International Immunology Advance Access originally published online on July 28, 2006
International Immunology 2006 18(9):1385-1396; doi:10.1093/intimm/dxl072
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Identification of disulfide bonds in the Ig-
/Ig-ß component of the B cell antigen receptor using the Drosophila S2 cell reconstitution system
Max Planck-Institut für Immunbiologie and University of Freiburg, Biologie III Stübeweg 51, 79108 Freiburg, Germany
Correspondence to: W. W. A. Schamel; E-mail: schamel{at}immunbio.mpg.de
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Structural information about immune receptor complexes is important for understanding signal transduction mechanisms. We have used the Drosophila S2 cell reconstitution system for identification of disulfide bonds within and between CD79a (Ig-
) and CD79b (Ig-ß), the heterodimeric signal transducing element of the B cell antigen receptor (BCR). Cysteines 113 and 135 of Ig- and Ig-ß, respectively, form the intermolecular disulfide bridge stabilizing the Ig-/Ig-ß heterodimer in both S2 cells and the B cell line J558L. Furthermore, using transfected S2 cells, two putative intramolecular disulfide bonds in the Ig-like domain of Ig-ß were identified. Ig-ßC65 and Ig-ßC120 form the canonical Ig fold disulfide bond. In addition, Ig-ßC43 and Ig-ßC124 also bind covalently. Individual cysteine to serine mutations in Ig- had no influence on membrane-bound Ig (mIg)-M expression on the surface of S2 cells. In contrast, mIgM expression on the surface of B cells expressing Ig-C113S was reduced, indicating that this intermolecular bond is prerequisite for efficient IgM-BCR formation. Our data also suggest that the Ig-/Ig-ß heterodimer can assemble into oligomers.
Keywords: BCR assembly, cysteine mutants, Ig-/Ig-ß heterodimer, Ig fold, surface mIgM expression
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Humoral immunity is mediated by the activity of functional B and T lymphocytes. These cells feature multi-chain immune recognition receptors (MIRRs) (1) which recognize antigens and, by binding to them, transduce signals through the cell membrane. Subsequently, signaling molecules within the cell become activated, leading to such diverse outcomes as differentiation, proliferation or cell death. Elucidation of the molecular structures of these MIRRs could provide clues as to the mechanisms by which the signals are transduced through the membrane, but as of yet, only individual pieces of the structural puzzle have been uncovered.
The MIRR on B cells is the B cell antigen receptor (BCR), which is probably organized as an oligomeric structure on the surface of B cells (2). Its basic unit, the monomeric BCR, comprises a complex of membrane-bound Ig (mIg), consisting of two covalently linked heavy chains (HCs) and two light chains (LCs), non-covalently associated with a signal transducing element, the disulfide-linked CD79a/CD79b (Ig-/Ig-ß) heterodimer (3). Ig- and Ig-ß both feature an extracellular Ig domain, a membrane proximal spacer region, a transmembrane (TM) domain and a cytoplasmic tail (4–6). The cytoplasmic region possesses an immunoreceptor tyrosine-based activation motif (7) which interacts with intracellular signaling molecules. The three dimensional structures of Ig- and Ig-ß are not yet available.
The Ig fold consists of a sandwich of two beta sheets, with their hydrophobic side chains pointing inwards, often stabilized by a single disulfide bond (8). Normally only one disulfide bond stabilizes the Ig fold; however, there are some proteins with Ig domains which do not have this disulfide bond at all, and others featuring several (9–11). Chicken Ig- contains five extracellular cysteines, three of which are conserved through mouse and man (M. Ratcliffe, personal communication). In murine Ig-, they are C50, C101 and C113 (Fig. 2A). There is also one conserved cysteine, C190, in the cytoplasmic tail of Ig-. Although chicken Ig-ß has only four extracellular cysteines, human and murine Ig-ß have five. Here we are studying murine Ig-ß cysteines C43, C65, C120, C124 and C135 (12). Speculations as to disulfide bonding within the Ig-/Ig-ß heterodimer have been made based on amino acid alignments of these proteins with one another (13, 14) or with other Ig superfamily members (4, 12) and structural modeling (15). Disulfide bonding in the extracellular domain of Ig- is reliably predicted, as Ig- has only three cysteines and alignments indicate that the relative positions of C50 and C101 fit those of Ig fold disulfide cysteines (4), leaving C113 near the membrane proximal spacer region (Fig. 2A) for intermolecular pairing with Ig-ß (14). Potential intrachain bonding within Ig-ß has been suggested between C65 and C120, leaving C124 and C135 for binding to Ig-, and neglecting C43 (12). Another prediction was that C65 and C120 form the typical Ig domain disulfide bridge and that because molecular modeling shows C43 and C124 close to one another, they may also bind covalently (14, 15). This would leave C135 to bind to Ig-. The National Center for Biotechnology Information database GenBank lists a further possible disulfide bond between C43 and C135 (P15530). To date, no experimental evidence has been shown to refute or support these hypotheses.
|
BCR subunits must fold and assemble in an ordered process to form a complete receptor competent to overcome endoplasmic reticulum (ER) retention mechanisms (16–20). In B cells, excess Ig-ß chains assemble into disulfide-bonded Ig-ß/Ig-ß homodimers that are retained in the ER and degraded, since only the Ig-
/Ig-ß heterodimer can assemble with the mIg molecule (16).
In order to study the function of individual disulfide bonds, it is helpful to express cysteine mutants of the protein of interest in a system that precludes interference from the wild-type (wt) protein. Cell lines lacking single proteins of interest that can be reconstituted with a mutant version are useful tools. Unfortunately, a B cell line lacking Ig-ß does not exist, rendering it impossible to study Ig-ß mutants in the absence of wt Ig-ß. Many foreign proteins can be simultaneously expressed in Drosophila S2 cells (21, 22). They have been used for the expression of competent antibody molecules (23) and, more importantly, for reconstitution of the complete BCR (18, 21, 24). We expressed soluble wt and mutant Ig- and Ig-ß in S2 cells in order to determine the cysteines that are responsible for Ig-/Ig-ß heterodimer stabilization and the pairs of cysteines forming disulfide bridges in the Ig domain of Ig-ß. We also expressed these proteins in the context of the reconstituted BCR in S2 cells to study their influence on IgM transport to the cell surface. In addition, we confirmed the Ig- and Ig-ß cysteines participating in the Ig-/Ig-ß intermolecular disulfide bond with Ig-ß in an Ig--negative B cell line, J558L (17, 25, 26). We show that this bond is necessary for efficient expression of the BCR on the B cell surface.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Generation of expression vectors
All expression vectors are based on pRmHa-3 (pD) containing an inducible metallothionein promoter which is active in Drosophila cells (27, 28). The following plasmids have been described previously: pDflmb-1 (21, 29), pDHAB29 (21), pDGFP (21), pDSLP-65 (21, 30), pD
1 (24), pDµm (24), pDSyk (21).
In order to replace the TM domains of Ig- and Ig-ß with basic leucine zipper (bzip) and acidic leucine zipper (azip) for expression of soluble heterodimeric proteins, the following strategy was employed. pDCD3
basic and pDCD3
acid vectors were a generous gift from K. Karjalainen, Belinzona Institute of Immunology, Switzerland. bzip DNA was amplified from the CD3basic vector such that BssHII and HpaI sites were introduced 5' and 3' to the zipper sequence, respectively, using the following primers for PCR—bzipf: AGTCGCGCGCACGCT CAGTTGAAAAAGAAATTGCAAG and bzipr: GGAGTTAACCTGGGCGAGTTTCTTCTTG. The same was done with the azip DNA from CD3acid with the following primers—azipf: GTGTGCGCGCACGCTCAGCTCGAAAAAGAG and azipr: GTCGTTAACCTGAGCC AGTTCCTTTTC. Basic zipper BssHII–HpaI and acidic zipper BssHII–HpaI fragments were isolated after digestion of the above-mentioned PCR products with BssHII and HpaI.
For the generation of pDflmb-1bzip, Quick Change site-directed mutagenesis (Stratagene, Amsterdam, Netherlands) was used to introduce a BssHII site into pDflmb-1 (21, 29) using the following primers—mb1BssHIIf: GAAGGTACCAAGAACCGCGCGCTCACAGCAGAAGGGATCA and mb1BssHIIr: CTTCCATGGTTCTTGGCGCGCGAGTGTCGTCTTCC CTAGT. The HpaI site was introduced using the following primers—mb1HpaIf: GTGCCAGGGACGCTGCTG GTTAACAGGAAACGGTGGCAAAATG and mb1HpaIr: CACGGTCCCTGCGACGAC CAATTGTCCTTTGCCACCGTTTTAC. pDflmb-1BssHII/HpaI was cut with BssHII and HpaI; bzip BssHII–HpaI was inserted to create pDflmb-1bzip.
Cysteine mutants of pDflmb-1bzip and pDflmb-1 were generated using pDflmb-1bzip as a template for mutagenesis and using the following primers—pDazC113S was made using mb1C113Sf: CAACATATTAAAACGCTCCAGTGGTACTTACCTCCGCGTG and mb1C113Sr: CACGCGGAGGTAAGTACCACTGGAGCGTTTTAATATGTTG and pDazC190S was made using mb1C190Sf: GGGCCTGAACCTTGATGACAGTTCTATGTATGAGGAC and mb1C190Sr: GTCCTCATACATAGAACTGTCATCAAGGTTCAGGCCC.
pDHAB29azip, a vector to express the soluble secreted version of Ig-ß, was created using the same strategy as for pDflmb-1bzip. Quick Change site-directed mutagenesis was used to introduce a BssHII site into pDHAB29 (21) using the following primers—B29BssHIIf: CACACTGAAAGATGGCGCGCTCTTGATCCAGACCCTCCTC and B29BssHIIr: GTGTGACTTTCTACCGCGCGAGAACTAGGTCTGGGAGGAG. HpaI sites were introduced into pDHAB29BssHII using the following primers—B29HpaIf: GCCCATCTTCCTGCT AGTTAACAAGGATGACGGCAAG and B29HpaIr: CGGGTAGAAGGACGATCAATT GTTCCTACTGCCGTTC. The resulting vector was cut with BssHII and HpaI and the acidic zipper BssHII–HpaI fragment was inserted to create pDHAB29azip.
Using pDHAB29azip and pDHAB29 as template, the following primers were used to generate various Cys mutants—pDbzC43S was made using B29C43Sf: CCAAGGAAGCCCTAGTTCCCAGATCTGGCAG CAC and B29C43Sr: GTGCTGCCAGATCTGGGAACTAGGGCTTCCTTGG; pDbzC65S was made using B29C65Sf: CCATGGTGAAGTTTCACTCCTACACAAACCACTC and B29C65Sr: GAGTGGTTTGTGTAGGAGTGAAACTTCACCATGG; pDbzC120S was made using B29C120Sf: GGATAATGGTATCTACTTCTCCAAGCAGAAATGTGACAG and B29C120Sr: CTGTCACATTTCTGCTTGGAGAAGTAGATACCATTATCC; pDbzC124S was made using B29C124Sf: CTTCTGCAAGCAGAAAAGTGACAGCGCCAACCATAATG and B29C124Sr: CATTATGGTTGGCGCTGTCACTTTTCTGCTTGCAGAAG and pDbzC135S was made using B29C135Sf: CATAATGTCACCGACAGCTCTGGCACGGAACTTCTAGTC and B29C135Sr: GACT AGAAGTTCCGTGCCAGAGCTGTCGGTGACATTATG.
For the generation of the mammalian expression vectors pABES-puro-Nflmb-1 and pABES-puro-Nflmb-1C113S, the pABES vector containing a puromycin cassette, pABES-puro2000II, was cut with SalI, blunt ended with Pfu and then cut with EcoRI. cDNAs cut from pDflmb-1 or pDflmb-1C113S vectors were then cloned in.
To generate retroviral vectors for the expression of Ig-ß, the oligonucleotides AATTCCCGGGTACCATGGTTAATTAAG and TCGACTTAATTAACCATGGTACCCGGG were phosphorylated and annealed to make a linker containing a PacI site. The linker was inserted into EcoRI- and SalI-digested retrovirus vector pMIG to generate a new vector pM3. The coding sequences of HAB29 and HAB29C135S were cut from pDHAB29 and pDHAB29C135S, respectively, with EcoRI and PacI, and inserted into the EcoRI-/PacI-digested pM3 vector to yield pM HAB29 and pM HAB29C135S.
All open reading frames of the expression vectors used in this study were sequenced.
Cell lines
Drosophila S2 cells were a generous gift from K. Karjalainen. S2 cells were grown in Drosophila S2 medium (Life Technologies Inc., Karlsruhe, Germany) containing 5–10% FCS at 27°C with atmospheric CO2 levels.
J558L (25, 26) and J558Lµm15-25 (17, 29) cells were grown in RPMI 1640 complete medium containing 5% FCS, 50 U ml–1 penicillin, 50 mg ml–1 streptomycin, 2 mM L-glutamine and 50 mM 2-mercaptoethanol. J558Lµmflmb-1 and J558Lµmflmb-1C113S were grown in RPMI complete medium containing 40 µg ml–1 puromycin (Sigma–Aldrich, Deisenhofen, Germany).
Transfections and preparation of lysates
The protocol for transient transfection of Drosophila S2 cells has been described elsewhere (21, 24), but was modified slightly. In brief, cells were plated at a density of 7 x 105 cells ml–1 in six-well plates and grown overnight. Plasmids were transfected as described with CellFectin Reagent (Life Technologies Inc.) and incubated for 18 h. Total plasmid amounts were equalized with an empty vector. DNA-containing medium was then replaced and cells were left to recover for 21–31 h. For experiments shown in Figs 2, 3 and 4, where it was important to concentrate proteins secreted from the cell, 1.5 ml medium was removed before induction; otherwise the cells were left in 3 ml medium. The cells were induced with 1 mM CuSO4 for 24 or 48 h. For the experiment shown in Fig. 1(B), cells were induced for 6 h, washed and then harvested 13 h later. The supernatant was harvested directly, aliquots were mixed with 5x reducing (R) or non-reducing (NR) Laemmli buffer (31) and boiled for 5 min. Cells were washed once with PBS and lysed for 20 min on ice at a density of 2 x 104 cells µl–1 in lysis buffer containing 50 mM Tris–HCl pH 8.0, 140 mM NaCl, 0.5 mM EDTA, 1 mM Na3VO4, 10% (v/v) glycerol, a protease inhibitor cocktail (Sigma–Aldrich) and 1% (v/v) Triton X-100 (Figs 2 and 4), 1% (w/v) Digitonin (Fig. 1B) or 0.3% Brij96 (Fig. 6). Alternatively, the protease inhibitors 1 mM phenylmethylsulphonylfluoride (PMSF), 0.5 mM iodoacetamide, 1 mM NaF, 10 mg ml–1 Aprotinin (Roche Diagnostics Corp., Indianapolis, IN, USA) and 10 mg ml–1 Leupeptin (Roche Diagnostics Corp.) were used. Lysates, centrifuged for 15 min at 13 000 rpm, and supernatants were mixed with 5x R or NR Laemmli buffer and boiled for 5 min.
|
|
|
|
The murine B cells J558Lµm15-25 were transfected as previously described (32). Briefly, 107 cells were transfected by electroporation of 10–20 µg linearized DNA, and then re-suspended and plated out 1 ml per well into 48-well plates. Transfectants were selected in RPMI complete medium containing 40 µg ml–1 puromycin (Sigma–Aldrich).
For transduction, the retroviral vectors pM HAB29 and pM HAB29C135S were transduced into Phoenix packaging cells with GeneJuice (Novagen, Schwalbach, Germany) to generate the appropriate retroviruses. J558Lµmflmb-1 cells (2 x 105) were infected with retrovirus for 3 h at 37°C by centrifugation in the presence of 10 mg ml–1 Polybrane (Chemicon, Hofheim, Germany). Cells were maintained as stable lines.
Immunopurification and endoglyosidase H treatment
The Ig-/Ig-ß heterodimer was immunopurified from cellular lysates using 2 µg anti-flag antibody (M2, Sigma–Aldrich) coupled to protein G sepharose beads (Amersham Pharmacia Biotech, Freiburg, Germany). Beads were subsequently washed twice and either treated with endoglycosidase H (Endo-H) (Fig. 1B) or washed four times (Fig. 6B), re-suspended in NR Laemmli buffer and boiled for 5 min.
For Endo-H treatment, immunopurified proteins bound to sepharose beads were washed twice with 600 µl deglycosylation buffer (50 mM NaAc, 0.05% SDS, 50 mM ß-mercaptoethanol, pH 5.5) and re-suspended in 60 µl deglycosylation buffer. Two equal aliquots were boiled for 3 min and protease inhibitors were then added to a final concentration of 1 mM PMSF, 10 mg ml–1 Aprotinin and 10 mg ml–1 Leupeptin. Endo-H (5 mU per sample) (Roche Diagnostics, Mannheim, Germany) was added to one aliquot of each sample and all samples were incubated at 37°C for 17 h.
Western blotting
Lysates were separated by 10% SDS-PAGE under R or NR conditions; exceptions were in Figs 1(B) and 4(C) which were 13 and 8% SDS-PAGE, respectively, in which the acrylamide:bisacrylamide ratio was altered to 1:118 (33). Consequently, proteins were transferred by semi-dry blotting to nitrocellulose (Amersham Pharmacia Biotech) or polyvinylidene difluoride membranes (Millipore, Eschborn, Germany) and analyzed by immunoblotting using the enhanced chemiluminescence detection system (ECL, Amersham Pharmacia Biotech) as previously described (32). Dilutions of primary antibodies used for western blotting were as follows: 1:500 anti-flag (M2, Sigma–Aldrich) and 1:1000 anti-HA (rat, Roche Diagnostics Corp.). The supernatant of a hybridoma secreting monoclonal anti-Ig-ß antibody, generated in our laboratory, was used undiluted (Fig. 6C). Anti-Ig- rabbit polyclonal antibody was a generous gift from J. Cambier, University of Colorado Health Sciences Center, Denver, CO, USA. HRP-conjugated goat anti-mouse, 1:10 000 (Perbio, Bonn, Germany), HRP-conjugated goat anti-rabbit IgG, 1:3000 (Perbio) and HRP-conjugated goat anti-rat, 1:5000 (Pierce, Bonn, Germany) were the dilutions of secondary antibodies used.
Coomassie staining
Supernatant fractions were separated on 10% SDS-PAGE gels and Coomassie staining was performed under standard conditions (Fig. 4B).
Flow cytometry
S2 cells were stained with goat anti-mouse IgM–Cy5 1:90 (Dianova, Hamburg, Germany) and analyzed with a FACSCalibur (Becton Dickinson, Franklin Lakes, NJ, USA) and CellQuestTM software. Dead cells were excluded by propidium iodide staining (1 µg ml–1, Sigma–Aldrich). Cells transfected with empty pD vector served as a negative control.
J558Lµm clones were stained with goat anti-mouse IgM–FITC 1:100 (BD PharMingen, Heidelberg, Germany) and analyzed as above. Untransfected cells served as a negative control.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Expression of Ig-
and Ig-ß in Drosophila S2 cellsWe chose Drosophila S2 cells to study disulfide bonding in Ig-
and Ig-ß, since these cells do not contain any component of the BCR and can be transfected with several vectors simultaneously. Ig- and Ig-ß were co-expressed with mIgM [membrane-bound µ heavy chain (µm) HC and LC] either individually (Fig. 1A, lanes 2 and 3) or simultaneously (lanes 4). Enhanced green fluorescent protein (EGFP) was also expressed to monitor transfection efficiency, which was 
30% (see below). Proteins of total cellular lysates were separated either by NR (upper panels) or R (lower panels) SDS-PAGE. Immunoblotting against flagIg- under NR conditions showed two bands containing Ig- at 74 kDa, possibly Ig-/Ig- homodimers in different glycosylation states, in addition to several Ig- forms >145 kDa (lane 2). Further, some monomeric Ig- was faintly discernible at 32–35 kDa. When Ig- was co-transfected with Ig-ß, a similar pattern appeared (lane 4). Since only monomers of Ig- were visible in the R blot (Fig. 1A, bottom panel), the larger molecular weight bands (upper panel) were the result of disulfide-bonded Ig- aggregates. Two Ig- monomer bands appeared when Ig- was co-expressed with Ig-ß (lane 4). Endo-H treatment demonstrated that these bands were differentially glycosylated Ig- proteins (Fig. 1B); the upper band corresponds to the immature, Endo-H sensitive, ER-retained form (lanes 1 and 3), and the lower band to the Endo-H resistant mature surface form of Ig- (lanes 3 and 4). In Drosophila S2 cells, the mannose-rich immature form is larger than the mature form, since most mannose residues are removed in the mature form without the subsequent addition of complex glycosylation.
In Fig. 1(B) lane 3, the ratio of mature to immature Ig- is greater than in Fig. 1(A) lane 4 since in this experiment, protein expression was induced for 6 h and the cells were incubated for a further 13 h before harvesting rather than an induction for 24 h without a chase. As a result, most of the Ig- was present in its mature, membrane-bound form. Returning to Fig. 1(A), the immunoblot against HAIg-ß showed monomeric bands of Ig-ß 40 kDa (Fig. 1A, lanes 3 and 4) attributed to differential glycosylation, and two bands corresponding to the Ig-ß/Ig-ß homodimer (lanes 3 and 4) (16, 24). Since the Ig-/Ig-ß heterodimer is nearly the same size as Ig-/Ig- and Ig-ß/Ig-ß homodimers, we could not unequivocally identify the heterodimer. Co-expression of Ig- and Ig-ß lead to an increased amount of both proteins in the transfectants (lanes 4) compared with those individually expressed (lanes 2 and 3). This could indirectly indicate that the Ig-/Ig-ß heterodimer is more stable than the respective homodimers.
Cysteine residues in Ig- and Ig-ß are conserved
All cysteine residues in Ig- and Ig-ß are conserved between mouse and man. Murine Ig- contains three extracellular cysteines, C50, C101 and C113 (Fig. 2A). There is also one cysteine, C190, in its cytoplasmic tail. Murine Ig-ß has five extracellular cysteines, C43, C65, C120, C124 and C135 (Fig. 2A). Experiments to determine which of these cysteines form the intermolecular and intramolecular disulfide bonds had not been performed; thus, we decided to test which cysteines are responsible for the disulfide bond between Ig- and Ig-ß (intermolecular) and to determine the pairing of cysteines within Ig-ß (intramolecular). To elucidate disulfide bond pairing, cysteine mutants of Ig- and Ig-ß were generated. For detection purposes, Ig- was flag tagged at the N-terminus and Ig-ß carried an N-terminal HA tag (Fig. 2A).
Expression of soluble Ig- and Ig-ß proteins in Drosophila S2 cells
In human B cells, excess Ig-ß chains assemble into Ig-ß/Ig-ß homodimers that are retained in the ER (16). In order to study only fully assembled Ig-/Ig-ß heterodimers without contamination by homodimers trapped in the ER, we altered our constructs such that soluble secreted proteins could be expressed. We replaced the DNA encoding the TM regions of tagged Ig- and Ig-ß with that encoding the bzip and azip, respectively (Fig. 2A). For expression of soluble Ig- and Ig-ß, S2 cells were transiently transfected with Ig- and Ig-ß zipper constructs, either individually (Fig. 2B, left and right panels, lanes 2–5) or simultaneously (lanes 6 and 7). Both lysate and supernatant fractions were separated by SDS-PAGE and subject to western blotting. When Ig- was expressed alone, it was only found in the lysate fraction (left panel, lane 2). The R blot showed one Ig- band attributed to the immature, ER-retained form. When Ig- and Ig-ß were co-expressed, they were efficiently secreted into the supernatant fraction as a disulfide-linked heterodimer at 90 kDa (lane 7). Thus, hardly any protein remained inside the cells (lane 6). Under R conditions, co-expressed Ig- was only detected in its mature surface form (left panel, lane 7). The NR membrane developed against Ig-ß confirmed the above-mentioned heterodimer band (right panel, lane 7). It also showed prominent secretion of Ig-ß alone, both as a disulfide-bonded homodimer and as a monomer that could have been a non-covalently linked homodimer (lane 5). Once again, larger complexes containing Ig- and Ig-ß are discernable (lanes 7); however, in this case, these complexes are not ER-retained aggregates. In conclusion, using the soluble forms of Ig- and Ig-ß allowed us to unequivocally identify the Ig-/Ig-ß heterodimer, as well as higher oligomeric complexes containing these proteins. Thus, in the following experiments, we also used the supernatants of transfectants expressing soluble Ig- and Ig-ß.
Misallocated Ig- cysteine 190 forms aberrant disulfide bridges
Complexes larger than dimers were evident when Ig- and Ig-ß were co-expressed (Fig. 2). In the soluble version of Ig-, the cytoplasmic tail is misallocated to the oxidizing environment of the ER lumen. In order to see whether Ig-C190 forms disulfide bonds upon exposure to the ER lumen, vectors encoding soluble versions of Ig- or Ig-C190S and Ig-ß were transiently transfected into S2 cells (Fig. 3). As already shown in Fig. 2(B), when Ig- and Ig-ß were expressed together, almost no protein was detected in the lysate (left and right panels, lanes 1). This also held true for co-expression of Ig-C190S and Ig-ß (lanes 3). The supernatant fractions of wt co-transfectants gave bands at 74, 110 and 145 kDa (lanes 2) in both flagIg- and HAIg-ß blots. Since Ig- is 35 kDa and Ig-ß is 40 kDa, it is likely that these bands correspond to the Ig-/Ig-ß heterodimer, an Ig-/Ig-/Ig-ß trimer and an Ig-/Ig-ß/Ig-/Ig-ß tetramer. When Ig-C190 was mutated, the Ig-/Ig-ß heterodimer was still detected, but higher complexes were no longer found (lanes 4). Thus, we conclude that this cysteine was necessary for the formation of Ig-/Ig-ß oligomers.
Identification of the inter- and intramolecular disulfide bonds within the Ig-/Ig-ß heterodimer
Next, we systematically mutated cysteine residues in both Ig- and Ig-ß and studied how these mutations affected covalent heterodimer formation. Cysteines were mutated to serine residues in order to minimize steric and chemical changes within the proteins. Since Ig- has three extracellular cysteines, two of which, C50 and C101, are predicted to form an intramolecular disulfide bond, we only mutated the remaining C113.
Vectors encoding Ig- or Ig-C113S and Ig-ß were transiently transfected in S2 cells and the supernatants separated by NR SDS-PAGE (Fig. 4A). The Ig-/Ig-ß heterodimer and higher complexes can be clearly seen in both flagIg- and HAIg-ß developments of the immunoblot (lanes 3 and 6). When Ig-C113 was mutated, neither the heterodimer nor higher complexes thereof were detected in the flagIg- blot (lane 2). Monomeric Ig-C113S was detected at 35 kDa. The corresponding HAIg-ß blot shows the Ig-ß monomer and homodimer bands (Fig. 4A, lane 5). Again, the large disulfide-bonded multimers were not detected when Ig-C113S was co-expressed. Thus, we conclude that the disulfide bond between Ig- and Ig-ß requires Ig- cysteine C113. The same is true for the multimeric Ig-–Ig-ß complexes.
To address the relevance of cysteines in Ig-ß for interchain disulfide bonding within Ig-ß in the context of the heterodimer, single soluble cysteine mutants of Ig-ß were transfected with soluble wt Ig-. As a control, wt Ig- and wt Ig-ß were also co-expressed (Fig. 4B). As was the case with the wt control, heterodimer bands and higher complexes thereof could be detected in S2 cell supernatant fractions of Ig- transfected with each of Ig-ßC43S, Ig-ßC65S, Ig-ßC120S and Ig-ßC124S (upper and lower panels, lanes 3–6), indicating that none of these cysteines responsible for the disulfide bond with Ig-; however, when Ig-ßC135 was mutated, neither heterodimer nor higher complexes thereof were found (lane 7). Consequently, only monomeric Ig- and Ig-ß were detected. Two differentially glycosylated Ig- monomers were present (lanes 7). That the lower band, corresponding to the mature form of Ig-, was detected probably reflects secretion of a non-covalently bound Ig-/Ig-ß heterodimer. The loss of disulfide-linked Ig-/Ig-ß heterodimers when either Ig-C113 or Ig-ßC135 were mutated demonstrates that Ig-C113 and Ig-ßC135 form the intermolecular disulfide bond. Ig-ßC135 also responsible for covalent bonding within the Ig-ß/Ig-ß homodimers, since Ig-ß/Ig-ß homodimers were neither detected in the supernatant of cells expressing wt Ig- and Ig-ßC135S (Fig. 4B, lower panel, lane 7) nor in cells expressing Ig-ßC135S alone (data not shown).
The R flagIg- blot confirms similar expression levels of Ig- in supernatants of all transfectants; however, in the R HAIg-ß blot, it is evident that Ig-ßC65S and Ig-ßC120S expression levels are much reduced and limited to the Ig-ß glycosylation form with the slowest electrophoretic mobility, likely the immature ER-retained form. The uniform BSA bands on the Coomassie-stained gel, generated by loading identical aliquots of the samples shown in the western blot (WB) figures, confirm equal loading of supernatant fractions (Fig. 4B, bottom panel).
To identify cysteines possibly involved in intrachain disulfide bonds in Ig-ß, we looked at the electrophoretic mobility of the heterodimers (Fig. 4B and C). Decreased electrophoretic mobility is evident upon loss of a disulfide bond (34–36). Thus, similar changes in the electrophoretic mobility of Ig-ß would be expected upon mutation of the individual cysteines that normally pair to form a disulfide bridge (37, 38). Indeed, our experiments showed differential electrophoretic mobility of heterodimers containing Ig-ß cysteine mutants. Ig-/Ig-ßC43S and Ig-/Ig-ßC124S (Fig. 4B, lanes 3 and 6 and Fig. 4C, lanes 2 and 5) showed equal electrophoretic mobility that was decreased compared with that of the wt Ig-/Ig-ß heterodimer (Fig. 4B, lanes 2 and Fig. 4C, lane 1). Similarly, the electrophoretic mobility of Ig-/Ig-ßC65S and Ig-/Ig-ßC120S was even more decreased (Fig. 4B and C). Thus, our data suggest intramolecular bonding in Ig-ß between C43 and C124 as well as C65 and C120. Different migration behavior was not caused by unequal protein loading, since the same amount of proteins was loaded in each lane (Fig. 4B, Coomassie stain). Also, the equal intensities of these distinct heterodimeric bands infer that C65 and C120 form a disulfide bond, since co-transfection of wt Ig- with Ig-ßC65S as well as wt Ig- with Ig-ßC120S resulted in weaker expression of these proteins compared with the other Ig-ß mutants (upper and lower panels, lanes 4 and 5). The lack of the C65–C120 disulfide bond may have resulted in ER retention or enhanced degradation of Ig-ß mutants due to the availability of an unpaired cysteine. This was not the case for Ig-ßC43S and Ig-ßC124S, arguing again that the two disulfide bonds are C43–C124 and C65–C120. The same disulfide bonds were also identified using the mIg-ß molecule and corresponding cysteine mutants (data not shown). We conclude that Ig-C113 and Ig-ßC135 form the disulfide bond stabilizing the Ig-/Ig-ß heterodimer and that the intramolecular disulfide bridges in Ig-ß are formed between C43 and C124 and between C65 and C120.
The intermolecular disulfide bond of Ig-/Ig-ß is not necessary for mIgM-BCR expression on the surface of S2 cells
To test whether cysteine mutations of Ig- have any effect on BCR transport to the cell surface, BCR components, including the signaling molecules SLP-65 and Syk, which bind to the cytoplasmic tails of Ig- and Ig-ß (39, 40), were expressed transiently in S2 cells (Fig. 5). 24 h post-induction, cells were harvested and stained on their surface for BCR expression. Cells transfected with empty vector only served as a negative control (bottom right-hand panel). The co-transfected vector encoding EGFP served as a marker for transfected cells. When Ig- or Ig-ß was expressed with µmHC alone in S2 cells, these molecules remained ER retained (panels a and m); however, when LC was also expressed, 20% of transfected cells were able to express incomplete BCRs on the surface (panels b and n). Co-expression of Ig- and Ig-ß without LC increased BCR surface expression to 80% of green fluorescent protein-positive cells (panel c) and expression of the complete BCR resulted in its presence on 90% of transfected cells (panel d). Co-expression of the mutant Ig-C113S with various combinations of the other BCR subunits had no effect on mIgM expression on the surface (panels e–h). This indicated that Ig-C113S and Ig-ß are able to form a non-disulfide-linked heterodimer in Drosophila cells that assembles with mIgM. Furthermore, non-covalently bonded heterodimers could be detected by co-affinity purification experiments (data not shown). Indeed, even co-expression of both intermolecular disulfide cysteine mutants, Ig-C113S and Ig-ßC135S, supported surface receptor transport in S2 cells (data not shown). Thus, the intermolecular disulfide bond between Ig- and Ig-ß is not necessary for BCR assembly and transport to the cell surface. In addition, mutation of the intracellular cysteine C190 did not influence mutant BCR expression on the surface of S2 cells (panels i–l).
|
Ig-
C113 and Ig-ßC135 also form the intermolecular disulfide bond in a B cell lineWe then wanted to see whether Ig-
C113 is part of the intermolecular disulfide bond within the Ig-/Ig-ß heterodimer in B cells. We made use of the B cell line J558Lµm15-25 (17) that expresses mIgM and Ig-ß, but is lacking Ig-, thus hindering BCR formation. Vectors encoding flagIg- and flagIg-C113S were transfected into J558Lµm15-25 and stable clones were selected. WB analysis of NR lysates of these clones was performed using anti-flagIg- antibodies (Fig. 6A). As expected, only the Ig- monomer, and not the Ig-/Ig-ß heterodimer, was detected in the Ig-C113S mutant lysate (Fig. 6A, lane 3), in contrast to that of the wt Ig- transfectant (lane 2). Some monomeric Ig- was also detected in the wt transfectant (lane 2), which was possibly ER-localized Ig- that had not yet formed a disulfide bridge with Ig-ß. Untransfected J558L served as a negative control for background bands (lane 1). Immunopurification of the Ig-/Ig-ß heterodimer from Digitonin lysates of these cells with an anti-flag antibody followed by WB analysis using a monoclonal anti-Ig-ß antibody shows the intact Ig-/Ig-ß heterodimer in the wt Ig- transfectant (Fig. 6B, lane 2), but only monomeric Ig-ß recovered from the Ig-C113S mutant (lane 3).
To assess whether Cys135 is the Ig-ß cysteine that forms the interchain disulfide bond, we transduced J558LµmflagIg- cells expressing wt Ig- with retrovirus encoding for either HA-tagged wt Ig-ß or Ig-ßC135S. WB analysis of cell lysates was performed using anti-HA antibodies, in order to detect only transduced and not endogenous Ig-ß (Fig. 6C). Disulfide-linked Ig-ß homodimers as well as the Ig-/Ig-ß heterodimer were only detected when wt Ig-ß was transduced, indicating that Ig-ßC135 is also part of the interchain disulfide bond in both dimers when expressed in J558L cells.
These findings from a B cell line confirmed the result obtained using the Drosophila S2 cell system, namely, that Ig-C113 covalently binds to Ig-ßC135 forming the interchain disulfide bond.
A mutant IgM-BCR that lacks the intermolecular Ig-/Ig-ß disulfide bond exhibits reduced expression on the B cell surface
Next, we wanted to validate a further result from the Drosophila expression system in B cells, namely, that the lack of the Ig-/Ig-ß intermolecular disulfide bond did not influence BCR expression on the cell surface (Fig. 5). Two independent clones of wt Ig- and mutant Ig-C113S J558Lµm B cell transfectants were stained for mIgM-BCR expression on the cell surface and analyzed by flow cytometry. Cells expressing the mutant IgM-BCR consistently displayed 40% lower surface receptor expression than wt IgM-BCR transfectants (Fig. 6D, dashed and bold lines, respectively). Statistical analysis of 11 and 17 clones, respectively, showed that this difference was significant (P < 0.0001), indicating that without the Ig-/Ig-ß intermolecular disulfide bond, receptor expression on the surface of B cells is less efficient. Ig-C113S and Ig-ß can form a non-covalently bound heterodimer in murine B cells (Fig. 6 and data not shown), and this dimer assembles with mIgM to form the mutant BCR, which is probably retained in the ER to some extent (Fig. 6). Thus, the presence of the Ig-/Ig-ß intermolecular disulfide bond or that of an unpaired Ig-ß cysteine could enable the B cell quality control machinery to distinguish between a correctly or an aberrantly formed BCR.
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Here we have identified the disulfide bonds in the Ig-
/Ig-ß heterodimer. Mutating C113 of Ig- or C135 of Ig-ß resulted in loss of the disulfide-bonded heterodimer accompanied by gain of monomeric species in our lysates, indicating that these cysteines form the intermolecular bond between Ig- and Ig-ß (Fig. 7). In addition, we systematically mutated single extracellular cysteines in Ig-ß. Expression of Ig-ß cysteine mutants with wt Ig- resulted in decreased electrophoretic mobility of Ig-/Ig-ß heterodimers, thus allowing us to determine that C43 and C124 as well as C65 and C120 form intrachain bonds (Fig. 7). These findings confirm our previous prediction (14) and refute others (GenBank accession number P15530) (12). Since these predictions were based on sequence alignments, this discrepancy supports the premise that sequence similarity does not necessarily prove structural similarity (9). This, in turn, underscores the need for experimental data.
|
In Ig-ß, C65 and C120 form the canonical disulfide bond of the Ig domain, and an outer disulfide bridge forms between C43 and C124 that likely renders the protein more compact (9). In our experiments, mutation of C43 or C124 did not affect protein expression, whereas mutation of C65 and C120 resulted in decreased mutant Ig-ß expression, likely due to enhanced degradation. Thus, the evolutionarily more conserved inner disulfide bond is more important for proper protein folding and stability than the outer bond. All available mammalian Ig-ß sequences have this second intramolecular disulfide bond, whereas the chicken Ig-ß sequence lacks the cysteine that would correspond to murine C124 (6). Obviously, the outer disulfide bond is not a requirement for proper Ig-ß folding in chicken.
The Ig-/Ig-ß interchain disulfide bond cysteines are C113 and C135 of Ig- and Ig-ß, respectively, demonstrating that this covalent bond is adjacent to the membrane; however, even in the absence of a covalent bond, Ig- and Ig-ß can still associate with one another. This is indicated by immunoprecipitation experiments showing that Ig- and Ig-ß can still be co-purified from lysates of Drosophila S2 as well as B cells in the absence of the intermolecular disulfide bond (Fig. 6B and data not shown). This non-covalent binding is probably mediated via their Ig domains (41) and TM regions (3). Indeed, the same conclusion can be drawn from our flow cytometry data quantifying µmHC expression on the surface of different Drosophila S2 cell transfectants (Fig. 5). The HC is only exported efficiently in the presence of Ig-/Ig-ß heterodimers. Efficient ER export is characterized by a high intensity of surface µm (18) at an already low µm expression level (in our case, low EGFP fluorescence). In contrast, µm with Ig- alone or Ig-ß alone was ER retained (Fig. 5, panels a and m). The expression pattern of IgM on the surface when expressed with Ig- or Ig-ß alone is rather indicative of ER overflow, whereby chaperone machinery becomes saturated at high µm expression levels (Fig. 5, panels b and n) (18). Since HC was actively exported when co-expressed with Ig-C113S/Ig-ß (Fig. 5) or Ig-/Ig-ßC135S (data not shown) or even when both mutants were co-expressed (data not shown), functional Ig-/Ig-ß heterodimers must have been assembled. This is in agreement with Ig-C113 mutant IgM-BCR expression in the B cell line, J558L.
In contrast to Drosophila S2 transfectants, Ig-C113S B cell transfectants, which lack the intermolecular disulfide bond and contain the unpaired cysteine Ig-ßC135, exhibited decreased mIgM expression on the cell surface. This was probably a result of partial ER retention of the mutant BCR, since exposed cysteines can function as retention and degradation signals (42). Another possibility is that BCR components were unable to overcome ER retention efficiently due to structural alterations resulting from the lack of the disulfide bond adjacent to the membrane. That we see a difference in expression of receptor on the surface between wt and mutant J558L transfectants suggests that these cells have a higher capacity to retain improperly formed receptors than S2 cells (Fig. 5).
A regulatory role for Ig- and Ig-ß subunits unable to form a disulfide bridge has been proposed through the study of naturally occurring mRNA splice variants in humans (43). Expression of the resulting truncated Ig- or Ig-ß retains IgM in the ER; when over-expressed, they compete with wt proteins, thereby down-modulating the BCR. Unpaired cysteines in their wt counterparts likely serve as retention signals.
Many studies have been reported on disulfide bonding in the TCR (44–47). Depending on the subunits and the nature of the cysteine mutation, the effects range from none at all (47) to drastic (46). This is in line with the observation that not all Ig domains require this bond for proper folding (11), and that not all disulfide bonds exist to stabilize proteins or complexes (48). The CD3 dimers of the TCR, thought to be functional and structural homologues of the Ig-/Ig-ß heterodimer, do not require disulfide bonding for dimerization; indeed, no interchain disulfides have been found (49). The CD3 dimers are perhaps stabilized to some extent by coordination of metal ions through CxxC motifs in their spacer regions (50), this interaction still allowing the flexibility to undergo the reported conformational change upon TCR engagement (51). No such mechanism has been elucidated in the BCR to date; the rigidity conferred on the Ig-/Ig-ß dimer by the interchain disulfide bridge may preclude the existence of such a conformational change.
In a recent study, oligomerization of soluble Ig- cytoplasmic domains expressed in bacteria was reported (52). This is in agreement with our observation of higher complexes containing soluble Ig- and Ig-ß expressed by S2 cells (Figs 2B and 3). These complexes, covalently bound via Ig-C190, were specific, since random complexes with endogenous Drosophila proteins were not detected. The trimer observed is most likely Ig-/Ig-/Ig-ß, since Ig-ßC135 is required for heterodimerization with Ig- and, thus, this cysteine is not free to form homodimers, rendering formation of a stable Ig-/Ig-ß/Ig-ß trimer unlikely. This is only possible in the event that an Ig-ß cysteine remains unpaired, thus explaining even larger complexes observed upon co-expression of wt Ig- with the Ig-ßC124 mutant (Fig. 4b, lanes 6). This finding demonstrates that Ig- can form oligomers in the ER, and is consistent with growing evidence that the BCR exists as oligomers in B cells (2, 52, 53).
Most of our results obtained using Drosophila cells were confirmed in B cells; hence, we are confident that we have identified valid disulfide bonds. We detected Ig-ß/Ig-ß, but not Ig-/Ig- dimers in S2 cells, an observation also made in human B cells (16). Similarly, our identification of the intermolecular Ig-/Ig-ß disulfide bond was validated in a B cell line. The necessity of Ig-/Ig-ß heterodimer binding to mIgM for efficient BCR export has also been elucidated in B cells (3, 14, 19). We realized the limitations of our system when we compared expression of wt and mutant IgM-BCR on the surface of S2 cells and B cells. In S2 cells, no apparent difference was observed between wt transfectants and those harboring mutations of the Ig-/Ig-ß heterodimer interchain disulfide cysteines (Fig. 5 and data not shown). This was not the case in B cells, as we consistently observed a decrease in mIgM expression on the surface of Ig-C113S transfectants (Fig. 6B). This difference is consistent with our earlier observation that B cell ER-retention machinery is more efficient in retaining improperly assembled or folded BCRs than Drosophila cells (18, 23, 24). This could be due to the evolutionary distance between the fruit fly and mammals or a cell-type difference. In general, the Drosophila S2 cell system is a useful tool to study disulfide bonds, especially in cases where several proteins must be co-expressed transiently and inducibly.
|
Acknowledgements |
|---|
We would like to thank the following people who made generous contributions to our work: Klaus Karjalainen for CD3zipper constructs; R. Scheuermann, University of Texas, Dallas, for pDSyk; Florian Losch for the pABES-puro2000II vector; John Cambier for the anti-Ig-
rabbit antiserum; Michael Ratcliffe for the unpublished chicken Ig- sequence and Tilman Brummer for help with pABES vector cloning, screening and J558L transfection protocol. This work was supported by the Leibniz prize and SFB388 to M.R., an Emmy Noether Fellowship to W.W.A.S. from the Deutsche Forschungsgemeinschaft (SCHA 976/1), and a University of Freiburg Wiedereinstiegsstipendium to G.M.S. |
Abbreviations |
|---|
| azip, acidic leucine zipper |
| BCR, B cell antigen receptor |
| bzip, basic leucine zipper |
| EGFP, enhanced green fluorescent protein |
| Endo-H, endoglycosidase H |
| ER, endoplasmic reticulum |
| HC, heavy chain |
| LC, light chain |
| mIg, membrane-bound Ig |
| µm, membrane-bound µ heavy chain |
| MIRR, multi-chain immune recognition receptor |
| NR, non-reducing |
| PMSF, phenylmethylsulphonylfluoride |
| R, reducing |
| TM, transmembrane |
| WB, western blot |
| wt, wild type |
|
Notes |
|---|
Transmitting editor: I. Pecht
Received 12 August 2005, accepted 5 July 2006.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
- Keegan AD and Paul WE. (1992) Multichain immune recognition receptors—similarities in structure and signaling pathways. Immunol. Today 13:63.[CrossRef][Web of Science][Medline]
- Schamel WWA and Reth M. (2000) Monomeric and oligomeric complexes of the B cell antigen receptor. Immunity 13:5.[CrossRef][Web of Science][Medline]
- Hombach J, Tsubata T, Leclercq L, Stappert H, Reth M. (1990) Molecular-components of the B-cell antigen receptor complex of the IgM class. Nature 343:760.[CrossRef][Medline]
- Kashiwamura SI, Koyama T, Matsuo T, Steinmetz M, Kimoto M, Sakaguchi N. (1990) Structure of the murine mb-1 gene encoding a putative sIgM-associated molecule. J. Immunol. 145:337.[Abstract]
- Sakaguchi N, Kashiwamura S, Kimoto M, Thalmann P, Melchers F. (1988) Lymphocyte-B lineage-restricted expression of mb-1, a gene with CD3-like structural-properties. EMBO J. 7:3457.[Web of Science][Medline]
- Katsukura H, Murakami R, Chijiwa Y, et al. (2001) Structure of the beta-chain (B29) gene of the chicken B-cell receptor and conserved collinearity with genes for potential skeletal muscle sodium channel and growth hormone. Immunogenetics 53:770.[CrossRef][Web of Science][Medline]
- Reth M. (1989) Antigen receptor tail clue. Nature 338:383.[Medline]
- Amzel LM and Poljak RJ. (1979) 3-Dimensional structure of immunoglobulins. Annu. Rev. Biochem. 48:961.[CrossRef][Web of Science][Medline]
- Halaby DM, Poupon A, Mornon JP. (1999) The immunoglobulin fold family: sequence analysis and 3D structure comparisons. Protein Eng. 12:563.
[Abstract/Free Full Text] - Bork P, Holm L, Sander C. (1994) The immunoglobulin fold—structural classification, sequence patterns and common core. J. Mol. Biol. 242:309.[Web of Science][Medline]
- Williams AF. (1987) A year in the life of the immunoglobulin superfamily. Immunol. Today 8:298.[CrossRef][Web of Science]
- Hermanson GG, Eisenberg D, Kincade PW, Wall R. (1988) B29—a member of the immunoglobulin gene superfamily exclusively expressed on B-lineage cells. Proc. Natl Acad. Sci. USA 85:6890.
[Abstract/Free Full Text] - Campbell KS, Hager EJ, Friedrich RJ, Cambier JC. (1991) IgM antigen receptor complex contains phosphoprotein products of B29 and mb-1 genes. Proc. Natl Acad. Sci. USA 88:3982.
[Abstract/Free Full Text] - Reth M. (1992) Antigen receptors on B-lymphocytes. Annu. Rev. Immunol. 10:97.[CrossRef][Web of Science][Medline]
- Williams AF and Barclay AN. (1988) The immunoglobulin superfamily—domains for cell-surface recognition. Annu. Rev. Immunol. 6:381.[Web of Science][Medline]
- Brouns GS, Devries E, Borst J. (1995) Assembly and intracellular-transport of the human B-cell antigen receptor complex. Int. Immunol. 7:359.
[Abstract/Free Full Text] - Hombach J, Leclercq L, Radbruch A, Rajewsky K, Reth M. (1988) A novel 34-kd protein co-isolated with the IgM-molecule in surface IgM-expressing cells. EMBO J. 7:3451.[Web of Science][Medline]
- Schamel WWA, Kuppig S, Becker B, Gimborn K, Hauri HP, Reth M. (2003) A high-molecular-weight complex of membrane proteins BAP29/BAP31 is involved in the retention of membrane-bound IgD in the endoplasmic reticulum. Proc. Natl Acad. Sci. USA 100:9861.
[Abstract/Free Full Text] - Venkitaraman AR, Williams GT, Dariavach P, Neuberger MS. (1991) The B-cell antigen receptor of the five immunoglobulin classes. Nature 352:777.[CrossRef][Medline]
- Campbell KS, Backstrom BT, Tiefenthaler G, Palmer E. (1994) Cart: a conserved antigen receptor transmembrane motif. Semin. Immunol. 6:393.[CrossRef][Medline]
- Rolli V, Gallwitz M, Wossning T, et al. (2002) Amplification of B cell antigen receptor signaling by a Syk/ITAM positive feedback loop. Mol. Cell 10:1057.[CrossRef][Web of Science][Medline]
- Schneider I. (1972) Cell lines derived from late embryonic stages of Drosophila melanogaster. J. Embryol. Exp. Morphol. 27:353.[Web of Science][Medline]
- Kirkpatrick RB, Ganguly S, Angelichio M, et al. (1995) Heavy-chain dimers as well as complete antibodies are efficiently formed and secreted from Drosophila via a BiP-mediated pathway. J. Biol. Chem. 270:19800.
[Abstract/Free Full Text] - Wossning T and Reth M. (2004) B cell antigen receptor assembly and Syk activation in the S2 cell reconstitution system. Immunol. Lett. 92:67.[CrossRef][Web of Science][Medline]
- Lundblad A, Weigert MG, Steller R, Cohn M, Hirst JW, Kabat EA. (1972) Immunochemical studies on mouse myeloma proteins with specificity for dextran or for levan. Immunochemistry 9:535.[CrossRef][Web of Science][Medline]
- Oi VT, Morrison SL, Herzenberg LA, Berg P. (1983) Immunoglobulin gene-expression in transformed lymphoid-cells. Proc. Natl Acad. Sci. USA 80:825.
[Abstract/Free Full Text] - Bunch T, Grinblat Y, Goldstein L. (1988) Characterization and use of the Drosophila metallothionein promoter in cultured Drosophila melanogaster cells. Nucleic Acids Res. 16:1043.
[Abstract/Free Full Text] - Mahiouz D, Aichinger G, Haskard D, George A. (1998) Expression of recombinant anti-e-selectin single-chain fv antibody fragments in stably transfected insect cell lines. J. Immunol. Methods 212:149.[CrossRef][Web of Science][Medline]
- Schamel W. (1999) Functional and structural characterization of membrane-bound immunoglobulin (mIg) complexes. PhD Thesis. (University of Freiburg, Germany)153.
- Wienands J, Schweikert J, Wollscheid B, Jumaa H, Nielsen PJ, Reth M. (1998) Slp-65: a new signaling component in B lymphocytes which requires expression of the antigen receptor for phosphorylation. J. Exp. Med. 188:791.
[Abstract/Free Full Text] - Laemmli U. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680.[CrossRef][Medline]
- Adachi T, Schamel WWA, Kim KM, et al. (1996) The specificity of association of the IgD molecule with the accessory proteins BAP31/BAP29 lies in the IgD transmembrane sequence. EMBO J. 15:1534.[Web of Science][Medline]
- Olivier AR and Parker PJ. (1994) Bombesin, platelet-derived growth factor, and diacylglycerol induce selective membrane association and down-regulation of protein kinase c isotypes in Swiss 3t3 cells. J. Biol. Chem. 269:2758.
[Abstract/Free Full Text] - Braakman I, Helenius J, Helenius A. (1992) Manipulating disulfide bond formation and protein folding in the endoplasmic reticulum. EMBO J. 11:1717.[Web of Science][Medline]
- Allison JP, Walker LE, Russell WA, et al. (1978) Murine Ia and human DR antigens: homology of amino-terminal sequences. Proc. Natl Acad. Sci. USA 75:3953.
[Abstract/Free Full Text] - Creighton TE. (1984) Disulfide bond formation in proteins. Methods Enzymol 107:305.[Web of Science][Medline]
- Dick TP, Bangia N, Peaper DR, Cresswell P. (2002) Disulfide bond isomerization and the assembly of MHC class I-peptide complexes. Immunity 16:87.[CrossRef][Web of Science][Medline]
- Turnquist HR, Petersen JL, Vargas SE, et al. (2004) The Ig-like domain of tapasin influences intermolecular interactions. J. Immunol. 172:2976.
[Abstract/Free Full Text] - Engels N, Wollscheid B, Wienands J. (2001) Association of Slp-65/BLNK with the B cell antigen receptor through a non-ITAM tyrosine of Ig-alpha. Eur. J. Immunol. 31:2126.[CrossRef][Web of Science][Medline]
- Rowley RB, Burkhardt AL, Chao HG, Matsueda GR, Bolen JB. (1995) Syk protein-tyrosine kinase is regulated by tyrosine-phosphorylated Ig alpha/Ig beta immunoreceptor tyrosine activation motif binding and autophosphorylation. J. Biol. Chem. 270:11590.
[Abstract/Free Full Text] - Kaloff CR and Haas IG. (1995) Coordination of immunoglobulin chain folding and immunoglobulin chain assembly is essential for the formation of functional IgG. Immunity 2:629.[CrossRef][Web of Science][Medline]
- Fra AM, Fagioli C, Finazzi D, Sitia R, Alberini CM. (1993) Quality-control of ER synthesized proteins—an exposed thiol-group as a 3-way switch mediating assembly, retention and degradation. EMBO J. 12:4755.[Web of Science][Medline]
- Indraccolo S, Minuzzo S, Zamarchi R, Calderazzo F, Piovan E, Amadori A. (2002) Alternatively spliced forms of Ig alpha and Ig beta prevent B cell receptor expression on the cell surface. Eur. J. Immunol. 32:1530.[CrossRef][Web of Science][Medline]
- Rubin B, Arnaud J, Caspar-Bauguil S, Conte F, Huchenq A. (1994) Biological function of the extracellular domain of the T-cell receptor constant region. Scand. J. Immunol. 39:517.[CrossRef][Web of Science][Medline]
- Li ZG, Wu WP, Kemp O, Stephen M, Manolios N. (1998) The interchain disulfide linkage of T-cell antigen receptor-alpha and -beta chains is a prerequisite for T-cell activation. Cell. Immunol. 190:101.[CrossRef][Web of Science][Medline]
- Casparbauguil S, Arnaud J, Gouaillard C, Hou XH, Geisler C, Rubin B. (1994) Functionally important amino-acids in the TCR revealed by immunoselection of membrane TCR-negative t-cells. J. Immunol. 152:5288.[Abstract]
- Arnaud J, Huchenq A, Vernhes MC, et al. (1997) The interchain disulfide bond between TCR alpha beta heterodimers on human T cells is not required for TCR-CD3 membrane expression and signal transduction. Int. Immunol. 9:615.
[Abstract/Free Full Text] - Dick TP. (2004) Assembly of MHC class I peptide complexes from the perspective of disulfide bond formation. Cell. Mol. Life Sci. 61:547.[CrossRef][Web of Science][Medline]
- Call ME, Pyrdol J, Wucherpfennig KW. (2004) Stoichiometry of the T-cell receptor-CD3 complex and key intermediates assembled in the endoplasmic reticulum. EMBO J. 23:2348.[CrossRef][Web of Science][Medline]
- Borroto A, Mallabiabarrena A, Albar JP, Martinez-A C, Alarcon B. (1998) Characterization of the region involved in CD3 pairwise interactions within the T cell receptor complex. J. Biol. Chem. 273:12807.
[Abstract/Free Full Text] - Gil D, Schamel WW, Montoya M, Sanchez-Madrid F, Alarcon B. (2002) Recruitment of Nck by CD3 epsilon reveals a ligand-induced conformational change essential for T cell receptor signaling and synapse formation. Cell 109:901.[CrossRef][Web of Science][Medline]
- Sigalov A, Aivazian D, Stern L. (2004) Homooligomerization of the cytoplasmic domain of the T cell receptor zeta chain and of other proteins containing the immunoreceptor tyrosine-based activation motif. Biochemistry 43:2049.[CrossRef][Medline]
- Reth M, Wienands J, Schamel WWA. (2000) An unsolved problem of the clonal selection theory and the model of an oligomeric B-cell antigen receptor. Immunol. Rev. 176:10.[CrossRef][Web of Science][Medline]
CiteULike 
Connotea 
Del.icio.us What's this?
This article has been cited by other articles:
|
|
 |
|
  A. K. Dobbs, T. Yang, D. Farmer, L. Kager, O. Parolini, and M. E. Conley Cutting Edge: A Hypomorphic Mutation in Igbeta (CD79b) in a Patient with Immunodeficiency and a Leaky Defect in B Cell Development J. Immunol., August 15, 2007; 179(4): 2055 - 2059. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||