International Immunology Advance Access originally published online on April 26, 2006
International Immunology 2006 18(6):911-920; doi:10.1093/intimm/dxl028
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Constitutive expression of the pre-TCR enables development of mature T cells
1 Division of Immunology, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands
2 Department of Immunology, University of Basel, 4056 Basel, Switzerland
3 Max Planck Institute for Immunobiology, 79108 Freiburg, Germany
Correspondence to: H. Jacobs; E-mail: h.jacobs{at}nki.nl
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Expression and signalling through the pre-TCR and the TCR
ß resemble two critical checkpoints during T cell development. We investigated to which extent a pre-TCR can functionally replace mature TCR chains during T cell development. For this purpose, transgenic mice were generated expressing the pre-TCR (pT) under the transcriptional control of TCRß regulatory elements. We report here on the interesting finding that constitutive pT expression allows complete T cell maturation. The pre-TCR complex permits a subset of ß-selected thymocytes to mature in the absence of TCR into peripheral T cells (ßT cells) comprising up to 10% of all lymphocytes. Lymphopenia-driven proliferation of these ßT cells is similar to that of conventional ßT cells. Furthermore, ßT cells proliferated and acquired effector function upon stimulation with allogeneic MHC.
Keywords: cell differentiation, pre-TCR, T cell development, thymus, transgenic/knockout mice
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The formation of a clonally distributed antigen receptor (AgR) repertoire on B and T lymphocytes hallmarks the adaptive immune system. The antigen-binding sites of both B and T cell AgRs are shaped by heterodimerization of the amino-terminal variable (V) domains of Ig heavy and light chains, TCR
and ß or TCR
and 
chains, respectively (1). The ontogeny of B and T cells is characterized by a sequential acquisition of their clonotypic AgR chains (2–5). To compensate for the transient lack of the secondary chain, both B and T cells make use of the so-called surrogate receptor chains to form the pre-BCR and pre-TCR complexes, in which the surrogate light chain (a disulphide-linked heterodimer between a VpreB and 
5) or the pre-TCR (pT) chain replaces the lacking IgL and TCR chain, respectively (3, 6–8). Expression of the precursor forms of AgRs is associated with increased survival, rapid clonal expansion, further differentiation and rearrangement of the secondary AgR genes. The subsequent expression of clonotypic AgR complexes and their selection into the mature lymphocyte pool is accompanied by transcriptional shutdown of the surrogate AgR chains.
Regarding ßT cells, the stages of intra-thymic development can be traced by their differential expression of CD4, CD8, CD25 and CD44 (9). CD4–CD8– double-negative (DN) precursors pass successively through four stages defined as CD25–44+ (DN I), CD25+44+ (DN II), CD25+44– (DN III) and CD25–44– (DN IV). While rearrangements of D (diversity) and J (joining) segments at the TCRß locus are found in DN I cells already, the vast majority of V (variability) to DJ rearrangements occur in resting DN III cells. If productive, the TCRß chain is disulphide linked to pT and assembles with pre-formed CD3 components into a pre-TCR–CD3 complex, which appears at very low levels at the cell surface. The pre-TCR signals ligand independently causing the progression of late resting TCRß-negative proT cells of ‘expected size’ (DN III E) into ‘large’, cycling pre-T cells (DN III L), a process known as ß-selection (10). The term ß-selection has been introduced to characterize a critical checkpoint by which only those T cells are selected for further maturation that have undergone successful rearrangement of their TCRß allele (10, 11). DN III L cells initiate VJ rearrangements at the TCR locus and continue development by down-regulation of CD25 to yield DN IV cells. After a transitional CD4–8+ immature single-positive (ISP) stage they develop into small resting, CD4+8+ double-positive (DP) thymocytes. The expansion of DN III L cells accounts for the generation of most ßT cell precursors, increasing the efficacy of TCRß repertoire formation and counteracting the substantial cell loss associated with positive and negative selection of DP ß thymocytes (4, 12). Further differentiation and selection into mature T cell subsets require a functional VJ rearrangement at the TCR locus and expression of a TCR chain capable of assembling into TCRß–CD3 complexes. The interaction of the clonotypic TCRß with peptide MHC (pMHC) ligands in the thymus determines the outcome for positive and negative selection.
Remarkably, the contribution of the TCR and ß chain in recognizing specific pMHC complexes varies considerably in that it can be largely determined by TCR, TCRß or both (for review see 13, 14). According to the affinity model, negative selection or neglection involves clonal elimination of those thymocytes that interact either too strong or too weak with pMHC, respectively (for review see 15). Positive selection is associated with the up-regulation of TCRß/CD3 surface expression levels, transcriptional down-regulation of pT and reduced expression of the T cell ‘immaturity marker’ (HSA). The final commitment into MHC class II-restricted CD4+8– helper or MHC class I-restricted CD4–8+ cytotoxic T cell lineage is marked by the shutdown of CD8 or CD4 co-receptor expression and migration into peripheral lymphatic tissues (for review see 16).
Peripheral ßT cells derive from intermediate-affinity self-MHC-restricted, positively selected thymocytes, which represent a very small fraction of T cell precursors. Despite the fact that the pre-TCR complex uses the same signalling cascades as the TCRß, signals arising from the pre-TCR appear to be ligand independent, i.e. pre-T cell development can proceed normally in the absence of the intra- and extracellular TCRß and pT domains (17–21) and does not require MHC expression (22).
We here addressed the developmental potential of precursor T cells, constitutively expressing the pT chain under the transcriptional control elements of the TCRß promotor. Constitutive expression of the pre-TCR permits a subset of ß-selected thymocytes to mature, giving rise to peripheral pT/TCRß/TCR–/– cells. The developmental and functional potential of this novel population of peripheral T cells from pT transgenic (tg)/TCR–/– mice has been addressed and the potential consequences in regard to the complexity of AgR formation are discussed.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Mice
Mice deficient in TCR
or Rag2 were purchased from Jackson Laboratories. Nude mice were obtained from Bomholtgaard as BLACK-nu and conventional C57Bl/6 mice from Charles River (Wilmingtion, MA, USA). Mice deficient in pT were kindly provided by J. Fehling and H. von Boehmer (23). Mice were maintained under specific pathogen-free conditions and used for experiments at 6–8 weeks of age. All animal experiments were performed according to institutional and national guidelines.
Generation of pT tg mice
A transgene was derived by placing a genomic fragment encompassing exon 2–4 of mouse pT coding region under the control of TCRß transcription elements. The construct is based on a 20-kb genomic KpnI fragment that originates from the 36-kb insert of cosHYß9-1.14-5 (24) and contains the rearranged HY-TCRß gene including the transcription elements of the TCRß locus (25). The 
V-TCRß mutant was derived by deleting most of the VDJ region, which encodes a small NH2-terminal tag of 12 aa (comprising 6 N-terminal amino acids of Vß8.2 and 6 C-terminal amino acids of Jß2.3) and the complete constant region of TCR Cß2 (26). The V-TCRß transgene was further modified by deleting a genomic 6.1-kb BamHI fragment containing the TCRß constant region (Cß2) and inserting a genomic ClaI-flanked EcoRV/HindIII fragment of 3.5 kb containing exon 2–4 of mouse pT (27) into a unique ClaI site located just upstream of the deleted BamHI fragment. To enable release of the pT transgene by KpnI digestion, the intronic KpnI site within pT was destroyed. Three independent founder lines were established by micro-injecting the 17-kb KpnI fragment into fertilized BDF1 (H2-Db) mouse oocytes. The Vtag allows differential detection of the pT transgene and products. The genotype of pT tg mice was determined by PCR, making use of the Vtag-specific primer (CACATGGAGGCTGCAACCAGACTG) and a reverse pT primer (CGGAAAGGGGGTGCCAGCGATGC). Mice were back-crossed on the C57Bl/6 background for at least six generations.
Forward primer used for reverse transcription (RT)–PCR on pT hybridizes at start of exon 2 (ATCACACTGCTGGTAGATGGA) and the reverse primer 20-bp downstream of stop codon (TCAGAGGGGTGGGTAAGATC).
Flow cytometry staining
Single cells from thymus, spleen or blood were obtained and RBCs were lysed. Cells were incubated for 15 min on ice with specific antibodies conjugated to FITC, PE, APC or biotin as indicated; biotinylated mAbs were revealed with streptavidin–PerCP. All Antibodies were purchased from BD PharMingen. Surface expression for pT was performed according to manufacturer's protocol. Intracellular stainings for TCRß, IFN and Granzyme B (GrB) were performed with the Cytofix–Cytoperm Kit from Becton Dickinson (Alphen aan den Rijn, The Netherlands). Analysis was performed on a FACS Calibur using Cell Quest Software. Viable cells were gated on the basis of propidium iodide exclusions.
Foetal liver cell reconstitution and thymus transplantation
Foetal liver (14.5 dpc) cell suspensions from individual, genotyped pT tg/TCR–/– embryos of pT tg/TCR–/– and TCR–/– time mated mice were injected intravenously into sub-lethally irradiated (4 Gy) 4-week-old nude mice. Eleven weeks after the reconstitution with foetal liver cells, some of the nude mice were analysed for the presence of ßT cells. A subset of the reconstituted nude mice received a thymus transplant from 15.5 dpc Rag2-deficient embryos under the kidney capsule. Six weeks after transplantation, the reconstituted and transplanted nude mice were analysed for the presence of ßT cells.
Adoptive transfer
ßT or ßT cells were sorted and labelled with CFSE (Invitrogen, Breda, The Netherlands). Half a million cells were injected intravenously into Rag–/–. Seven and 16 days later, lymph nodes (LNs) and spleen were isolated and cells were stained with anti-CD3–PE and anti-CD90–APC for flow cytometric analysis.
Stimulation of primary ßT, T and ßT cells
Cells were sorted on the basis of CD3
, CD90 and TCR staining and stimulated for 3 days with either ConA (5 µg ml–1) or plate-bound anti-CD3 mAb (50 µg ml–1, clone 145.2C11). Proliferation was measured by [3H]thymidine incorporation.
Allogenic response
C57Bl/6, pT tg/TCR–/– and TCR–/– mice were challenged intra-peritoneally with three to five million irradiated Balb/c splenocytes (50 Gy) on week 0, 2 and 6. Two weeks after the last boost, splenocytes were labelled with CFSE, and re-stimulated in vitro with irradiated (80 Gy) EL-4 (H-2b) or P815 (H-2d) cells at a ratio of 1 responder:10 stimulators in the presence of IL-2 (10 U ml–1). Using the CFSE profile of ßT cells from day 1, 3, 4 and 6, proliferation parameters such as responder frequency (the number of initial cells that are responding), burst size (the magnitude of the response) and proliferative capacity (average number of divisions of activated cells) were calculated as described (28). GrB production was determined after 10 days of in vitro culture and adding fresh IL-2 on day 3.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Generation of tg mice expressing pT
throughout T cell developmentTo express the pT
chain constitutively in all T cells, a transgene was derived that places pT under the transcriptional control elements (25) of the TCRß locus. Three founders were identified by Southern blot and PCR analysis (Fig. 1A and B).
|
To ensure that the tagged pT
transgene is functional, the transgene was introduced into a pT-deficient background and T cell development in pT tg and non-tg pT-deficient (pT–/–) and proficient mice was analysed. As expected, the pT transgene compensates for the developmental block that pT–/– thymocytes encounter at the DN III stage of development (23, 29). The presence of tg pT restores progression of DN III into DN IV, ISP and DP thymocytes, normalizes the ratio of CD4/CD8 subsets in pT tg/pT–/– thymi and increases the cellularity from about 10% in pT–/– to 50% in pT tg/pT–/–, relative to wild-type levels (Fig. 1C). The failure of tg pT to reconstitute the thymus cellularity completely likely relates to a general observation of reduced thymic cellularity in TCR and pT tg mice (4). In pT–/– mice, the development of T cells is favoured. As expected, the pT transgene restores the development of ßT cells and simultaneously reduces the frequency and number of T cells to wild-type levels. In conclusion, the constitutively expressed pT transgene is capable of reconstituting ß-selection in pT–/– mice.
Identification of a novel peripheral T cell subset in pT tg mice
In order to reveal any obvious differences in the composition of peripheral T cell subsets in pT tg mice compared with non-tg mice, the T cell subsets of the three independent pT tg founder lines were analysed by flow cytometry using the T cell markers CD3-, CD4-, CD8- and CD90.2 (Thy1.2)- specific mAbs. Interestingly, in pT tg mice, a unique T cell subset expressing high levels of CD90 and low level of CD3 could be identified, that is virtually absent in non-tg littermates. This subset is clearly distinguishable from conventional ßT or T cells expressing high levels of CD3 (Fig. 2A). Within the CD90highCD3low population, the majority of T cells lack CD4 and CD8 co-receptors, 20–40% express the CD8 and 1–3% express CD4. In all three founder lines, the CD90highCD3low population constitutes 2–5% of peripheral lymphocytes and 5–15% of T cells (Fig. 2A). Like the vast majority of mature ßT cells, these T cells resemble small lymphocytes that do not express CD25, CD44 or CD69 (data not shown). In conclusion, constitutive expression of pT allows the development of a unique CD90highCD3low T cell population.
|
In pT
tg mice, CD90highCD3low T cells constitute 2–5% of peripheral lymphocytes and coexist with conventional ßT cells. Whether their number and development are influenced in trans by ßT cells or in cis by TCR expression was addressed by crossing the pT tg onto a TCR-deficient background. In pT tg/TCR–/– mice, conventional ßT cells do not develop. In the absence of TCR, the frequency of CD90highCD3low cells increases from 2–5% to 8–10% of peripheral lymphocytes (Fig. 2B). The relative increase is accompanied by a 2- to 3-fold increase in their absolute number (from 2 ± 0.6 x 106 to 8.7 ± 1.0 x 106), which likely relates to a compensatory lymphopenic proliferation due to the absence of ßT cells (see below). Besides CD90highCD3low T cells, a CD90highCD3high T cell population is found.
The CD8 co-receptor is generally expressed as a CD8 homodimer on T cells and as a CD8ß heterodimer on cytotoxic ßT cells (30). The CD8+ subset of CD90highCD3low T cells expresses only the heterodimeric form of CD8 (Fig. 2B).
In summary, a constitutively expressed pT chain gives rise to a novel subset of mature CD90highCD3low T cells, but fails to compensate numerically the lack of ßT cells in a TCR-deficient background. Based on flow cytometry, these CD90highCD3low T cells express low levels of TCRß and CD3 in a stoichiometric ratio at the cell surface (data not shown). As these CD90highCD3low T cells develop independent of the TCR chain but express constitutively a ß/pT TCR, they are hereafter referred to as ßT cells.
Surface staining showed that these CD90highCD3low ßT cells express low levels of TCRß (Fig. 2C). Additionally, surface staining for pT showed that ßT cells express indeed pT, in contrast to CD90highCD3high T cells and ßT cells from wild-type mice (Fig. 2C). Furthermore, ßT cells express full-length pT as determined by RT–PCR (Fig. 2D) supporting that ßT cells require pT expression. This also excludes the possibility that ßT cells express a truncated splice variant of pT lacking the extracellular domain, as has been shown in TCRß-only cells of TCR-deficient mice (31). Interestingly, pT transcripts do not occur in CD90highCD3low cells of TCR-deficient mice explaining the absence of ßT cells in those mice. The detection of tg pT expression in T cells is consistent with the TCRß promotor activity in those cells.
ßT cells are related to ßT cells
To examine whether ßT cells are indeed thymus derived, dpc 14.5 foetal liver cells from pT tg/TCR–/– mice were adoptively transferred into sub-lethally irradiated nude mice, which are thymus deficient. Eleven weeks after reconstitution, the mice were analysed for the presence of ßT cells (Fig. 3A). The absence of ßT cells in the reconstituted nude mice implies their thymic origin. Indeed, when the pT tg/TCR–/– foetal liver reconstitution was followed by transplantation of dpc 15.5 foetal Rag2–/– thymic lobes 6 weeks after transplantation, the peripheral T cell compartments of these mice contained, besides the expected conventional T cells from host-derived bone marrow stem cells, foetal liver stem cell-derived ßT cells (Fig. 3A). Thus, the thymus transplant supports the development of ßT cells clearly demonstrating the thymic origin of ßT cells.
|
Given the finding that ßT cells express low levels of TCR–CD3 complexes, we made use of CD3 and the immaturity marker CD24 to distinguish mature ßT cells (CD3lowCD24low) from mature
ß/ thymocytes (CD3highCD24low) and immature thymocytes (CD3lowCD24high) (Fig. 3B). In pT tg mice, a small CD24lowCD3low thymic compartment develops that is virtually absent in wild-type and TCR–/– mice. This compartment is even more prominent in pT tg/TCR–/– mice. The TCR co-receptor expression pattern of these CD24lowCD3low thymocytes is similar to the one found on peripheral ßT cells. The low frequency (0.1–0.2%) of mature ßT cells in pT tg as well as pT tg/TCR–/– thymi suggests that the maturation of ßT cells underlies rigid selection.
In summary, ßT cells develop independently of conventional ßT cells and do not require TCR chain expression. In addition, consistent with the expected requirement of a functionally rearranged TCRß locus, ßT cells do not develop in pT tg/Rag2-deficient mice (data not shown).
Proliferation and survival of ßT cells in vivo and in vitro
To further elucidate whether ßT cells resemble mature lymphocytes, the proliferative and survival capacity of ßT cells was compared with that of ßT cells in vivo. A total of 0.5 million sorted ßT and ßT cells from spleens of pT tg/TCR–/– mice and wild-type mice, respectively, were labelled with CFSE and adoptively transferred into Rag-deficient mice. Seven and 16 days after transfer, peripheral lymphoid compartments of three recipient mice were pooled for the analysis for presence and proliferation of ßT cells and ßT cells in vivo (Fig. 4A). The number and proliferative capacity of ßT and ßT cells were very similar. The low event number is explained by the low number of transferred cells. Apparently, in this lymphopenic setting, the homeostasis of ßT cells is similar to that of ßT cells. The fact that only mature T cells undergo lymphopenic proliferation in peripheral organs indicates that ßT cells resemble mature T cells.
|
Besides homeostatic proliferation, the responsiveness of ßT cells to polyclonal T cell stimuli was examined in vitro. Both
ß and T cells are known to proliferate in response to the T cell-specific lectin ConA or to cross-linking of their TCR complexes with coated CD3-specific mAbs. Peripheral ßT cells do not proliferate in response to ConA, but mount a normal proliferative response upon cross-linking with CD3-specific mAb (Fig. 4B). The failure of ßT cells to respond to ConA suggests differential glycosylation and/or binding/cross-linking capability of ConA to the highly expressed TCRß on T cells compared with the low levels of pre-TCR on ßT cells. The fact that peripheral ßT cells proliferate rather than die in response to CD3 cross-linking is an additional indication that peripheral ßT cells resemble mature T cells.
ßT cells respond to allogenic MHC
Apparently, a subset of thymocytes expressing the pT chain constitutively develops in a thymus-dependent manner into mature ßT cells. These ßT cells derive from a large pool of DP thymocytes and share many features with conventional ßT cells. We further analysed the functional capacity of ßT cells. We determined whether H-2b-derived ßT cells are capable of mounting a response to allogenic MHC. pT tg/TCR–/– and wild-type mice (H-2b) were immunized three times with allogenic splenocytes (Balb/c, H-2d) and splenocytes were re-stimulated in vitro with the tumour cell line P815 (H-2d) or EL4 (H-2b) (Fig. 5A). The percentage of cells that had been triggered to divide (responder frequency) and the mean of divisions among those cells that had divided at least once (burst size) were calculated according to Walmsley (28). Consistent with published estimates, the responder frequency of normal mice towards allogenic stimulators is in the range of 1–10% (32). Intriguingly, a subset of ßT cells (4%) is capable of responding to allogenic stimulators (Fig. 5B). The CD4–CD8–, CD4+ or CD8+ ßT cells participate to a similar extent in the allogenic response (data not shown). On average, antigen-reactive ßT cells divide 2.4 times and ßT cells 3.6 times within 4 days (burst sizes). The proliferative capacity of ßT cells compared with ßT cells was three times higher (31 versus 9, respectively).
|
To examine whether ßT cells are capable of effector function, the production of GrB was analysed by flow cytometry following 10 days in vitro re-stimulation of ßT and
ßT cells with allogenic P815 and syngenic EL4 cells, respectively (Fig. 5C). Interestingly, 61% of CD8+ ßT cells produce GrB, compared with 48% of CD8– ßT cells. |
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Prior to the acquisition of the second receptor chain, lymphoid precursors express surrogate IgL and pT
chains that allow IgH and TCRß chains to assemble into pre-BCR and pre-TCR complexes, respectively. In terms of structure, composition and signalling function, these precursor forms of AgRs are very similar to AgRs on mature lymphocytes and are critical checkpoints in controlling the development of precursor lymphocytes. Once, expression of the surrogate AgR is achieved, V to J rearrangement at Ig light and TCR chain gene loci commences, which eventually leads to the replacement of the surrogate chain by Ig
or light chains or the TCR chain. Thus, the assembly of AgRs is a prerequisite for and parallels lymphocyte development. The final differentiation of bone marrow-derived IgM-expressing B cells and thymus-derived ßT cells is associated with a transcriptional termination of VpreB/5 and pT chain expression, respectively.
While pT–/– mice clearly identified a critical function of the pT chain in early T cell development (23), constitutive surface expression of the pre-TCR is required to address the developmental potential beyond ß-selection. Transgenic mice were derived that express pT under transcriptional control elements of the TCRß locus, in the absence of TCR chains. In this setup, three possibilities can be envisaged. (i) Maturation of thymocytes does not take place in the absence of the TCR chain. (ii) Due to constitutive expression and autonomous signalling by the pre-TCR in the absence of ligand binding (17, 33), most thymocytes mature. (iii) Selective pre-TCRs are capable of interaction with MHC molecules, driving maturation of some but not all thymocytes. In the latter case, only a subset of thymocytes is expected to mature and might even be capable of responding to allogenic MHC molecules. Here, we clearly demonstrate that constitutive expression of pT indeed allows a small fraction of ß-selected DP thymocytes to mature into post-thymic, peripheral T cells. The low frequency of mature ßT cells in the thymus compared with their DP precursors suggests thymic selection. In addition, ßT cells develop independently of TCR, require expression of TCRß and differentiate intra-thymically into co-receptor-positive (CD8ß+ or CD4+) and -negative (CD4–8–) compartments. The increased frequency of mature ßT cells in TCR-deficient thymi most likely relates to the absence of competition of pT and TCR chains for dimerization with the TCRß chain. The fact that 0.2% thymic ßT cells generate up to 10% of all peripheral lymphocytes and the expansion of adoptively transferred ßT cells in Rag-deficient recipients strongly supports the idea that mature ßT cells like conventional ßT cells can undergo homeostatic proliferation.
The pT/TCRß-expressing thymocytes develop into CD8+ and some into CD4+ co-receptor-positive cells indicating that lineage commitment does not necessitate expression of TCR chains. That only 1–3% of ßT cells express the CD4 co-receptor suggests that pre-TCR signals do not deliver the sustained signalling thought to be required for CD4 SP differentiation (for review see 16). The Vß usage of ßT cells is comparable to ßT cells, suggesting that all segments can promote the development of ßT cells (data not shown). No reaction was observed for ßT cells in a mixed primary lymphocyte reaction of ßT cells with allogenic irradiated Balb/c splenocytes. Yet, MHC recognition by ßT cells is suggested by the ability of ßT cells to respond to allogenic MHC in a recall response, although we cannot exclude that allorecognition is due to another receptor than the pre-TCR at present. Subsequent experiments are required to address whether the pre-TCR is the relevant antigen recognition unit. These observations contrast a similar study in which CD8+/CD3low cells developed when a pT transgene was placed under the proximal lck promotor (34). Based on northern blotting from total non-sorted LN tissue, these CD8+ cells were interpreted to be pT negative and capable of developing normally in an MHC-deficient environment, suggesting that recognition of MHC antigens by the pre-TCR is not required for thymic selection. Either our ßT cells (Fig. 2C) differ from the lck-driven pT tg T cells with regard to pre-TCR expression (34), or alternatively, the pre-TCR is expressed and non-classical MHC molecules or leaky MHC class I heavy chains support the development of CD8+ cells. Therefore, constitutive ligand-independent tickling by the pre-TCR is quite unlikely to explain the inefficient intra-thymic maturation of ßT cells, as has been previously suggested (34). Our observations that ßT cells do express the pre-TCR (Fig. 2C), resemble small resting T cells lacking expression of activation markers and seem to be capable of alloresponse (Fig. 5) are in line with the maturation of a very small subset of ß-selected thymocytes into mature small resting ßT cells.
Two opposing evolutionary scenarios could explain the existence of pT: (i) the pT chain evolved after TCRß to fulfil its function in ß-selection (35) and (ii) prior to the evolution of TCR, the pT/TCRß heterodimer resembled an immunocompetent AgR. Two predictions can be derived from the latter scenario. First, the pre-TCR should be able to mediate cognate antigen recognition of self-MHC molecules. Here, the pre-TCR antigen recognition would largely be determined by the TCRß chain. Second, precursor T lymphocytes expressing the pre-TCR constitutively throughout development would undergo intra-thymic selection and maturation. Our data are in favour of the second scenario.
In addition, since AgRs are generated by somatic recombination of two complex gene loci, it is very unlikely that they have evolved simultaneously. Based on these considerations, we would like to propose an alternative model, in which the sequential rearrangement of AgR chains during lymphocyte development resembles a time lapse of lymphocyte and AgR evolution. In this scenario, the development of lymphocytes from lymphoid progenitors might recapitulate the stepwise acquisition of complex AgR gene loci during evolution. Accordingly, the maintenance of the non-rearranging surrogate receptor chain genes throughout evolution reflects the necessity of lymphocytes to receive AgR signals that warrant survival at each stage of their development (2, 4, 5, 36, 37).
Crystallographic analysis of TCRß–pMHC complexes have revealed that specific recognition of the pMHC complex by the TCRß can be largely determined by the V domain, the Vß domain or both (13, 14, 38, 39). These data indicate that a single Vß domain is principally capable of pMHC recognition. We show here that indeed the Vß domain can be sufficient to allow T cell development in the absence of the TCR chain generating immunocompetent ßT cells. We speculate that with the evolution of the TCR locus, the pT locus got modified such that it fulfils a function in ß-selection only. During this process, it might have been important to delay thymic selection and delete TCR V-like domains within the pre-TCR. This will prevent that ßT cell precursors are selected twice, first on the basis of the pre-TCR specificity (which is not relevant) and second on the basis of the specificity of the clonotypic TCRß (which is relevant).
|
Acknowledgements |
|---|
We would like to thank J. Fehling for kindly providing the genomic pT
fragment. We also like to thank J. P. Dangy and R. Allensbach for technical assistance and M. Dessing and A. Pfauth for help with the flow cytometry. Furthermore, we would like to thank T. Schumacher, J. Borst and R. Arens for critical reading of the manuscript. The work was initially financed by F. Hoffmann-La Roche Ltd, Basel, Switzerland, which founded and supported the former Basel Institute for Immunology, and subsequently by The Netherlands Cancer Institute SFN SFR 2.1.29. |
Abbreviations |
|---|
| AgR, antigen receptor |
| DN, double negative |
| DP, double positive |
| GrB, Granzyme B |
| ISP, immature single positive |
| LN, lymph node |
| pMHC, peptide MHC |
| pT, pre-TCR |
| RT, reverse transcription |
| tg, transgenic |
|
Notes |
|---|
Transmitting editor: J. Borst
Received 21 February 2006, accepted 21 March 2006.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
- Davis MM and Bjorkman PJ. (1988) T-cell antigen receptor genes and T-cell recognition. Nature 334:395.[CrossRef][Medline]
- Borst J, Jacobs H, Brouns G. (1996) Composition and function of T-cell receptor and B-cell receptor complexes on precursor lymphocytes. Curr. Opin. Immunol 8:181.[CrossRef][ISI][Medline]
- Melchers F, Haasner D, Grawunder U, et al. (1994) Roles of IgH and L chains and of surrogate H and L chains in the development of cells of the B lymphocyte lineage. Annu. Rev. Immunol 12:209.[CrossRef][ISI][Medline]
- Rodewald HR and Fehling HJ. (1998) Molecular and cellular events in early thymocyte development. Adv. Immunol 69:1.[ISI][Medline]
- Rajewsky K. (1996) Clonal selection and learning in the antibody system. Nature 381:751.[CrossRef][Medline]
- Von Boehmer H, Aifantis I, Azogui O, et al. (1998) Crucial function of the pre-T-cell receptor (TCR) in TCR beta selection, TCR beta allelic exclusion and alpha beta versus gamma delta lineage commitment. Immunol. Rev 165:111.[CrossRef][ISI][Medline]
- Von Boehmer H, Aifantis I, Feinberg J, et al. (1999) Pleiotropic changes controlled by the pre-T-cell receptor. Curr. Opin. Immunol 11:135.[CrossRef][ISI][Medline]
- Von Boehmer H. (2004) Selection of the T-cell repertoire: receptor-controlled checkpoints in T-cell development. Adv. Immunol 84:201.[ISI][Medline]
- Godfrey DI, Kennedy J, Suda T, Zlotnik A. (1993) A developmental pathway involving four phenotypically and functionally distinct subsets of CD3-CD4-CD8- triple-negative adult mouse thymocytes defined by CD44 and CD25 expression. J. Immunol 150:4244.[Abstract]
- Mallick CA, Dudley EC, Viney JL, Owen MJ, Hayday AC. (1993) Rearrangement and diversity of T cell receptor beta chain genes in thymocytes: a critical role for the beta chain in development. Cell 73:513.[CrossRef][ISI][Medline]
- Dudley EC, Petrie HT, Shah LM, Owen MJ, Hayday AC. (1994) T cell receptor beta chain gene rearrangement and selection during thymocyte development in adult mice. Immunity 1:83.[CrossRef][ISI][Medline]
- Malissen B, Ardouin L, Lin SY, Gillet A, Malissen M. (1999) Function of the CD3 subunits of the pre-TCR and TCR complexes during T cell development. Adv. Immunol 72:103.[ISI][Medline]
- Garcia KC, Teyton L, Wilson IA. (1999) Structural basis of T cell recognition. Annu. Rev. Immunol 17:369.[CrossRef][ISI][Medline]
- Garcia KC, Degano M, Pease LR, et al. (1998) Structural basis of plasticity in T cell receptor recognition of a self peptide-MHC antigen. Science 279:1166.
[Abstract/Free Full Text] - Germain RN. (2003) Ligand-dependent regulation of T cell development and activation. Immunol. Res 27:277.[CrossRef][Medline]
- Singer A and Bosselut R. (2004) CD4/CD8 coreceptors in thymocyte development, selection, and lineage commitment: analysis of the CD4/CD8 lineage decision. Adv. Immunol 83:91.[ISI][Medline]
- Jacobs H, Vandeputte D, Tolkamp L, de Vries E, Borst J, Berns A. (1994) CD3 components at the surface of pro-T cells can mediate pre-T cell development in vivo. Eur. J. Immunol 24:934.[ISI][Medline]
- Jacobs H, Iacomini J, van de Ven M, Tonegawa S, Berns A. (1996) Domains of the TCR beta-chain required for early thymocyte development. J. Exp. Med 184:1833.
[Abstract/Free Full Text] - Jacobs H, Ossendorp F, de Vries E, et al. (1996) Oncogenic potential of a pre-T cell receptor lacking the TCR beta variable domain. Oncogene 12:2089.[ISI][Medline]
- Irving BA, Alt FW, Killeen N. (1998) Thymocyte development in the absence of pre-T cell receptor extracellular immunoglobulin domains. Science 280:905.
[Abstract/Free Full Text] - Fehling HJ, Iritani BM, Krotkova A, et al. (1997) Restoration of thymopoiesis in pT alpha-/- mice by anti-CD3epsilon antibody treatment or with transgenes encoding activated Lck or tailless pT alpha. Immunity 6:703.[CrossRef][ISI][Medline]
- Haks MC, Belkowski SM, Ciofani M, et al. (2003) Low activation threshold as a mechanism for ligand-independent signaling in pre-T cells. J. Immunol 170:2853.
[Abstract/Free Full Text] - Fehling HJ, Krotkova A, Saint-Ruf C, Von Boehmer H. (1995) Crucial role of the pre-T-cell receptor alpha gene in development of alpha beta but not gamma delta T cells. Nature 375:795.[CrossRef][Medline]
- Uematsu Y, Ryser S, Dembic Z, et al. (1988) In transgenic mice the introduced functional T cell receptor beta gene prevents expression of endogenous beta genes. Cell 52:831.[CrossRef][ISI][Medline]
- Krimpenfort P, de Jong R, Uematsu Y, et al. (1988) Transcription of T cell receptor beta-chain genes is controlled by a downstream regulatory element. EMBO J 7:745.[ISI][Medline]
- Krimpenfort P, Ossendorp F, Borst J, Melief C, Berns A. (1989) T cell depletion in transgenic mice carrying a mutant gene for TCR-beta. Nature 341:742.[CrossRef][Medline]
- Fehling HJ, Laplace C, Mattei MG, Saint-Ruf C, Von Boehmer H. (1995) Genomic structure and chromosomal location of the mouse pre-T-cell receptor alpha gene. Immunogenetics 42:275.[Medline]
- Walmsley MJ, Ooi SK, Reynolds LF, et al. (2003) Critical roles for Rac1 and Rac2 GTPases in B cell development and signaling. Science 302:459.
[Abstract/Free Full Text] - Xu Y, Davidson L, Alt FW, Baltimore D. (1996) Function of the pre-T-cell receptor alpha chain in T-cell development and allelic exclusion at the T-cell receptor beta locus. Proc. Natl Acad. Sci. USA 93:2169.
[Abstract/Free Full Text] - Parnes JR. (1989) Molecular biology and function of CD4 and CD8. Adv. Immunol 44:265.[ISI][Medline]
- Barber DF, Passoni L, Wen L, Geng L, Hayday AC. (1998) The expression in vivo of a second isoform of pT alpha: implications for the mechanism of pT alpha action. J. Immunol 161:11.
[Abstract/Free Full Text] - Bevan MJ, Langman RE, Cohn M. (1976) H-2 antigen-specific cytotoxic T cells induced by concanavalin A: estimation of their relative frequency. Eur. J. Immunol 6:150.[Medline]
- Yamasaki S, Ishikawa E, Sakuma M, et al. (2006) Mechanistic basis of pre-T cell receptor-mediated autonomous signaling critical for thymocyte development. Nat. Immunol 7:67.[CrossRef][ISI][Medline]
- Ito Y, Arai S, van Oers NS, Aifantis I, Von Boehmer H, Miyazaki T. (2002) Positive selection by the pre-TCR yields mature CD8+ T cells. J. Immunol 169:4913.
[Abstract/Free Full Text] - Buer J, Aifantis I, DiSanto JP, Fehling HJ, Von Boehmer H. (1997) Role of different T cell receptors in the development of pre-T cells. J. Exp. Med 185:1541.
[Abstract/Free Full Text] - Polic B, Kunkel D, Scheffold A, Rajewsky K. (2001) How alpha beta T cells deal with induced TCR alpha ablation. Proc. Natl Acad. Sci. USA 98:8744.
[Abstract/Free Full Text] - Lam KP, Kuhn R, Rajewsky K. (1997) In vivo ablation of surface immunoglobulin on mature B cells by inducible gene targeting results in rapid cell death. Cell 90:1073.[CrossRef][ISI][Medline]
- Reiser JB, Darnault C, Gregoire C, et al. (2003) CDR3 loop flexibility contributes to the degeneracy of TCR recognition. Nat. Immunol 4:241.[CrossRef][Medline]
- Di Santo JP, Aifantis I, Rosmaraki E, et al. (1999) The common cytokine receptor gamma chain and the pre-T cell receptor provide independent but critically overlapping signals in early alpha/beta T cell development. J. Exp. Med 189:563.
[Abstract/Free Full Text]
CiteULike 
Connotea 
Del.icio.us What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||