Skip Navigation


International Immunology Advance Access originally published online on December 6, 2006
International Immunology 2007 19(1):105-115; doi:10.1093/intimm/dxl127
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/1/105    most recent
dxl127v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kurachi, M.
Right arrow Articles by Matsushima, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kurachi, M.
Right arrow Articles by Matsushima, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Japanese Society for Immunology. 2006. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Maintenance of memory CD8+ T cell diversity and proliferative potential by a primary response upon re-challenge

Makoto Kurachi1,*, Kazuhiro Kakimi1,*, Satoshi Ueha2 and Kouji Matsushima2

1 Department of Immunotherapeutics (Medinet), Graduate School of Medicine, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan
2 Department of Molecular Preventive Medicine and SORST JST, Graduate School of Medicine, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan

Correspondence to: K. Matsushima; E-mail: koujim{at}m.u-tokyo.ac.jp


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Supplementary data
 References
 
Memory CD8+ T cells generated during an immune response are long lived and self-renewing, offering enhanced host protection against re-infection. However, how an antigen-specific population of memory T cells is maintained, throughout repetitive infections over potentially a lifetime, is not known. Here we show that a primary response during re-challenge significantly contributes to memory T cell pool both qualitatively and quantitatively. Upon re-challenge, the skewed Vß usage and TCR repertoire of pre-existing memory T cells is partly corrected by diversity in a newly primed (primary) T cell population. Importantly, this primary population expands more vigorously in a subsequent antigen encounter. These findings indicate that memory T cell populations evolve over multiple challenges, favoring memory T cells generated in more recent encounters, and suggest that these primary populations have essential roles in the perpetuation of antigen-specific T cell populations.


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Supplementary data
 References
 
The memory T cell response ensures that a recall response to foreign antigen is greater in magnitude and faster than a naive T cell response. This enhanced response results in part through the increased frequency, proliferative responsiveness and effector function acquisition of memory T cells compared with naive T cells (13). Memory T cells can persist for years to a lifetime in humans through homeostatic proliferation—a feature reminiscent of stem cells—and therefore offer increased protection against foreign antigen long after an initial immune response has occurred (2, 49). Thus, a memory T cell population, once established, is generally thought to expand and contract clonally upon antigen re-challenge. However, it is not clear whether memory T cells can undergo such rounds of extensive proliferation indefinitely (2).

Although a recall T cell response consists mostly of pre-existing (secondary) CD8+ T cells, some naive (primary) CD8+ T cells are newly primed by antigen-presenting cells (APCs) during re-infection (1012). This was shown in studies that employed either TCR transgenic (Tg) or non-TCR Tg systems. However, the role of this primary response in the maintenance of memory T cell populations has not been thoroughly characterized. Furthermore, the endogenous polyclonal T cell response presumably follows a different developmental program than TCR Tg cells, possibly due to the different number of cell divisions and/or differential competition for APCs and co-stimulatory/growth signals in these systems (13, 14). Memory T cells are classified as CD62L-CCR7- effector memory T cells (TEM) or CD62L+CCR7+ central memory T cells (TCM) based on homing characteristics and effector function (2, 15). While studies using large numbers of monoclonal TCR Tg T cells indicate a lineage relationship between TEM and TCM (13), antigen-specific T cells generated from low numbers of endogenous naive precursors (and which experience a higher number of cell divisions) remain TEM and fail to convert to TCM (14). Taken together, these results indicate that initial precursor frequency is important in the study of in vivo immune responses. We therefore examined longitudinal responses of endogenous antigen-specific T cells in serial adoptive transfer experiments. This allowed us to characterize the memory T cell response with precise classification of antigen experience number. Our analysis has the advantage of more closely approximating the natural dynamics of memory T cell populations in response to serial antigen challenge.

Consistent with previous reports, we find that antigen re-challenge can elicit a primary response despite the presence of pre-existing memory T cells. We further find that this primary response contributes to overall TCR diversity within the antigen-specific memory T cell population. Surprisingly, effector T cells generated from a more recent challenge expand more robustly in a third antigen encounter. These results indicate that a primary response during antigen re-exposure can contribute to the maintenance of memory T cell populations, and that these populations may ultimately be subject to dynamic turnover.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Supplementary data
 References
 
Mice
B10.D2 and C57BL/6 were purchased from SLC (Shizuoka, Japan). C57BL/6 background GFP+ and Ly5.1+ mice were purchased from RIKEN (Japan) and The Jackson Laboratory (Bar Harbor, ME, USA), respectively. C57BL/6 GFP+/B10.D2 F1 (H-bxd), C57BL/6 Ly5.2/B10.D2 F1 and C57BL/6 Ly5.1/B10.D2 F1 mice were generated by crossing C57BL/6 background GFP+ with B10.D2, C57BL/6 with B10.D2 and Ly5.1+ with B10.D2, respectively. Mice were aged 6–12 weeks at experimental onset and maintained by in-house breeding at the University of Tokyo under specific pathogen-free conditions and in accordance with the University of Tokyo Institutional Animal Care and Use Committee guidelines.

Peptide, plasmid and recombinant vaccinia virus and adenovirus
A peptide corresponding to a known H-2 Ld-restricted HBs antigen-specific CD8+ T cell epitope (S28–39; IPQSLDSWWTSL) and lymphocytic choriomeningitis virus NP118 (RPQASGVYM) were synthesized by Sigma Genosis (Ishikari, Japan) (16). A plasmid that expresses HBs antigen under transcriptional control of the CMV immediate early promoter (pCMV-S) was kindly provided by Aldevron (Fargo, ND, USA) (17). Recombinant vaccinia virus encoding the small ENV protein of hepatitis B virus (HBV) (vHBs.4) was kindly provided by Moss (NIAID) (18, 19). A replication-defective adenovirus vector containing a 1.3-fold-overlength replication competent HBV genome that drives liver-specific HBV antigen expression (Ad-HBV) was kindly provided by Protzer (University of Heidelberg, Heidelberg, Germany) (20).

Immunization of mice and adoptive transfer
In prime-boost experiments, mice were immunized once with pCMV-S injected into regenerating tibialis anterior muscles (50 µg per leg) 5 days after the injection of cardiotoxin (LATOXAN, Valence, France). At least 4 weeks after DNA injection, mice were intravenously administered a booster injection of 1 x 107 plaque-forming units (pfu) of vHBs.4 (21). Mice were sacrificed at least 40 days after and isolated spleen cells were injected intravenously into congenic non-irradiated naive recipient mice after treatment with ACK lysis buffer (0.15 M NH4Cl, 10 mM KHCO3 and 0.1 mM Na2EDTA at pH 7.4). Recipient mice were infected intravenously 1 day later with Ad-HBV (5 x 109 pfu), as described (20). For ovary vHBs.4 titration, plaque assay of homogenized ovaries were performed by 10-fold serial dilutions. Titers were determined by staining with 0.1% crystal violet after 48 h (13).

Lymphomononuclear cell preparation
Spleen cells were isolated by passage through a 70-µm cell strainer (Becton Dickinson) with a 2.5-ml syringe plunger and washed twice with PBS. For intrahepatic lymphocyte (IHL) isolation, livers were perfused with 10 ml of PBS via portal vein to remove circulating lymphocytes and liver cell suspensions were pressed through 200-µm stainless mesh. IHLs were isolated by 33% Percoll (Amersham Bioscience, Piscataway, NJ, USA) centrifugation of homogenized liver for 10 min at 800 x g and washed twice with RPMI 1640 medium for further use. For separation of secondary memory cells in Fig. 5, magnetic microbeads and AutoMACS (Miltenyi Biotec, Germany) were used according to manufacturer's protocol.


Figure 5
View larger version (43K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Functional capacities of primary and secondary memory. (A) Experimental design. Equivalent numbers of Ly5.1+ primary memory or secondary memory (1.4 x 105) were adoptively transferred into Ly5.2+ mice (Group 1, primary memory; Group 2, secondary memory). Secondary memory cells were mixed with 1 x 108 Ly5.1+naive spleen cells to cell numbers constant. Mice that received only naive spleen cells were also analyzed (Group 3). Recipient mice were challenged with 5 x 106 pfu vHBs.4 intra-peritoneally, and respective proliferative capacities (as measured by the number of splenic Env.28-Dimer+ CD8+ T cells) and anti-viral activities (as measured by virus titer in the ovaries) were determined on day 5. (B) Flow cytometry profiles of adjusted donor spleen cells before transfer (left) and 5 days after vHBs.4 challenge (right, gated on Ly5.1+ donor-derived cells). Numbers indicated in right upper quadrants are the percentage of Env.28-Dimer+ CD8+ T cell among all donor-derived CD8 T+ cells. (C) Number of Ly5.1+ Env.28-Dimer+ CD8+ T cells in the spleen on day 5 after vHBs.4 challenge (n = 3–6, mean ± SEM). Statistical evaluations were carried out by the two-sample t-test (*P < 0.0001). (D) Control of vHBs.4 infection by primary or secondary memory following intra-peritoneal injection. Titers of vHBs.4 in the ovaries were determined on day 5 after challenge (n = 3–6, mean ± SEM, *P < 0.0001).

 
FACS analysis
All antibodies used in flow cytometry were purchased from BD PharMingen (San Diego, CA, USA), except for CD127 (eBioscience; San Diego, CA, USA). Dimer X (BD PharMingen), which consists of recombinant H-2 Ld:Ig fusion protein supplemented with recombinant ß2 microglobulin, was conjugated to Env.28 peptide (Env.28-Dimer) according to the supplied protocol. Single-cell suspensions of lymphocytes were prepared and 106 cells were incubated in PBS containing Env.28-Dimer and antibody supplemented with 2% fetal bovine serum for 1 h at 4°C. After washing twice with PBS, cells were stained with PE-conjugated anti-mouse IgG1 at 4°C for 30 min to detect Env.28-Dimer+ cells. Intracellular cytokine staining for IFN-{gamma} was performed using Cytofix/Cytoperm (BD PharMingen). Briefly, lymphocytes were cultured in the presence or absence of Env.28–39 peptide (0.2 µg ml–1) at 37°C in complete medium supplemented with 50 U ml–1 human recombinant IL-2 and brefeldin A for 5 h [IFN-{gamma} and tumor necrosis factor (TNF)] or 6 h (IL-2), followed by surface staining for CD8 and Ly5.1 and intracellular staining for IFN-{gamma}, TNF, and IL-2. Flow cytometry was performed using an EPICS, ELITE and ALTRA (Beckman Coulter, Fullerton, CA, USA), and data were analyzed with Expo32 software (Beckman Coulter).

TCR repertoire analysis
Spectratyping analyses were performed as described (22). Briefly, total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA, USA) from sorted Env.28-Dimer+ CD8+ T cells. cDNAs were synthesized using a SuperScript III cDNA synthesis kit (Invitrogen) with oligo dT primer. Different sets of 24 PCRs were performed with Cß 145 (CACTGATGTTCTGTGTGACA) and 24 unique Vß-specific primers (22). Following amplification, five cycle run-off reactions were performed using fluorescent primer Cß 5' (CTTGGGTGGAGTCACATTTCTC). PCR products were analyzed using an ABI3730 sequencer (Applied Biosystems, Foster City, CA, USA), and data were analyzed with Gene Mapper Software version 3.1 (Applied Biosystems). For TCR repertoire analysis, all experimental procedures including adoptive transfer of spleen cells and sorting of Env.28-Dimer+ CD8+ T cells were carried out on individual mice.

Statistical analysis
The two-sample t-test was used to evaluate the correlation between data. Statistical analyses were performed with the JMP software, version 6.0.0 (SAS Institute Inc., Cary, NC, USA).


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Supplementary data
 References
 
Primary (naive) CD8+ T cells can be generated during a recall response
We used an adoptive transfer model to distinguish concurrent primary (naive) and memory CD8+ T cell responses against the same antigen upon repetitive exposure (Fig. 1A). We chose as an antigen the HBV surface antigen that includes the Env.28 peptide (S28–39), an immunodominant, Ld-restricted CD8+ T cell epitope located between residues 28 and 39 (16). In addition, we employed different antigen delivery systems to allow heterologous immunization and multiple challenges, while also minimizing complication from background vector (23, 24). Antigen delivery was accomplished using plasmid DNA (pCMV-S), recombinant vaccinia virus (vHBs.4) or recombinant adenovirus (Ad-HBV). Details are provided in Methods.


Figure 1
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 A primary response during re-challenge. (A) Experimental design. Ly5.1+ donor mice were immunized with 100 µg plasmid DNA (pCMV-S) for prime and at least 4 weeks later 1x107 pfu vHBs.4 for boost. Spleen cells (4.1x107 including 5x105 Env.28-Dimer+ CD8+ T cells) were transferred into naive non-irradiated Ly5.2+ mice that were then challenged 1 day later with 5x109 pfu Ad-HBV. (B) Detection and phenotype of Env.28-Dimer+ CD8+ T cells at the time of transfer. Numbers and phenotype of Env.28-Dimer+ CD8+ T cells in pooled spleen cells were assessed by MHC class I dimer staining. Filled and open histograms denote isotype control and markers, respectively. Representative data on day 85 after vHBs.4 infection are shown (see also Supplementary Figure 1,available at International Immunology Online). (C) Env.28-Dimer+ CD8+ T cells in the spleen detected on day 14 after Ad-HBV infection with 5x109 Ad-HBV. Numbers represent frequencies of primary (Ly5.2+) and memory (Ly5.1+) cells among total Env.28-Dimer+ CD8+ T cells. Irrelevant peptide staining (lymphocytic choriomeningitis virus NP118) is shown as a control for dimer staining. (D) Number of Env.28-Dimer+ CD8+ T cells in the liver and spleen after Ad-HBV infection. The overall T cell response consists of memory (Ly5.1+, filled box) and primary (Ly5.2+, open box) responses. Data are indicated as mean ± SEM from three to six mice analyzed per time point from three independent experiments.

 
Ly5.1+ C57BL6/B10.D2 F1 mice were immunized with pCMV-S for prime and vHBs.4 for boost, and isolated spleen cells from these donor mice were used as a source of Env.28-specific memory CD8+ T cells (21). Pooled spleen cells consisted of at least 5.4% Env.28-specific memory T cells within the CD8+ population, as determined by both intracellular IFN-{gamma} and Env.28-Dimer staining (Fig. 1B and Supplementary Figure 1, available at International Immunology Online). Surface markers and functional properties of splenic Env.28-Dimer+ CD8+ T cells were CD44hi CD127hi IL-2+ TNF++, indicating memory phenotype (Fig. 1B and Supplementary Figure 1, available at International Immunology Online). Spleen cells from Ly5.1+ donor mice were adoptively transferred into naive Ly5.2+ C57BL6/B10.D2 F1 recipient mice, which were subsequently treated intravenously with 5 x 109 pfu of Ad-HBV 1 day after transfer (20). Transfer of 4.1 x 107 spleen cells (containing 5 x 105 Env.28-Dimer+ CD8+ T cells) and inoculation with 5 x 109 pfu Ad-HBV resulted in vigorous expansion of Env.28-Dimer+ CD8+ T cells in both the liver and spleen that peaked around days 10–14 and gradually subsided by day 35 [Fig. 1C and D and (25)]. The majority (>90%) of Env.28-Dimer+ CD8+ T cells were Ly5.1+; however, 5–10% were Ly5.1-. No Env28-Dimer+ cells that are Ly5.1- are detectable using Ly5.1+ mice, which also carry Ly5.2 (data not shown). Therefore, Ly5.1- Env.28-Dimer+ CD8+ T cells were derived from Ly5.2 recipients (Fig. 1C). For clarity, here and elsewhere, we refer to this population as Ly5.2+ to indicate that they originate in Ly5.2 mice. These results indicate that a primary (Ly5.2+) CD8+ T response is induced in response to Ad-HBV infection despite the presence of transferred Ly5.1+ memory T cells (Fig. 1C and D). Even in heterologous immunization with recombinant viral vectors, the recall T cell response can be comprised of pre-existing memory as well as primary CD8+ T cells (1012).

A primary response occurs with quantitative expansion of pre-existing memory cells
Next, to examine factors that might influence the induction of a primary response, we transferred different numbers of Ly5.1+-immunized spleen cells (4.1 x 106 or 4.1 x 107), containing 5 x 104 or 5 x 105 Env.28-specific CD8+ T cells, into naive Ly5.2+ mice (Fig. 2). Recipient mice were challenged 1 day later with different doses of Ad-HBV (5 x 109 or 1 x 108 pfu). Although a rapid and vigorous memory CD8+ T cell response was induced in all groups, primary (Ly5.2+) Env.28-Dimer+ CD8+ T cells were only observed in mice infected with 5 x 109 pfu of Ad-HBV (Fig. 2A, Groups 1 and 2). This suggests that antigen dose can determine whether a primary response detectably occurs. Furthermore, the magnitude of the primary response was variable, with ~25-fold higher induction when fewer (5 x 104) memory cells were transferred (Fig. 2A).


Figure 2
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Correlation between antigen load, memory T cell number and primary response induction. (A) Number of Env.28-Dimer+ CD8+ T cells in the liver and spleen after transfer of either 5 x 104 or 5 x 105 memory cells, and challenge with either 1 x 108 or 5 x 109 pfu Ad-HBV. Memory (Ly5.1+) and primary (Ly5.2+) responses are indicated by filled and open boxes, respectively. Data are representative of three independent experiments (n = 3–5 per group, mean ± SEM). (B) 5,6-Carboxyfluoroscein succinimidyl ester (CFSE) analysis of memory T cell division with different Ad-HBV dose. Results are shown as CFSE intensity gated on Env.28-Dimer+ CD8+ T cells.

 
We next tested whether a correlation exists between pre-existing memory cell division and the induction of a primary response (Fig. 2B). We labeled Ly5.1+-immunized spleen cells with 5,6-carboxyfluoroscein succinimidyl ester before transfer of 5 x 105 memory cells and challenge with different doses of Ad-HBV (5 x 109 or 1 x 108 pfu; Groups 2 and 3, respectively, Fig. 2A and B). Nearly all transferred memory CD8+ T cells had divided by day 14 in mice injected with a high Ad-HBV dose, in which a primary CD8+ T cell response occurred (Fig. 2A and B, Ad-HBV 5 x 109). In contrast, 10–20% of transferred memory CD8+ T cells were undivided over 35 days in mice receiving a low Ad-HBV dose, in which a primary response was undetectable (Fig. 2A and B, Ad-HBV 1 x 108). This suggests that a primary response is induced upon recall only under conditions where antigen load saturates pre-existing memory CD8+ T cell expansion, when presumably excess antigen is present and available to less efficient naive T cells. Consistent with previous observations, once recruited into division, memory T cells underwent at least 7–8 divisions (26). Furthermore, in mice infected with 1 x 108 pfu Ad-HBV, the undivided population was stably maintained after day 7, whereas the number of divided cells had peaked by this time.

The primary response contributes to overall TCR diversity
To investigate the primary response contribution to overall TCR diversity, we used Vß usage analysis and spectratyping length analysis (immunoscope) of complementarity determining region 3 (CDR3), with classification of the number of antigen experiences. As CDR3 segments are the most polymorphic regions of TCR chains, their diversity reflects T cell population complexity (27). Immunized spleen cells were isolated from Ly5.1+ mice on day 69 after initial challenge with pCMV-S and divided into two portions. Env.28-Dimer+ CD8+ T cells were sorted from half portion of spleen cells and designated as primary memory from initial challenge (Fig. 3A, population I). The remaining unsorted spleen cells (which contained 7.6 x 104 Env.28-Dimer+ CD8+ T cells) were then transferred into naive Ly5.2+ mice. Recipient mice were challenged with 1 x 107 pfu vHBs.4 as a re-challenge and sacrificed on day 8 after infection. Splenic Ly5.1+ or Ly5.1- Env.28-Dimer+ CD8+ T cells were sorted separately and designated as secondary effector from re-challenge (population II) and primary effector from re-challenge (population III), respectively (Fig. 3A). Vß usage of these populations was analyzed by flow cytometry (Fig. 3B). In addition, total RNAs from these CD8+ T cells were examined for TCR transcript diversity by spectratyping analysis (22).


Figure 3
View larger version (22K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 TCR repertoire analysis of antigen-specific CD8+ T cells after re-challenge. (A) Experimental design. Env.28-Dimer+ CD8+ T cells were sorted from a half portion of Ly5.1+ spleen cells on day 69 after challenge with pCMV-S (initial challenge). The remainder of spleen cells (containing 7.6 x 104 Env.28-Dimer+ CD8+ T cells) were transferred into naive non-irradiated Ly5.2+ mice. Recipient mice were subsequently challenged with 1 x 107 pfu vHBs.4 (re-challenge) and sacrificed on day 8 after infection. Ly5.1+ or Ly5.1- Env.28-Dimer+ CD8+ T cells were sorted separately from spleen cells. The same number (at least 3 x 104) of naive CD8+ T cells was also analyzed to verify the Gaussian distribution of the TCR repertoire. Purity of all isolated samples was at least 97% (data not shown). All procedures were carried out on individual mice. (B) TCR Vß gene usage of different memory cell populations. The values plotted are averaged from four to six mice (mean ± SEM). (C) Representative TCR Vß sub-repertoire profiles in the populations described above. Length in amino acids of the CDR3 regions, x-axis; normalized fluorescence intensity, y-axis, reflecting the number of clones using each Vß/CDR3 length combination. The 15 panel sets within Vß sub-repertoires are from an individual mouse. Results are representative of three independent experiments (n = 3–4 per experiment).

 
Compared with naive CD8+ T cells, population I predominantly used Vß2, 4 and 14, although other Vß usage was detectable (Fig. 3B). After re-challenge, the distribution of this population dramatically skewed, with Vß2, 4 and 10 comprising 75% of Vß gene usage in population II. Population III, which concurrently existed in Ly5.2+ recipients, displayed a wide range of Vß gene usage, including Vß5.1/5.2, 6, 7, 8.1/8.2, 8.3 and 11.

Spectratyping length analysis of Env.28-Dimer+ CD8+ T cell populations revealed that population I has a TCR repertoire that is skewed compared with naive CD8+ T cells in each Vß usage (Fig. 3C). The TCR repertoire of population II was further narrowly focused among the majority of Vß genes tested, indicating selective expansion of pre-existing memory cell sub-populations in the recall response (Fig. 3C, Vß4, 5.1, 6, 7, 8.1, 8.2, 8.3, 9 and 16). However, population III consisted of a broader TCR repertoire when compared with population II. With some Vß genes, a skew in secondary effector was accompanied by different profiles in primary effector (Fig. 3C, Vß4, 6, 7, 8.2, 8.3, 9 and 16). In others, multiple primary effector clones were generated, some of which overlapped with secondary effector (Fig. 3C, Vß8.1 and 13). This may indicate that primary effector can compete with identical CDR3 length clones in the established memory population. In still other cases, primary effector recovered Vß usage that was absent and/or undetectable in the pre-existing secondary effector population (Fig. 3B and C, Vß3.1), and could even contribute to overall diversity in the absence of dramatic skewing (Fig. 3C, Vß2 and 11). Since populations II and III were concurrently generated in individual mice, they can be considered together as the cumulative recall response. The overall diversity of this response was therefore restored to more closely approximate that from the initial challenge (Fig. 3B and C). The narrowly skewed TCR repertoire of secondary effector was corrected, to some extent, by diversity in the primary effector population in >75% of Vß genes analyzed (Fig. 3C).

Newly emerged primary memory cells dominate in future recall responses
We next tested for a functional difference between primary and secondary memory populations by monitoring their response to a third antigen challenge (Fig. 4A). Spleen cells from Ly5.2+ mice immunized with pCMV-S (initial challenge) were adoptively transferred into Ly5.1+ mice, which were subsequently infected with 1 x 107 pfu vHBs.4 (re-challenge). Seventy-five days after infection, spleen cells from Ly5.1+ recipient mice (containing 1.6 x 105 Env.28-Dimer+ CD8+ T cells, comprised of 85.1% Ly5.2+ secondary memory and 14.9% Ly5.1+ primary memory cells) were transferred into naive GFP+ mice (Fig. 4B and C). At the time of transfer (day 75 after re-challenge with vHBs.4), primary and secondary memory cells exhibited comparable phenotypes (CD44hi CD62Llo; Fig. 4C and Supplementary Figure 2, available at International Immunology Online) and ability to produce IFN-{gamma} upon stimulation with titrated doses of S28–39 peptides (Fig. 4D). Primary and secondary memory T cells achieved 50% maximal IFN-{gamma} production at 2.3 x 10-9 M and 4.3 x 10-9 M of S28–39 peptides, respectively. This suggested that the functional avidities of both memory populations were similar. GFP+ recipient mice were then challenged with 5 x 109 pfu Ad-HBV (third challenge), and subsequent T cell responses were analyzed.


Figure 4
View larger version (42K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Primary and secondary memory T cell dynamics in a third antigen challenge. (A) Experimental design. Spleen cells from Ly5.2+ mice immunized with pCMV-S (initial challenge) were adoptively transferred into naive non-irradiated Ly5.1+ mice. Ly5.1+ mice were then challenged intravenously with 1 x 107 pfu vHBs.4 (re-challenge), and 75 days later, spleen cells containing both Ly5.2+ secondary and Ly5.1+ primary memory cells were adoptively transferred into naive GFP+ mice. Env.28-Dimer+ CD8+ T cell populations were analyzed after a third challenge with 5 x 109 pfu Ad-HBV (third challenge). (B) Kinetics of secondary (Ly5.2+) and primary (Ly5.1+) Env.28-Dimer+ CD8+ T cells (filled and dotted boxes, respectively) in the spleen of Ly5.1+ mice. (C) Flow cytometry of spleen cells from Ly5.1+ mice 75 days after re-challenge with vHBs.4 (left). At the time of adoptive transfer, 5.6 x 107 transferred spleen cells included 1.6 x 105 Env.28-Dimer+ CD8+ T cells, consisting of more Ly5.2+ than Ly5.1+ memory cells (85.1 and 14.9%, respectively). Right, phenotype of Env.28-Dimer+ CD8+ T cells at the time of transfer. Filled and open histograms denote isotype control and markers, respectively. (D) IFN-{gamma} production by primary and secondary memory cells was examined after 5 h of stimulation with indicated doses of S28–39 peptides. The results are expressed as a percentage of the maximum response attained with saturating peptide concentrations (10-6 M). (E) Dot plots showing the distribution by origin of Env.28-Dimer+ CD8+ T cells in the liver of GFP+ mice on day 14 after Ad-HBV infection. A, primary effector (GFP+); B, secondary effector (Ly5.1+) and C, tertiary effector (Ly5.2+). (F) Number of tertiary (filled box), secondary (dotted box) and primary (open box) Env.28-Dimer+ CD8+ T cells in the liver and spleen of GFP+ mice at various time points after Ad-HBV injection. Data are indicated as mean ± SEM of three to five mice per group.

 
At the peak of memory CD8+ T cell response after Ad-HBV injection (day 14), Env.28-Dimer+ CD8+ T cells were detectable that were GFP+Ly5.1-, GFP-Ly5.1+ or GFP-Ly5.1- (Fig. 4E). This indicates that the memory T cell pool to the same antigen specificity upon a third challenge is a mixture of primary (GFP+), secondary (Ly5.1+) and tertiary (Ly5.2+) cells. Surprisingly, 14 days after Ad-HBV challenge, effector cells derived from re-challenge (Ly5.1+) outnumbered those from the initial challenge (Ly5.2+) and formed the majority of the memory CD8+ T cell pool (primary:secondary:tertiary = 19.7%:57.7%:22.6%; Fig. 4E and F). To eliminate biased cell survival of Ly5.1+ and Ly5.2+ cells as a potential explanation, we confirmed these results in a reversal of congenic backgrounds (Ly5.1+ -> Ly5.2+ -> GFP+, Supplementary Figure 3, available at International Immunology Online). Furthermore, as GFP+ Env.28-Dimer+ CD8+ T cells were observed after a third challenge (Fig. 4F and Supplementary Figure 3D, open box, available at International Immunology Online), a primary response potentially occurs upon every recall response.

Primary memory cells have better proliferative capacity and similar anti-viral activity compared with secondary memory cells
While these experiments approximate in vivo conditions, where different memory populations co-exist in the same animal, we also examined the properties of these populations when transferred independently of one another. Equal numbers of these cell populations (1.4 x 105) were adoptively transferred together with naive spleen cells (1 x 108) into recipient mice (Fig. 5A). To obtain a sufficient number of primary memory cells, primary and secondary memory cells were obtained from separate mice. Primary memory cells were transferred from Ly5.1+ mice on day 74 after pCMV-S immunization. For secondary memory cell transfer, Ly5.1+ mice were initially challenged with pCMV-S. Sixty-eight days later, 2.7 x 107 spleen cells containing 2.7 x 104 primary memory cells were adoptively transferred into Ly5.2+ mice, which were then sacrificed on day 74 after Ad-HBV infection. Ly5.1+ secondary memory cells were selectively isolated from spleen using magnetic microbeads to eliminate Ly5.2+ primary memory cells. Mice that received 1 x 108 Ly5.1+ naive spleen cells were also analyzed. One day after transfer, recipient mice were challenged with 5 x 106 pfu vHBs.4, and the proliferation and anti-viral properties of primary and secondary memory cells were analyzed on day 5 after vHBs.4 infection.

In primary memory recipients (Group 1), Env.28-Dimer+ CD8+ T cells expanded vigorously and comprised 28.9% of Ly5.1+ donor-derived CD8+ T cells after vHBs.4 infection [Group 1, Fig. 5B (upper right panel) and C]. In secondary memory recipients (Group 2), this frequency was 5.0% [Group 2, Fig. 5B (middle right panel) and C]. While this represents a significant expansion when compared with initial frequency (~1.6% of Ly5.1+ donor-derived CD8+ T cells), it is less than that observed in the primary memory population. Indeed, the number of Ly5.1+ Env.28-Dimer+ CD8+ T cells was 5.2 x 106 and 2.7 x 105 in the spleen of primary memory recipients (Group 1) and secondary memory recipients (Group 2), respectively—a difference of nearly 20-fold (P < 0.0001, Fig. 5C). Primary memory cells in naive cell recipients (Group 3) were barely detectable [Group 3, Fig. 5B (lower right panel) and C].

We also examined the anti-viral capacities of these cell populations (Fig. 5D). Compared with naive mice (Group 3), mice receiving memory cells—either primary or secondary—had a reduction in viral load of ~20-fold in their ovaries (P < 0.0001). Therefore, despite differences in proliferative capacity, both memory cell populations offered comparable protection under these experimental conditions. Nonetheless, these results, obtained under non-competitive conditions and using normalized cell numbers, support the finding that more recently generated memory cell populations have increased proliferative capacity.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Supplementary data
 References
 
We have monitored the dynamics of an antigen-specific memory T cell population in vivo in response to repeated antigen challenge. By using serial adoptive transfer of isolated spleen cells, we were able to investigate endogenous polyclonal responses that approximate the natural host response to repeated infection. Consistent with previous results, we find that a recall response can include a population of newly primed memory T cells despite the presence of pre-existing memory T cells (1012). Furthermore, this newly generated population contributes to the overall diversity of the memory T cell population (Fig. 3) and, importantly, expands more vigorously than an older population in a subsequent challenge (Figs. 4 and 5). A primary response during re-challenge therefore potentially makes a significant contribution in future antigen challenges, both qualitatively and quantitatively. This suggests that replenishing the supply of memory T cells may be important for the optimal response and maintenance of an antigen-specific memory T cell population. In addition, during the preparation of the manuscript, other groups reported a delayed conversion of secondary memory CD8+ T cells to CD62Lhi phenotype (28, 29). This was proposed to be associated with reduced or delayed homing to lymph nodes, thus resulting in less interference with priming of naive T cells to generate new primary memory cells (28).

Previous studies have suggested that T cells compete for limited resources [such as access to APCs (30, 31) or cytokines such as IL-7 or 15 (32, 33)]. Indeed, we find that a primary CD8+ T cell response occurred only following quantitative expansion of pre-existing CD8+ T cells (Fig. 2). A likely interpretation is that pre-existing antigen-specific CD8+ T cells, which have better proliferative capacity than naive T cells, expand more vigorously upon antigen re-exposure and comprise the initial response. Only when antigen load overwhelms memory CD8+ T cells are functionally competent APCs available to naive CD8+ T cells. Although generated under competition with older memory populations, primary CD8+ T cells were able to differentiate into fully functional effector, then memory, CD8+ T cells with the capacity for vigorous proliferation in a subsequent challenge (Figs 4 and 5 and Supplementary Figure 3, available at International Immunology Online).

Memory CD8+ T cells have been proposed to resemble stem cells in that both are long lived and have self-renewal capacity, allowing for the continual generation of descendent effector cells (2, 9, 34). In the memory maintenance phase, memory T cells self-renew through homeostatic proliferation in the presence of cytokines such as IL-15, IL-2 and IL-7, but independent of antigen and MHC (2, 33). A recent study also identified CD44loCD62LhiCD8+ T cells as candidate memory stem cells with the capacity to generate TCM, TEM and effector subsets while self-renewing in a graft-versus-host disease model (35). Given that we observe turnover within an antigen-specific T cell population, however, our results may indicate that memory T cells are not immortal. Rather, the memory T cell response to repetitive infection appears to be biased against older memory T cells, resulting in a population that is dynamically turned over in favor of new conscripts (Figs 4 and 5 and Supplementary Figure 3, available at International Immunology Online). This is consistent with other results that question the permanent sustainability of established memory T cells (29, 36). Collectively, these studies indicate a qualitative difference in memory T cells with repeated antigen challenge. To our knowledge, ours is the first to indicate that memory T cell populations turn over in favor of memory T cells generated during a more recent challenge (Fig. 6).


Figure 6
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Dynamic turnover model for a polyclonal memory T cell population with repeated antigen challenge. Primary memory T cells generated in the first infection (blue) expand vigorously and form the majority of effector T cells upon a second infection. Some primary effector T cells (red) are also newly generated, and the antigen-specific memory T population after clearance is comprised of both primary memory (red) and secondary memory (blue). On subsequent infection, the majority of antigen-specific T cells arise from memory T cells generated in most recent challenge (red). In addition, yet another primary response occurs (green). In this model, memory CD8+ T cell populations are heterogeneous in antigen encounter number, and dynamically turn over upon repetitive challenge.

 
Together with a quantitative contribution, we show that primary CD8+ T cells make a qualitative contribution to the memory T cell population by adding to its overall diversity. Previous studies of TCR repertoires within single antigen-specific populations that compared primary and secondary CD8+ T cells have had conflicting results. While some indicate a dramatic focusing of the secondary repertoire due to expansion of only a portion of the memory pool (3739), others have shown little or no difference between primary and secondary populations (4043). We propose that these two results are not mutually exclusive. Our experiments indicate that re-exposure to the same antigenic determinant causes the TCR repertoire of pre-existing memory T cell to skew significantly, yet overall TCR diversity is maintained, to some extent, through the addition of newly primed T cells. As a result, when thymic output continuously reconstitutes peripheral T cells, overall TCR diversity is maintained through the inclusion of these primary T cells in the memory T cell population (Fig. 3). Given that even a small gain in TCR repertoire diversity to a single viral epitope can result in higher resistance to pathogen (27, 44), this may afford the host greater versatility in controlling future infections.

The mechanism underlying this turnover remains to be determined. Recently, it was shown that the initial frequency of memory T cells can influence memory development (14). This may be an important consideration in endogenous polyclonal responses, especially when compared with TCR Tg systems in which all monoclonal T cells with the same TCR affinity are expected to proliferate equally. Indeed, our Vß usage and TCR repertoire analysis showed that memory T cell populations that consisted of several CDR3 length clones from an initial challenge yielded a predominant single CDR3 length profile in most Vß genes after re-challenge. Deletion of some clones may add to the replicative burden of those that are selected. In addition, the procedure of two-step serial adoptive transfer might further force each memory T cell to divide more vigorously than in an undisturbed setting. These factors may cause memory T cell over-division, with consequent cell exhaustion and replicative senescence (29, 36). Yet another consideration is that we exclude memory T cells in compartments other than spleen (i.e. bone marrow, lymph nodes and/or peripheral non-lymphoid tissues), thereby neglecting memory T cell sub-populations that could also be sources of descendent effector T cells (45). However, this is unlikely to explain the turnover we observe in these populations. We used at least day 75 post-infection spleen cells (day 75 and day 260), long after the initial several weeks in which most phenotypical changes occur (46). Furthermore, it has been shown that memory T cells rapidly equilibrate into lymphoid and non-lymphoid organs following parabiosis (47). Although further experimentation is required to clarify the underlying mechanism for turnover, we believe that our results faithfully reproduce polyclonal responses to repeated antigen challenge in vivo.

A major goal of vaccination is to generate long-lived protective memory T cells. To produce large numbers of memory CD8+ T cells with propagation of high-affinity clones, current vaccination is widely based on prime-boost immunization. The precise mechanisms that control T cell expansion and lifespan during repeated exposure to complex pathogens is not well understood. Nonetheless, our data suggest that the ideal prime-boost strategy in vaccination should be directed to balance the expansion of pre-existing memory T cells with the induction of primary T cells for optimal memory pool size, repertoire diversity and proliferative potential.

In conclusion, we have demonstrated that a primary CD8+ T cell response during repeated antigen challenge contributes to the TCR diversity and proliferative potential of an antigen-specific memory T cell population. These results provide new insights that primary response rejuvenates memory T cell pool after multiple antigen challenges. Our results introduce another perspective on the heterogeneity of memory T cells: the number of antigen encounters.


    Supplementary data
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Supplementary data
 References
 
Supplementary Figures 1–3 are available at International Immunology Online.


    Acknowledgements
 
We thank Yasuhiko Koezuka (KIRIN), Steven A. Porcelli (Albert Einstein College of Medicine) and Masahiro Kitabatake for helpful discussion and suggestion; Ken Dower for critical reading of the manuscript and Shun-ichi Fujita, Shinji Ichihara, Saori Takao, Tomohiro Horiya, Junko Kurachi, Masako Sakashita and Yasuko Uehara for animal care and technical assistance. This work was supported in part by Solution Oriented Research for Science (SORST), the Japan Science and Technology Corporation (JST) and a grant from the Ministry of Education, Culture, Sports, Science and Technology of Japan (MEXT).


    Abbreviations
 
APC, antigen-presenting cell
CDR3, complementarity determining region 3
HBV, hepatitis B virus
IHL, intrahepatic lymphocyte
pfu, plaque-forming unit
TCM, central memory T cell
TEM, effector memory T cell
Tg, transgenic
TNF, tumor necrosis factor

    Notes
 
* These authors contributed equally to this study. Back

Transmitting editor: K. Okumura

Received 30 September 2006, accepted 31 October 2006.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Supplementary data
 References
 

  1. Ahmed R and Gray D. (1996) Immunological memory and protective immunity: understanding their relation. Science 272:54.[Abstract]
  2. Kaech SM, Wherry EJ, Ahmed R. (2002) Effector and memory T-cell differentiation: implications for vaccine development. Nat. Rev. Immunol. 2:251.[CrossRef][Web of Science][Medline]
  3. Veiga-Fernandes H, Walter U, Bourgeois C, McLean A, Rocha B. (2000) Response of naive and memory CD8+ T cells to antigen stimulation in vivo. Nat. Immunol. 1:47.[CrossRef][Web of Science][Medline]
  4. Goldrath AW and Bevan MJ. (1999) Selecting and maintaining a diverse T-cell repertoire. Nature 402:255.[CrossRef][Medline]
  5. Freitas AA and Rocha B. (1999) Peripheral T cell survival. Curr. Opin. Immunol. 11:152.[CrossRef][Web of Science][Medline]
  6. Mullbacher A. (1994) The long-term maintenance of cytotoxic T cell memory does not require persistence of antigen. J. Exp. Med. 179:317.[Abstract/Free Full Text]
  7. Murali-Krishna K, Lau LL, Sambhara S, Lemonnier F, Altman J, Ahmed R. (1999) Persistence of memory CD8 T cells in MHC class I-deficient mice. Science 286:1377.[Abstract/Free Full Text]
  8. Swain SL, Hu H, Huston G. (1999) Class II-independent generation of CD4 memory T cells from effectors. Science 286:1381.[Abstract/Free Full Text]
  9. Fearon DT, Manders P, Wagner SD. (2001) Arrested differentiation, the self-renewing memory lymphocyte, and vaccination. Science 293:248.[Abstract/Free Full Text]
  10. Butz EA and Bevan MJ. (1998) Massive expansion of antigen-specific CD8+ T cells during an acute virus infection. Immunity 8:167.[CrossRef][Web of Science][Medline]
  11. Turner SJ, Cross R, Xie W, Doherty PC. (2001) Concurrent naive and memory CD8(+) T cell responses to an influenza A virus. J. Immunol. 167:2753.[Abstract/Free Full Text]
  12. Badovinac VP, Messingham KA N, Hamilton SE, Harty JT. (2003) Regulation of CD8+ T cells undergoing primary and secondary responses to infection in the same host. J. Immunol. 170:4933.[Abstract/Free Full Text]
  13. Wherry E j., Teichgraber V, Becker TC, Masopust D, et al. (2003) Lineage relationship and protective immunity of memory CD8 T cell subsets. Nat. Immunol. 4:225.[CrossRef][Web of Science][Medline]
  14. Marzo AL, Klonowski KD, Le Bon A, Borrow P, Tough DF, Lefrancois L. (2005) Initial T cell frequency dictates memory CD8+ T cell lineage commitment. Nat. Immunol. 6:793.[CrossRef][Web of Science][Medline]
  15. Sallusto F, Lenig D, Forster R, Lipp M, Lanzavecchia A. (1999) Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 401:708.[CrossRef][Medline]
  16. Ando K, Moriyama T, Guidotti LG, et al. (1993) Mechanisms of class I restricted immunopathology. A transgenic mouse model of fulminant hepatitis. J. Exp. Med. 178:1541.[Abstract/Free Full Text]
  17. Davis HL, Schirmbeck R, Reimann J, Whalen RG. (1995) DNA-mediated immunization in mice induces a potent MHC class I-restricted cytotoxic T lymphocyte response to the hepatitis B envelope protein. Hum. Gene Ther. 6:1447.[Web of Science][Medline]
  18. Smith GL, Mackett M, Moss B. (1983) Infectious vaccinia virus recombinants that express hepatitis B virus surface antigen. Nature 302:490.[CrossRef][Medline]
  19. Chakrabarti S, Brechling K, Moss B. (1985) Vaccinia virus expression vector: coexpression of beta-galactosidase provides visual screening of recombinant virus plaques. Mol. Cell. Biol. 5:3403.[Abstract/Free Full Text]
  20. Sprinzl MF, Oberwinkler H, Schaller H, Protzer U. (2001) Transfer of hepatitis B virus genome by adenovirus vectors into cultured cells and mice: crossing the species barrier. J. Virol. 75:5108.[Abstract/Free Full Text]
  21. Kakimi K, Isogawa M, Chung J, Sette A, Chisari FV. (2002) Immunogenicity and tolerogenicity of hepatitis B virus structural and nonstructural proteins: implications for immunotherapy of persistent viral infections. J. Virol. 76:8609.[Abstract/Free Full Text]
  22. Pannetier C, Cochet M, Darche S, Casrouge A, Zoller M, Kourilsky P. (1993) The sizes of the CDR3 hypervariable regions of the murine T-cell receptor beta chains vary as a function of the recombined germ-line segments. Proc. Natl Acad. Sci. 90:4319.[Abstract/Free Full Text]
  23. Ramshaw IA and Ramsay AJ. (2000) The prime-boost strategy: exciting prospects for improved vaccination. Immunol. Today 21:163.[CrossRef][Web of Science][Medline]
  24. Moore AC and Hill AV S. (2004) Progress in DNA-based heterologous prime-boost immunization strategies for malaria. Immunol. Rev. 199:126.[CrossRef][Web of Science][Medline]
  25. Isogawa M, Kakimi K, Kamamoto H, Protzer U, Chisari F V. (2005) Differential dynamics of the peripheral and intrahepatic cytotoxic T lymphocyte response to hepatitis B surface antigen. Virology 333:293.[CrossRef][Web of Science][Medline]
  26. Kaech SM and Ahmed R. (2001) Memory CD8+ T cell differentiation: initial antigen encounter triggers a developmental program in naive cells. Nat. Immunol. 2:415.[Web of Science][Medline]
  27. Nikolich-Zugich J, Slifka MK, Messaoudi I. (2004) The many important facets of T-cell repertoire diversity. Nat. Rev. Immunol. 4:123.[CrossRef][Web of Science][Medline]
  28. Jabbari A and Harty JT. (2006) Secondary memory CD8+ T cells are more protective but slower to acquire a central-memory phenotype. J. Exp. Med. 203:919.[Abstract/Free Full Text]
  29. Masopust D, Ha S-J, Vezys V, Ahmed R. (2006) Stimulation history dictates memory CD8 T cell phenotype: implications for prime-boost vaccination. J. Immunol. 177:831.[Abstract/Free Full Text]
  30. Kedl RM, Rees WA, Hildeman DA, et al. (2000) T cells compete for access to antigen-bearing antigen-presenting cells. J. Exp. Med. 192:1105.[Abstract/Free Full Text]
  31. Kedl RM, Kappler JW, Marrack P. (2003) Epitope dominance, competition and T cell affinity maturation. Curr. Opin. Immunol. 15:120.[CrossRef][Web of Science][Medline]
  32. Jameson SC. (2002) Maintaining the norm: T-cell homeostasis. Nat. Rev. Immunol. 2:547.[Web of Science][Medline]
  33. Schluns KS and Lefrancois L. (2003) Cytokine control of memory T-cell development and survival. Nat. Rev. Immunol. 3:269.[CrossRef][Web of Science][Medline]
  34. Lanzavecchia A and Sallusto F. (2002) Progressive differentiation and selection of the fittest in the immune response. Nat. Rev. Immunol. 2:982.[CrossRef][Web of Science][Medline]
  35. Zhang Y, Joe G, Hexner E, Zhu J, Emerson SG. (2005) Host-reactive CD8+ memory stem cells in graft-versus-host disease. Nat. Med. 11:1299.[CrossRef][Web of Science][Medline]
  36. Voehringer D, Blaser C, Brawand P, Raulet DH, Hanke T, Pircher H. (2001) Viral infections induce abundant numbers of senescent CD8 T cells. J. Immunol. 167:4838.[Abstract/Free Full Text]
  37. Bachmann MF, Speiser DE, Ohashi PS. (1997) Functional management of an antiviral cytotoxic T-cell response. J. Virol. 71:5764.[Abstract]
  38. Busch DH and Pamer EG. (1999) T cell affinity maturation by selective expansion during infection. J. Exp. Med. 189:701.[Abstract/Free Full Text]
  39. Savage PA, Boniface JJ, Davis MM. (1999) A kinetic basis for T cell receptor repertoire selection during an immune response. Immunity 10:485.[CrossRef][Web of Science][Medline]
  40. Sourdive DJ D, Murali-Krishna K, Altman JD, et al. (1998) Conserved T cell receptor repertoire in primary and memory CD8 T cell responses to an acute viral infection. J. Exp. Med. 188:71.[Abstract/Free Full Text]
  41. Maryanski JL, Jongeneel CV, Bucher P, Casanova J-L, Walker PR. (1996) Single-cell PCR analysis of TCR repertoires selected by antigen in vivo: a high magnitude CD8 response is comprised of very few clones. Immunity 4:47.[Medline]
  42. Levraud J-P, Pannetier C, Langlade-Demoyen P, Brichard V, Kourilsky P. (1996) Recurrent T cell receptor rearrangements in the cytotoxic T lymphocyte response in vivo against the p815 murine tumor. J. Exp. Med. 183:439.[Abstract/Free Full Text]
  43. Vijh S and Pamer EG. (1997) Immunodominant and subdominant CTL responses to Listeria monocytogenes infection. J. Immunol. 158:3366.[Abstract]
  44. Messaoudi I, Guevara Patino JA, Dyall R, LeMaoult J, Nikolich-Zugich J. (2002) Direct link between mhc polymorphism, T cell avidity, and diversity in immune defense. Science 298:1797.[Abstract/Free Full Text]
  45. Mazo IB, Honczarenko M, Leung H, et al. (2005) Bone marrow is a major reservoir and site of recruitment for central memory CD8+ T cells. Immunity 22:259.[CrossRef][Web of Science][Medline]
  46. Masopust D, Kaech SM, Wherry EJ, Ahmed R. (2004) The role of programming in memory T-cell development. Curr. Opin. Immunol. 16:217.[CrossRef][Web of Science][Medline]
  47. Klonowski KD, Williams KJ, Marzo AL, Blair DA, Lingenheld EG, Lefrancois L. (2004) Dynamics of blood-borne CD8 memory T cell migration in vivo. Immunity 20:551.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
19/1/105    most recent
dxl127v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Kurachi, M.
Right arrow Articles by Matsushima, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kurachi, M.
Right arrow Articles by Matsushima, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?