HO-1 activity is restricted to specific cellular subsets.
Finally, the possibility that the function of human and mouse Treg would rely on different molecular pathways has multiple consequences, at the fundamental and clinical levels. This intriguing issue is out of the scope of the present study, but it is worth noticing that contrary to the genes involved in Treg development and function, such as Foxp3, CTLA-4, IL-2, IL-2R and TGF-beta, polymorphisms in the HO-1 locus have yet not been associated with autoimmune diseases. Moreover, HO-1 gene polymorphisms in donor and not in recipient have been associated with graft survival (37). A definitive answer to the question of whether HO-1 is required for human Treg function in vivo will involve novel experimental designs specific to human studies, most probably based on the analysis of the rare patients presenting HO-1 deficiencies, or else on large-scale correlative analysis of HO-1 polymorphisms and Treg activity. Irrespective of these considerations, our findings, indicating that mouse Treg development, maintenance and function do not require HO-1, call for a re-evaluation of the links between the HO-1 and Treg immunomodulatory pathways.
| Acknowledgements |
|---|
This work was supported by the Fundação para a Ciência e Tecnologia with the co-participation of the Fundo Europeu de Desenvolvimento Regional; Grants POCTI/SAU-MNO/58192/2004 and/56066/2004 to J.D. and M.P.S., respectively, and fellowships SFRH/BD/10181/2002 and 3106/2000 to S.Z. and A.C., respectively. We are grateful to Alexis Perez for operating the cell sorter, Dolores Bonaparte for embryo transfer, Rosa Santos for antibodies preparation and Sofia Rebelo and Silvia Cardoso for maintaining the HO-1 mutant colony. We acknowledge the members of the Lymphocyte Physiology and Inflammation groups for their support and thank Michael Parkhouse, Luis Graça and Werner Haas for their critical reading of the manuscript.
| Abbreviations |
|---|
| APC, antigen-presenting cell |
| CTLA-4, CTL-associated protein 4 |
| hmox-1/, heme oxygenase-1-deficient |
| HO-1, heme oxygenase-1 |
| HPRT, hypoxanthine-guanine phosphoribosyl transferase |
| LN, lymph node |
| PI, propidium iodide |
| RT, reverse transcription |
| SPF, specific pathogen free |
| TGF-beta, transforming growth factor-beta |
| Treg, regulatory T cell |
| Notes |
|---|
Transmitting editor: R. Flavell
Received 31 May 2006, accepted 3 October 2006.
| References |
|---|
|
|
|---|
- Sakaguchi S. (2004) Naturally arising CD4+ regulatory t cells for immunologic self-tolerance and negative control of immune responses. Annu. Rev. Immunol 22:531.[CrossRef][Web of Science][Medline]
- Mittrucker HW and Kaufmann SH. (2004) Mini-review: regulatory T cells and infection: suppression revisited. Eur. J. Immunol 34:306.[CrossRef][Web of Science][Medline]
- Coutinho A, Hori S, Carvalho T, Caramalho I, Demengeot J. (2001) Regulatory T cells: the physiology of autoreactivity in dominant tolerance and "quality control" of immune responses. Immunol. Rev 182:89.[CrossRef][Web of Science][Medline]
- Annacker O, Pimenta-Araujo R, Burlen-Defranoux O, Barbosa TC, Cumano A, Bandeira A. (2001) CD25+ CD4+ T cells regulate the expansion of peripheral CD4 T cells through the production of IL-10. J. Immunol 166:3008.
[Abstract/Free Full Text] - Almeida AR, Legrand N, Papiernik M, Freitas AA. (2002) Homeostasis of peripheral CD4+ T cells: IL-2R alpha and IL-2 shape a population of regulatory cells that controls CD4+ T cell numbers. J. Immunol 169:4850.
[Abstract/Free Full Text] - Waldmann H, Graca L, Adams E, Fairchild P, Cobbold S. (2005) Regulatory T cells in transplantation tolerance. Curr. Top. Microbiol. Immunol 293:249.[Web of Science][Medline]
- Zenclussen AC. (2005) CD4(+)CD25+ T regulatory cells in murine pregnancy. J. Reprod. Immunol 65:101.[CrossRef][Web of Science][Medline]
- Thornton AM and Shevach EM. (1998) CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J. Exp. Med 188:287.
[Abstract/Free Full Text] - Zelenay S, Lopes-Carvalho T, Caramalho I, Moraes-Fontes MF, Rebelo M, Demengeot J. (2005) Foxp3+ CD25- CD4 T cells constitute a reservoir of committed regulatory cells that regain CD25 expression upon homeostatic expansion. Proc. Natl Acad. Sci. USA 102:4091.
[Abstract/Free Full Text] - Curotto de Lafaille MA, Muriglan S, Sunshine MJ, et al. (2001) Hyper immunoglobulin E response in mice with monoclonal populations of B and T lymphocytes. J. Exp. Med 194:1349.
[Abstract/Free Full Text] - Fontenot JD, Rasmussen JP, Williams LM, Dooley JL, Farr AG, Rudensky AY. (2005) Regulatory T cell lineage specification by the forkhead transcription factor foxp3. Immunity 22:329.[CrossRef][Web of Science][Medline]
- Hori S, Nomura T, Sakaguchi S. (2003) Control of regulatory T cell development by the transcription factor Foxp3. Science 299:1057.
[Abstract/Free Full Text] - Fontenot JD, Gavin MA, Rudensky AY. (2003) Foxp3 programs the development and function of CD4+CD25+ regulatory T cells. Nat. Immunol 4:330.[CrossRef][Web of Science][Medline]
- Khattri R, Cox T, Yasayko SA, Ramsdell F. (2003) An essential role for Scurfin in CD4+CD25+ T regulatory cells. Nat. Immunol 4:337.[CrossRef][Web of Science][Medline]
- von Boehmer H. (2005) Mechanisms of suppression by suppressor T cells. Nat. Immunol 6:338.[CrossRef][Web of Science][Medline]
- Choi AM and Alam J. (1996) Heme oxygenase-1: function, regulation, and implication of a novel stress-inducible protein in oxidant-induced lung injury. Am. J. Respir. Cell Mol. Biol 15:9.[Abstract]
- Otterbein LE, Soares MP, Yamashita K, Bach FH. (2003) Heme oxygenase-1: unleashing the protective properties of heme. Trends Immunol 24:449.[CrossRef][Web of Science][Medline]
- Woo J, Iyer S, Mori N, Buelow R. (2000) Alleviation of graft-versus-host disease after conditioning with cobalt-protoporphyrin, an inducer of heme oxygenase-1. Transplantation 69:623.[CrossRef][Web of Science][Medline]
- Yamashita K, Ollinger R, McDaid J, et al. (2006) Heme oxygenase-1 is essential for and promotes tolerance to transplanted organs. FASEB J 20:776.
[Abstract/Free Full Text] - Camara NO and Soares MP. (2005) Heme oxygenase-1 (HO-1), a protective gene that prevents chronic graft dysfunction. Free Radic. Biol. Med 38:426.[CrossRef][Web of Science][Medline]
- McDaid J, Yamashita K, Chora A, et al. (2005) Heme oxygenase-1 modulates the allo-immune response by promoting activation-induced cell death of T cells. FASEB J 19:458.
[Abstract/Free Full Text] - Sollwedel A, Bertoja AZ, Zenclussen ML, et al. (2005) Protection from abortion by heme oxygenase-1 up-regulation is associated with increased levels of Bag-1 and neuropilin-1 at the fetal-maternal interface. J. Immunol 175:4875.
[Abstract/Free Full Text] - Song R, Mahidhara RS, Zhou Z, et al. (2004) Carbon monoxide inhibits T lymphocyte proliferation via caspase-dependent pathway. J. Immunol 172:1220.
[Abstract/Free Full Text] - Pae HO, Oh GS, Choi BM, et al. (2004) Carbon monoxide produced by heme oxygenase-1 suppresses T cell proliferation via inhibition of IL-2 production. J. Immunol 172:4744.
[Abstract/Free Full Text] - Pae HO, Oh GS, Choi BM, Chae SC, Chung HT. (2003) Differential expressions of heme oxygenase-1 gene in CD25- and CD25+ subsets of human CD4+ T cells. Biochem. Biophys. Res. Commun 306:701.[CrossRef][Web of Science][Medline]
- Choi BM, Pae HO, Jeong YR, Kim YM, Chung HT. (2005) Critical role of heme oxygenase-1 in Foxp3-mediated immune suppression. Biochem. Biophys. Res. Commun 327:1066.[CrossRef][Web of Science][Medline]
- Brusko TM, Wasserfall CH, Agarwal A, Kapturczak MH, Atkinson MA. (2005) An integral role for heme oxygenase-1 and carbon monoxide in maintaining peripheral tolerance by CD4+CD25+ regulatory T cells. J. Immunol 174:5181.
[Abstract/Free Full Text] - Poss KD and Tonegawa S. (1997) Heme oxygenase 1 is required for mammalian iron reutilization. Proc. Natl Acad. Sci. USA 94:10919.
[Abstract/Free Full Text] - Yet SF, Perrella MA, Layne MD, et al. (1999) Hypoxia induces severe right ventricular dilatation and infarction in heme oxygenase-1 null mice. J. Clin. Invest 103:R23.[Medline]
- Kapturczak MH, Wasserfall C, Brusko T, et al. (2004) Heme oxygenase-1 modulates early inflammatory responses: evidence from the heme oxygenase-1-deficient mouse. Am. J. Pathol 165:1045.
[Abstract/Free Full Text] - Ryter SW and Tyrrell RM. (2000) The heme synthesis and degradation pathways: role in oxidant sensitivity. Heme oxygenase has both pro- and antioxidant properties. Free Radic. Biol. Med 28:289.[CrossRef][Web of Science][Medline]
- Caramalho I, Lopes-Carvalho T, Ostler D, Zelenay S, Haury M, Demengeot J. (2003) Regulatory T cells selectively express toll-like receptors and are activated by lipopolysaccharide. J. Exp. Med 197:403.
[Abstract/Free Full Text] - Kieper WC, Troy A, Burghardt JT, et al. (2005) Recent immune status determines the source of antigens that drive homeostatic T cell expansion. J. Immunol 174:3158.
[Abstract/Free Full Text] - Hori S, Carvalho TL, Demengeot J. (2002) CD25+CD4+ regulatory T cells suppress CD4+ T cell-mediated pulmonary hyperinflammation driven by Pneumocystis carinii in immunodeficient mice. Eur. J. Immunol 32:1282.[CrossRef][Web of Science][Medline]
- Mottet C, Uhlig HH, Powrie F. (2003) Cutting edge: cure of colitis by CD4+CD25+ regulatory T cells. J. Immunol 170:3939.
[Abstract/Free Full Text] - Suffia IJ, Reckling SK, Piccirillo CA, Goldszmid RS, Belkaid Y. (2006) Infected site-restricted Foxp3+ natural regulatory T cells are specific for microbial antigens. J. Exp. Med 203:777.
[Abstract/Free Full Text] - Baan C, Peeters A, Lemos F, et al. (2004) Fundamental role for HO-1 in the self-protection of renal allografts. Am. J. Transplant 4:811.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
A. Moreau, M. Hill, P. Thebault, J. Y. Deschamps, E. Chiffoleau, C. Chauveau, P. Moullier, I. Anegon, B. Alliot-Licht, and M. C. Cuturi Tolerogenic dendritic cells actively inhibit T cells through heme oxygenase-1 in rodents and in nonhuman primates FASEB J, September 1, 2009; 23(9): 3070 - 3077. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. George, A. Braun, T. M. Brusko, R. Joseph, S. Bolisetty, C. H. Wasserfall, M. A. Atkinson, A. Agarwal, and M. H. Kapturczak Suppression by CD4+CD25+ Regulatory T Cells Is Dependent on Expression of Heme Oxygenase-1 in Antigen-Presenting Cells Am. J. Pathol., July 1, 2008; 173(1): 154 - 160. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Lee, W. Gao, S. Mazzola, M. N. Thomas, E. Csizmadia, L. E Otterbein, F. H. Bach, and H. Wang Heme oxygenase-1, carbon monoxide, and bilirubin induce tolerance in recipients toward islet allografts by modulating T regulatory cells FASEB J, November 1, 2007; 21(13): 3450 - 3457. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







