Skip Navigation


International Immunology Advance Access originally published online on March 28, 2006
International Immunology 2006 18(5):689-699; doi:10.1093/intimm/dxl006
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/5/689    most recent
dxl006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Masli, S.
Right arrow Articles by Streilein, J W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masli, S.
Right arrow Articles by Streilein, J W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Japanese Society for Immunology. 2006. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Thrombospondin orchestrates the tolerance-promoting properties of TGFß-treated antigen-presenting cells

Sharmila Masli1,2,, Bruce Turpie1 and J Wayne Streilein1,2,*

1 Schepens Eye Research Institute and
2 Department of Ophthalmology, Harvard Medical School, 20 Staniford Street, Boston, MA 02114, USA

Correspondence to: S. Masli; E-mail: smasli{at}vision.eri.harvard.edu


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Eye-derived antigen-presenting cells (APCs) are known to contribute to the immune privilege status of the eye by inducing a form of peripheral tolerance that deviates Th1 type of pro-inflammatory immune responses. Similar systemic tolerance can also be induced by non-ocular APCs exposed to transforming growth factor ß (TGFß) in vitro. Such APCs were found to express enhanced levels of thrombospondin (TSP)-1, an extracellular matrix (ECM) protein. In this report, we analyzed the significance of TSP-1 in conferring tolerance-inducing properties on APCs. While TSP-treated APCs matched TGFß-treated APCs in their functional ability to induce systemic tolerance, a deficiency of TSP-1 or its receptor CD36 prevented APCs from becoming tolerogenic in response to TGFß. Exogenous TSP-1 restored tolerogenic ability of TGFß-treated TSP-1 null APCs. Both TGFß-treated TSP-1 null and CD36 knockout APCs failed to inhibit IL-12 secretion. Furthermore, TGFß-treated TSP-1 null APCs, unlike similarly treated wild-type APCs, failed to increase secretion of active TGFß. Similar to TGFß, TSP could also up-regulate expression of MIP-2, TGFß2 and tumor necrosis factor {alpha}—all of which are required for tolerance induced by TGFß-treated APCs. We conclude that TSP-1, an ECM protein induced by TGFß treatment, orchestrates the changes in APC functional programs that equip these cells to promote tolerance of the eye-derived type.

Keywords: antigen presentation/processing, monocytes/macrophages, tolerance


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Immune privilege detected in the ocular environment has been attributed to various factors including unique properties of resident cells, soluble factors released or surface molecules expressed by these cells and contents of aqueous humor in the anterior segment of the eye (1–4). Among the resident cells studied extensively are F4/80+ antigen-presenting cells (APCs). These cells have been demonstrated to possess unique property of presenting antigen in a manner that deviates immune response away from typical Th1 type of an inflammatory response (5, 6). These APCs are also known to generate regulatory T cells in the spleen that are involved in maintaining a form of peripheral tolerance to eye-derived antigens (7–9). It is also of great interest that these APCs are able to impose this tolerance on pre-sensitized recipients (10). This particular feature makes mechanisms utilized by these APCs suitable to develop potential therapeutic approaches to prevent clinical transplant rejections as well as immunopathogenic diseases mediated by Th1. Therefore, understanding molecular mechanisms employed by transforming growth factor ß (TGFß)-treated APCs is of significance not only to understand ocular pathologies but also as a tool to develop future immunotherapeutics.

The ability of resident ocular APCs to deviate immune response has been attributed to their exposure to TGFß in the local environment (11). It has been shown that non-ocular APCs such as thioglycollate-elicited peritoneal macrophages or macrophage hybridoma cell line when exposed to TGFß in culture can also acquire the ability to deviate immune response away from Th1 type and induce peripheral tolerance (7, 9). Therefore, it has been possible to study the mechanisms underlying the interactions of these APCs with T cells at a molecular level. These APCs when co-cultured with pre-sensitized T cells could decrease their IFN{gamma} secretion and enhance IL-4 secretion (12). Also, naive T cells co-cultured with these APCs were found to bear regulatory properties and could suppress a Th1-mediated delayed-type hypersensitivity (DTH) response (13, 14). APCs treated with TGFß have been shown to secrete increased levels of TGFß, tumor necrosis factor {alpha} (TNF{alpha}), IL-10 and lowered ability to secrete IL-12 (12, 15–17). Surface expression of CD40 was also found decreased in these APCs. In an attempt to explore molecular mechanisms in further detail, our group previously reported differentially expressed genes in such TGFß-treated APCs. Expression of genes such as thrombospondin (TSP), type I IFNs and macrophage inflammatory protein-2 (MIP-2) was found up-regulated in TGFß-exposed APCs as compared with untreated APCs, whereas expression of genes such as CD40 and nuclear factor kappa B (NF{kappa}B) p105 was found decreased (18). MIP-2 expressed by TGFß-treated APCs was reported to be involved in recruiting NK T cells to the spleen where these APCs were demonstrated to form a cluster with T cells together with NKT cells that leads to generation regulatory T cells (19).

In this report, we have assessed the role of TSP in the ability of TGFß-treated APCs to induce immune deviation and promote peripheral tolerance. TSP is well known to be a family of extracellular matrix (ECM) protein with five known isoforms (TSP-1, -2, -3, -4 and -5). Of these, TSP-1 and TSP-2 are extensively studied for their antiangiogenic properties and roles in activation of TGFß (20, 21). Pleiotropic effects of TSP are exerted by its binding to various receptors including CD47, CD36, low-density lipoprotein receptor-related protein, integrins ({alpha}3ß1, {alpha}vß3) and various proteoglycans. In recent years, TSP-1 has been found to have a role to play in regulation of immune responses. By binding CD47 on monocytes, TSP-1 was reported to selectively inhibit their IL-12 production (22, 23). Also CD47 is expressed on T cells and it was noted that ligation of this receptor altered the TCR-mediated signaling pathways and was also found to prevent the development of Th1 effectors from naive T cells (24, 25). Activation of latent TGFß produced by macrophages has been demonstrated to require CD36 ligation by TSP (26). While TSP was also found to inhibit cytokine production by and maturation of immature dendritic cells (DCs) in response to bacterial stimulation, more recently it has been reported as a potential negative regulator of DC maturation (27–29). Together, these reports support the possibility that TSP may play a significant role in immune deviation induced by TGFß-treated APCs and generation of regulatory cells associated with this deviation. Our results demonstrate that TSP-1 induced in response to TGFß exposure of APCs plays a central role in that deficiency of TSP or its receptor CD36 on macrophages prevents their ability to become tolerogenic. TSP contributes to functional phenotype of TGFß-treated APCs by facilitating activation of newly synthesized TGFß and down-regulating IL-12 secretion thereby preventing Th1-mediated responses.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice
C3D2/F1 (C3H/HeJ x DBA2/J-H-2k/d) and C57BL/6 (H-2b) mice, 6- to 8-weeks old, were purchased from Jackson Laboratories (Bar Harbor, ME, USA). TSP-1 null mice (C57BL/6 background) were a generous gift from the laboratory of J. Lawler (Beth Israel-Deaconess Medical Center, Harvard Medical School, Boston, MA, USA) and CD36 knockout (KO) mice (C57BL/6 background) from the laboratory of M. Freeman (Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA).

Hybridomas and cell culture
Macrophage hybridoma clone #59 is a fusion product of macrophages harvested from the spleen of a CKB (H-2k) mouse and P388D1 tumor cell line (H-2d) (30). Cells were cultured and maintained in complete RPMI 1640 (BioWhittaker, Walkersville, MD, USA) containing 1% HEPES, 1% penicillin–streptomycin, 1% glutamine, 10% fetal bovine serum, 1% sodium pyruvate, 1% non-essential amino acids (NEAAs).

Serum-free medium
Serum-free medium (SFM) was used for in vitro assays. The medium contained RPMI 1640, 10 mM HEPES, 0.1 mM NEAA, 1 mM sodium pyruvate, 100 U ml–1 penicillin, 100 mg ml–1 streptomycin (BioWhittaker), 0.1% BSA (Sigma Chemical Co., St Louis, MO, USA) and ITS+ culture supplement [1 µg ml–1 iron-free transferrin, 10 ng ml–1 linoleic acid, 0.3 ng ml–1 Na2Se and 0.2 µg ml–1 Fe(NO3)3] (Collaborative Biomedical Products, Bedford, MA, USA).

Preparation of peritoneal exudate cells
Peritoneal exudate cells (PECs) were obtained from C57BL/6 (wild type) or TSP-1 KO mice that received intra-peritoneally 2 ml of a 3% thioglycollate solution (Sigma Chemical Co.) 3 days earlier. Cells were cultured (either in a 96-well flat-bottom or 24-well culture plate) in SFM overnight in the presence or absence of the antigen and/or TGFß2. After overnight cultures, cells were washed three times with culture medium to remove TGFß2 and non-adherent cells. Adherent cells were used as APCs. Cells collected by this method are F4/80+ (>90%) and CD11b+ (>99%) (16, 31).

In vitro treatment of APCs with cytokines or TSP-1
APCs (#59 or thioglycollate-elicited PECs) were cultured (1 x 105 per well) in a 96-well plate overnight with TGFß2 (R&D Systems, CA, USA, 5 ng ml–1 final concentration), IFNß (PharMingen, San Diego, CA, USA, 5 ng ml–1) or TSP (Haematologic Technologies, Inc., VT, USA, 1 µg ml–1) in serum-free culture medium and pulsed with antigen ovalbumin peptide (OVA) (7 mg ml–1). In some experiments, culture supernatants were collected at 48-h interval and were tested for either IL-12p70 or TNF{alpha} levels by ELISA (R&D Systems). Cytokine levels are reported as ‘not detected’ when absorbance readings of samples tested were less than or equal to absorbance of the blank sample in the assay.

Flow cytometry
Hybridoma cells were analyzed by flow cytometry to assess cell surface expression of CD36, CD47 or IFN{alpha}/ßR. Cells were stained with FITC-conjugated primary anti-CD47 (PharMingen) or unlabeled primary anti-IFN{alpha}/ßR or anti-CD36 antibodies (Santacruz Biotechnology, Inc., CA, USA). FITC-conjugated secondary antibody (Santacruz Biotechnology, Inc.) was used to detect unlabeled antibodies. Matching isotype antibodies were used as control. Stained cells were washed with PBS containing 1% BSA and analyzed on a Coulter Epics XL flow cytometer and Coulter system II software.

Assay for tolerance induction or immune deviation
Seven days after intravenous infusion of OVA-pulsed APCs subjected to various in vitro treatments (2 x 10 3 to 5 x 10 3 per mouse), recipients were immunized subcutaneously into the nape of the neck with OVA/CFA (50 µg). A week later these animals received intra-dermal inoculation of OVA (200 µg per 20 µl) into their right ear pinna. The left ear served as an untreated control. Thickness of both ears was measured immediately before and at 24-h interval after the OVA injection using a micrometer (Mitutoyo 227-101, MTI Corp., Paramus, NJ, USA). The measurements were performed in triplicates.

DTH was measured as change in ear swelling [(24-h measurement – 0-h measurement in the experimental ear) – (24-h measurement – 0-h measurement in the untreated control ear)]. Tolerance induction or assay for tolerance induction or immune deviation (ACAID) was detected as the suppression in DTH in the experimental groups as compared with the positive control. A two-tailed Student's t-test was used with significance assumed at P ≤ 0.05. DTH results were confirmed by repeating the experiments.

Bioassay to measure TGFß in culture supernatants
Biologically active TGFß was measured by Mv1Lu cells (ATCC, Rockville, MD, USA). For the detection of active TGFß, culture supernatants were diluted (1:4) with Eagle's minimum essential medium (EMEM) (BioWhittaker) containing 2 mM L-glutamine, 10 mM HEPES, 0.1 mM NEAAs, 1 mM sodium pyruvate, 100 U ml–1 penicillin, 100 mg ml–1 streptomycin and 0.5% FCS. To measure the total TGFß (active + latent), supernatants were acid treated (1 N HCl, 1:10) for 1 h followed by neutralization with a mixture of 1 N NaOH:1 M HEPES (1:5). These acid-treated supernatants were further diluted (1:10) with complete EMEM. Samples (100 µl) were added to a 96-well flat-bottom plate. Mv1Lu cells (1 x 10 5 per 100 µl) were then added to each well and cultures were incubated for 26 h at 37°C in an atmosphere of 5% CO2. Cultures were pulsed with 1 µCi of 3[H]-thymidine for 8 h prior to harvesting. Radioactivity was measured as counts per minute and half-maximal inhibition was determined by polynomial regression on log–log transformation of standard curves and experimental samples. The results were expressed as picogram per milliliter.

RNA isolation
Total RNA was isolated from cells using RNA STAT-60 kit (Tel-Test, Inc., Friendswood, TX, USA) according to the manufacturer's instructions provided. This kit utilizes single-step method by acid guanidinium thiocyanate–phenol–chloroform extraction.

Reverse transcription–PCR
cDNA was synthesized by reverse transcribing RNA using random hexamers and AMV RT (Promega, Madison, WI, USA). For PCR amplification, cDNAs were amplified using various primers as listed: (5'–3' sequences) F-MIP-2, CCTGCCAAGGGTTGACTTCA, R-MIP-2, AGACACGAAAAGGCATGACA (852 bp); F-TGFß2, CACCACAAAGACAGGAACCTGG, R-TGFß2, GCGAAGGCAGCAATTATCCTGCAC (327 bp); F-TNF{alpha}, TAGCCCACGTCGTAGCAAAC, R-TNF{alpha}, ACGGCAGAGAGGAGGTTGAC (250 bp); F-TSP-1, GTT CGT CGG AAG GAT TGTTA, R-TSP-1, TCT ATT CCA ATG GCA ACG AG (733 bp); F-IL-12p40, AATTACTCCGGACGGTTCAC, R-IL-12p40, GGCCAAGTGGAATGCTAGAA (836 bp) and F-GAPDH, GGTGAAGGTCGGTGTGAACGGA, R-GAPDH, TGTTAGTGGGGTCTCGCTCCTG (245 bp). Intron-spanning primers for the specific amplification of selected genes were designed using gene sequences from the public database and software Oligo Primer Analysis software 6.0 (Molecular Biology Insights, Inc., Plymouth, MN, USA). PCRs were performed in a 50-µl amplification mixture containing 1x polymerase buffer, 2.5 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, 1 µM of forward and reverse primers and 1.25 U Taq polymerase (Perkin Elmer). Touchdown PCR analysis with a thermal profile of 94°C for 1 min, followed by 70–55°C at two cycles per degree for 2 min and 72°C for 3 min was performed in a thermal cycler (GeneAmp PCR System 2400, Perkin Elmer). After 30 thermal cycle amplification, the PCR products were separated by 1.5% agarose gel electrophoresis.

Semi-quantitative reverse transcription–PCR
PCRs were set up as described earlier using primers specific for TNF{alpha} or glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Amplification was accomplished at appropriate optimum temperatures for TNF{alpha} primers (58°C) and terminated at various cycles as indicated in the figures. Reaction products were detected using a 1.5% agarose/Tris acetate EDTA (TAE) gel containing 0.5 µg ml–1 ethidium bromide. Densitometric measurements of bands were used to calculate a ratio of the gene of interest (TNF{alpha})/GAPDH.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The ability of TSP to confer tolerance-inducing properties on APCs
Although peritoneal exudate macrophages are known to express TSP receptors CD36 and CD47, we confirmed their expression on the macrophage hybridoma cell line (#59) that is also known to acquire tolerogenic ability upon exposure to TGFß. Using fluorescent-tagged antibodies, we determined by flow cytometry the expression of CD36 and CD47 on #59 cells. As revealed in Fig. 1(A), a minor population of #59 cells expressed CD36, and all the cells stained positively for CD47. Similar levels of expression of these receptors were detected on TGFß-treated #59 cells (data not shown).


Figure 1
View larger version (7K):
[in this window]
[in a new window]
 
Fig. 1. TSP confers tolerance-inducing properties on APCs. (A) APCs stained with FITC-conjugated antibodies against (CD47 or purified anti-CD36) were analyzed by flow cytometry; dotted lines represent staining with isotype control antibodies and solid lines indicate CD47 or CD36 staining. (B) APCs (macrophage hybridoma #59) were cultured overnight with OVA (7 mg ml–1) in the presence of medium alone or TSP (1 µg ml–1) or TGFß2 (5 ng ml–1), washed with medium and injected (2 x 10 3) i.v. into C3D2F1 recipients. Seven days later, all the recipients (except those in negative control group) were immunized with OVA (50 µg) in CFA subcutaneously and 1 week later their ears were challenged with OVA (400 µg). Ear swelling responses measured after 24 h are presented as mean ± SEM. Animals in both positive and negative control groups did not receive any APCs. (*P < 0.05 compared with positive control).

 
Next we tested if TSP treatment alone is sufficient to confer tolerogenic properties on these APCs. To test this, we used a previously described assay that can detect the suppression of immunization mediated DTH (5). In this assay recipients are first infused with antigen-pulsed APCs intravenously (i.v.). A week later these animals are immunized with antigen in CFA and a week after that they are challenged with the same antigen in their ear pinnae. Ear swelling response is measured at 24-h interval to detect DTH. Suppression of DTH response is determined by comparing ear swelling responses of the animals in the experimental group and those from the control group that are immunized but do not receive any APCs. In this assay regulatory cells generated by tolerogenic APCs in the recipient spleen are expected to suppress inflammatory DTH response induced by subsequent immunization. Previously, TGFß-treated APCs (PEC or #59) have been shown to suppress DTH responses in this assay (7, 12, 17, 19). In order to study the effect of TSP on APCs, #59 cells were pulsed in vitro with antigen (OVA) and treated with TSP or TGFß. After overnight culture, these cells were harvested, washed and injected i.v. into naive recipients (C3D2F1). Seven days later, these recipients plus a group of animals that did not receive any APCs (positive control) were immunized subcutaneously with OVA in CFA. After 1 week, recipients were challenged with OVA by injecting it intra-dermally into their ear pinnae. A group of unimmunized mice were also ear challenged and served as a negative control. Ear swelling was measured 24 h later. As the results presented in Fig. 2(A) reveal, significantly increased ear swelling responses indicative of the presence of DTH were observed in positive control group animals as well as in recipients of untreated OVA-pulsed APCs. In contrast, recipients of TSP- or TGFß-treated OVA-pulsed APCs failed to mount significant DTH responses. Thus, TSP-1-treated APCs suppressed DTH response in a manner similar to TGFß-treated APCs. Therefore, TSP-1 was found to confer tolerance-promoting properties on #59 cells—a property shared with TGFß.


Figure 2
View larger version (22K):
[in this window]
[in a new window]
 
Fig. 2. TSP induces expression of genes essential for tolerance induction. (A) Total RNA was isolated from APCs (macrophage hybridoma #59) that were untreated or TSP (1 µg ml–1) treated. These RNA samples were subjected to RT–PCR analysis as described in Methods using specific primers for MIP-2, TGFß2 and housekeeping gene GAPDH. PCR products were analyzed by ethidium bromide/agarose gel electrophoresis. (B1) Culture supernatants collected from overnight cultures of untreated or TSP-treated #59 were tested for the levels of TNF{alpha} using ELISA. Samples were tested from multiple cultures (four to five wells) and were analyzed in triplicates. Mean values of TNF{alpha} detected with SEM are presented. (B2) Total RNA isolated as described in (A) was assessed for TNF{alpha} message using semi-quantitative RT–PCR as described in Methods.

 
Gene expression patterns of APCs treated with TSP-1 resembles that seen in response to TGFß
The ability of TSP to influence APCs in a manner similar to TGFß prompted us to examine whether the pattern of gene expression in #59 cells treated with TSP resembled the gene expression pattern found in TGFß-treated cells. We chose to compare the expression of molecules that have previously been reported to play a significant role in immune deviation induced by TGFß-treated APCs such as TNF{alpha}, MIP-2 and TGFß2 (12, 17, 19). It was noted that the expression of these three molecules was essential for the induction of immune deviation. Neutralizing antibodies against MIP-2 and TGFß2 reportedly prevented generation of regulatory cells that participate in deviating immune response away from a conventional response. Local or systemic administration of neutralizing anti-TNF{alpha} antibodies prevented induction of immune deviation. Exact role of TNF{alpha} was evaluated in a separate study (in preparation). In response to TGFß, increased expression of TNF{alpha}, MIP-2 and TGFß2 has been shown previously. We now applied increased expression of these three molecules as an indicator of the immune deviation inducing ability of TGFß-treated APCs and accordingly examined their expression in TSP-treated APCs. Total RNA was isolated from #59 cells that were treated overnight with TSP and subjected to reverse transcription (RT)–PCR analysis for detection of MIP-2 and TGFß2. Compared with untreated APCs, expression of MIP-2 and TGFß2 was enhanced after TSP treatment of APCs (Fig. 2A). With respect to TNF{alpha} expression, culture supernatants collected from APCs treated with TSP were tested for TNF{alpha} protein using ELISA. Additionally, semi-quantitative RT–PCR was performed to confirm the increased TNF{alpha} levels. Both protein and message for TNF{alpha} were found increased in TSP-treated APCs (Fig. 2B and C). Thus, expression of the chosen three genes in TSP-treated APCs resembled that reported in TGFß-treated APCs.

Significance of TSP-1 in the ability of TGFß-treated APCs to induce immune deviation
We next sought to determine whether TSP-1 is essential to the process by which TGFß confers tolerance-inducing properties on APCs. In these experiments, PECs were harvested from TSP-1 null and wild-type (C57BL/6) mice. These cells were then pulsed with OVA and incubated overnight with TGFß. Thereafter, the cells were harvested, washed and injected i.v. into naive C57BL/6 recipients. These animals were immunized 1 week later with OVA plus CFA, and then ear challenged at 7 days with intrapinnae injections of OVA. The results of a representative experiment are presented in Fig. 3(A). In mice that received TGFß-treated PECs from wild-type donors, immunization with OVA/CFA did not lead to OVA-specific DTH (indicating active suppression of antigen-specific immunization). However, if mice received similarly treated PECs from TSP-1 null donors, the subsequent OVA/CFA immunization induced OVA-specific DTH (absence of suppression of an immune response). Although the ear swelling response in recipients of TGFß-treated TSP-1 null APCs appeared slightly diminished, this response was not significantly different from that observed in the control group that received untreated TSP-1 null APCs. Thus, OVA-pulsed, TGFß-treated APCs failed to suppress subsequent immunization with OVA plus adjuvant if these APCs were incapable of producing their own TSP-1.


Figure 3
View larger version (8K):
[in this window]
[in a new window]
 
Fig. 3. TSP is essential for the ability of TGFß-treated APCs to induce immune deviation/tolerance. Thioglycollate-elicited PECs from wild-type or TSP-1 null mice were pulsed with OVA and cultured overnight with or without TGFß2 (A) or TGFß2 and TSP (B). Adherent cells were harvested and injected i.v. into groups of naive C57BL/6 recipients. DTH assay was performed as described earlier and in Methods. Mean ear swelling responses ± SEM are presented. (*P < 0.05 compared with group receiving untreated APCs).

 
Furthermore, we tested if exogenous TSP could restore the ability of TSP-1 null APCs to suppress DTH upon their TGFß exposure. To address this possibility, PECs derived from TSP-1 null mice were pulsed with OVA in the presence of TGFß alone or with TSP and TGFß. After overnight cultures these APCs were infused i.v. into naive recipients as described earlier. This was followed by OVA/CFA immunization a week later and ear challenge with OVA in the following week. As presented in Fig. 3(B), exogenously added TSP was found to restore the DTH-suppressing ability of TGFß-treated TSP-1 null APCs.

TSP-1 facilitates active TGFß production by TGFß-treated APCs
The capacity of APCs treated with TGFß to promote regulatory T cells has been shown to depend in part on the enhanced capacity of these APCs to generate active TGFß (12). The ability of TSP to convert latent TGFß into its active form is well documented (32, 33). Also, alveolar macrophages have been reported to utilize TSP to activate their latent TGFß (26). Therefore, we tested if TGFß-treated APCs also require TSP in order to generate active TGFß. We examined the levels of latent and active TGFß in supernatants of cultures of TGFß-treated or untreated APCs from wild-type and TSP-1 null donors. Thioglycollate-induced PECs were cultured overnight in the presence or absence of TGFß. Subsequently, the culture plates were washed to remove unbound TGFß and non-adherent cells, and the adherent cells were re-cultured in SFM for 24 h. Supernatants were then removed and assayed for content of total (includes latent and active forms) and active TGFß using a bioassay. As the results presented in Fig. 4(A) indicate, both wild-type and TSP-1 null PECs responded to TGFß treatment by increasing significantly their production of total TGFß as compared with respective untreated PECs. It is important to note that the absolute levels of total TGFß detected in supernatants collected from both types of PECs (wild type and TSP-1 deficient) were comparable. However, TSP-1-deficient PECs produced far less ‘active’ TGFß as compared with wild-type PECs after being treated with TGFß (Fig. 4B). Thus, TSP-1 is required for TGFß-treated APCs to generate increased levels of active TGFß. However, enhanced production of latent TGFß by the same APCs is not affected by the absence of TSP-1.


Figure 4
View larger version (8K):
[in this window]
[in a new window]
 
Fig. 4. TGFß-treated APCs require TSP to activate their latent TGFß OVA-pulsed PECs from wild-type or TSP-1 null mice were cultured overnight with or without TGFß as described earlier. Non-adherent cells and TGFß were washed out completely and remaining cells were harvested re-cultured in SFM. After 24 h, culture supernatants were collected and tested for the presence of total (active + latent) TGFß (A) or active TGFß (B) using a bioassay (described in Methods). (*P < 0.05 compared with TGFß-treated wild-type APCs).

 
TSP-1 participates in inhibition of IL-12 secretion by TGFß-treated APCs
Previously, it has been shown that TGFß treatment of APCs (both PECs and macrophage hybridoma) impairs their ability to secrete IL-12 (16). This impaired expression of IL-12 is consistent with their ability to suppress DTH and induce systemic tolerance. Further, it was demonstrated in vitro as well as in vivo experiments that this IL-12 deficiency of TGFß-treated APCs was responsible for the deviation of effector T cells away from Th1 phenotype (34, 35). Therefore, regulation of IL-12 appears to contribute significantly to the tolerizing property of TGFß-treated APCs. According to some recent reports, TSP was found to regulate IL-12 secretion by human monocytes via ligation of CD47 (22). Therefore, we assessed whether TSP expressed by TGFß-treated APCs participates in inhibition of IL-12. To examine this, we cultured thioglycollate-elicited PECs derived from either wild-type or TSP-1 null mice in the presence of antigen (OVA) with or without TGFß or TSP. Consistent with the previously reported results, PECs derived from wild-type mice responded to TGFß by inhibiting their IL-12 secretion. Similar inhibition was detected in the presence of TSP (Fig. 5A). However, TSP-1-deficient APCs failed to suppress their IL-12 secretion. This observation was further confirmed by examining message levels for IL-12p40. As shown in Fig. 5(B), while message for IL-12p40 was decreased in wild-type APCs treated with TGFß, such a decrease was not detectable in TSP-1 null APCs treated with TGFß. These results are consistent with our previous results demonstrating the ability of TSP to suppress IL-12 secretion by IFN{gamma}-primed macrophage hybridoma cells (18). Furthermore, we also tested IL-12 secretion by such macrophage hybridomas in the presence of TSP-derived peptide (4N1K) known to bind CD47. In the presence of this peptide, and not the mutant peptide, IL-12 secretion of macrophage hybridoma was inhibited (data not shown). Our results therefore indicate that TSP expressed by TGFß-treated APCs is involved in mediating inhibition of IL-12, presumably via CD47 expressed by these APCs.


Figure 5
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5. TSP participates in inhibition of IL-12 secretion by TGFß-treated APCs. OVA-pulsed PECs from wild-type or TSP-1 null mice were cultured in the presence or absence of TGFß or TSP as described earlier. Culture supernatants were subjected to IL-12p70 ELISA and total RNA isolated from these cells was subjected to RT–PCR analysis to detect message for IL-12p40. GAPDH message served as a housekeeping gene control. (ND = not detected, *P < 0.05).

 
The inability of CD36-deficient APCs to acquire tolerance-inducing property upon TGFß exposure
Among the various receptors that TSP is known to bind, it is through binding CD36 TSP has been reported to activate latent TGFß in alveolar macrophages (26). Taking into account the known ability of TGFß-treated APCs to synthesize increased levels of TGFß and the fact that active TGFß produced by these APCs is essential for their ability to induce immune deviation, we explored the role of CD36 in allowing APCs to acquire their tolerizing properties in the presence of TGFß. We used thioglycollate-elicited PECs from CD36-deficient mice as APCs. These cells were pulsed with antigen (OVA) and treated with TGFß as described earlier. One group of C57BL/6 mice received intravenous infusion of untreated OVA-pulsed APCs whereas the other group received TGFß-treated APCs. One week after receiving OVA-pulsed APCs, mice were immunized with OVA/CFA and challenged with OVA in their ear pinnae a week after that. Ear swelling responses measured in the two groups as well as untreated group of negative control mice were measured at 24-h interval. Representative data of DTH responses are shown in Fig. 6. Ear swelling responses in both groups receiving either untreated or TGFß-treated CD36-deficient APCs were comparable. These results indicate that in the absence of CD36, TGFß exposure of APCs fails to confer on them tolerizing properties.


Figure 6
View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6. CD36–TSP interaction is essential for the tolerogenic phenotype of TGFß-treated APCs. Thioglycollate-elicited PECs from CD36 KO mice were pulsed with OVA and cultured overnight with or without TGFß. Cells were either harvested to be injected into naive C57BL/6 recipients in a DTH assay (A) or used to isolate total RNA as described previously. Culture supernatants collected from these cells were tested for the levels of IL-12p70 using ELISA (B1). Total RNA isolated was subjected to RT–PCR analysis to detect IL-12p40 (B2) or TSP expression pattern (C).

 
Further, we also tested IL-12 secretion by CD36-deficient APCs in the presence of TGFß. Culture supernatants collected from APCs cultured with OVA and TGFß (as described earlier) were tested for IL-12 levels using ELISA. Figure 6(B1) shows IL-12 levels detected in these supernatants. No significant difference was detected between the levels of IL-12 secreted by untreated and TGFß-treated APCs. Also, no decrease in the message for IL-12p40 in TGFß-treated APCs was noted as compared with untreated APCs (Fig. 6B2). We also compared their TSP expression and as shown in Fig. 6(C), we noted that while wild-type APCs responded to TGFß by increasing message levels for TSP, CD36-deficient APCs failed to do so. These results are consistent with the inability of TGFß-treated CD36-deficient APCs to induce immune deviation.

Thus, ligation of TSP receptor CD36, expressed on TGFß-treated APCs, is essential for their tolerizing phenotype.

Comparative significance of other molecules up-regulated in TGFß-treated APCs, such as type I IFNs, in conferring tolerance-inducing properties on APCs
Besides TSP, APCs treated with TGFß were also found to up-regulate their expression of type I IFN genes (18). Previously, we reported that exogenously added IFNß inhibits IL-12 secretion by IFN{gamma}-primed APCs (#59 cells). We therefore examined whether IFNß resembles TSP-1 and contributes similarly to the tolerance-inducing properties of TGFß-treated APCs through an autocrine effect. To test this possibility, we first assessed expression of IFN{alpha}/ßRs by hybridoma #59 by flow cytometry. As shown in Fig. 7(A), type I IFNRs were universally detected on #59 cells. These receptors were also detected on TGFß-treated APCs (data not shown). Next, we pulsed #59 cells with OVA in the presence or absence of IFNß. After overnight culture, these cells were injected i.v. into naive C3D2F1 recipients that were subsequently immunized with OVA in CFA. Induction of OVA-specific DTH was tested by measuring ear swelling responses within 24 h after receiving ear challenge with OVA. As shown in Fig. 7(B), significant ear swelling responses indicative of the presence of OVA-specific DTH were observed in positive control animals as well as in the recipients of untreated APCs. Importantly, mice that were pre-treated i.v. with IFNß-treated OVA-pulsed APCs also displayed intense OVA-specific DTH. These results indicate that IFNß is unable to confer upon APCs the functional property of inducing systemic tolerance similar to that induced by APCs treated with TGFß or TSP.


Figure 7
View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7. Role of other molecule up-regulated in TGFß-treated APCs, IFNß, in their tolerance-inducing ability. APCs (#59) were tested for the presence of IFN{alpha}/ßR by flow cytometry; dotted line represents isotype control antibody staining and solid line represents IFN{alpha}/ßR staining (A), untreated or IFNß-treated APCs were tested for their ability to induce immune deviation in a DTH assay as described earlier. Mean ear swelling response ± SEM are presented. (*P < 0.05 compared with positive control group that did not receive any APCs) (B). Culture supernatants collected from these APCs were tested for the levels of TNF{alpha} using ELISA (C1). Total RNA isolated from these APCs was analyzed by RT–PCR using primers specific for MIP-2, TGFß2 and housekeeping gene GAPDH. PCR products were analyzed by ethidium bromide/agarose gel electrophoresis (C2).

 
Furthermore, expression of MIP-2, TGFß2 and TNF{alpha} by IFNß-treated APCs was assessed as described previously. Macrophage hybridomas were cultured overnight with or without IFNß and either culture supernatants were collected to test TNF{alpha} protein levels by ELISA or total RNA was isolated from harvested cells. Expression of MIP-2 and TGFß2 was assessed by RT–PCR. As shown in Fig. 7(C1) and (C2), neither of these tested genes were found up-regulated in IFNß-treated APCs. This expression pattern of these genes is consistent with the failure to suppress DTH response by these APCs. Together, these results demonstrate that although IFNß resembles TSP in its ability to suppress IL-12 secretion by APCs and its increased expression in TGFß-treated APCs, IFNß does not resemble TSP in conferring tolerizing properties on APCs.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Our results reveal a significant role for TSP-1, a previously unsuspected member of an ECM protein family, in the process by which TGFß enables APCs to deviate inflammatory immune responses and induce a form of peripheral tolerance. Although studied extensively for its antiangiogenic properties (36–38) and ability to activate latent TGFß (20, 33, 39, 40), TSP has only recently been assessed for its immunomodulatory potential (22, 25, 41, 42). Our data suggest that TSP-1 acts in an autocrine manner in TGFß-exposed APCs and organizes other molecular interactions that participate in conferring tolerance-inducing properties on these APCs.

In our previous report we identified several candidate genes that were selectively expressed or silenced in TGFß-exposed APCs capable of inducing eye-derived tolerance (18). TSP was among the genes that were up-regulated in these APCs, and our current results demonstrate how TSP-1 contributes to their tolerance-inducing ability. Naive mice first treated with TSP-exposed antigen-pulsed APCs were unable subsequently to develop robust DTH when immunized with the same antigen plus adjuvant—a form of immune deviation previously found with TGFß-treated APCs. The presence of receptors for TSP-1, such as CD47 and CD36, on TGFß-exposed APCs supports the possibility of an autocrine effect of this molecule. TSP-treated APCs resembled TGFß-treated APCs in terms of their ability to increase the expression of TNF{alpha}, MIP-2 and TGFß2, molecules previously determined as essential for tolerance-promoting properties of these APCs. Furthermore, antigen-pulsed TSP-1 KO APCs exposed to TGFß were unable to suppress DTH response like their wild-type counterparts and this deficiency was restored by exogenous addition of TSP. We conclude that TSP is essential for the tolerance-inducing phenotype of TGFß-exposed APCs. To our knowledge this is the first report of a significant role for an ECM protein in the process of induction of peripheral tolerance.

Abundant presence of TSP in the ocular environment (43–47) suggests a possibility that TSP contributes to generating active TGFß in the ocular microenvironment or on the surface of resident APCs resulting into altered functional phenotype of local APCs. TGFß-treated APCs were previously shown to produce increased levels of total and active TGFß (12). Neutralization of active TGFß in vitro caused TGFß-treated APCs to induce responding T cells of the Th1 phenotype instead of a regulatory phenotype (12, 13). Our results demonstrate that the ability of TGFß-treated APCs to secrete increased levels of active TGFß is associated with their increased expression of TSP-1 since TSP-1-deficient APCs produced significantly reduced levels of active TGFß when exposed to exogenous TGFß. However, their ability to produce increased levels of latent TGFß in response to exogenous TGFß remained unaffected by the absence of TSP-1. This observation suggests that among the various mechanisms that might be available to APCs to activate latent TGFß in their close vicinity, TSP-1 plays a major role.

Previous studies have revealed that lack of IL-12 production by APCs exposed to TGFß is a pre-requisite for tolerance induction, and for preventing naive T cells from differentiating in vitro into Th1 (34, 35). We noted that IL-12 expression by TGFß-treated TSP-deficient APCs remained unaltered while their wild-type counterparts show significant inhibition of this cytokine. This observation is consistent with the role of TSP reported by others in inhibition of IL-12 by monocytes through ligation of TSP-1 receptor CD47 (22). Our current results indicate that TSP-1 produced by TGFß-exposed APCs promotes impaired IL-12 production by these APCs—presumably by signaling through CD47.

It has been reported that TSP-1 is able to promote activation of latent TGFß optimally if it is tethered to a cell membrane through binding to CD36 (26). Absence of this TSPR interfered with the ability of the APCs to become tolerogenic in response to TGFß thereby mimicking the absence of TSP-1 or active TGFß. Similar to TSP-deficient APCs, IL-12 secretion of these CD36 KO APCs also remained unaltered after TGFß treatment. Although consistent with their non-tolerogenic phenotype, availability of CD47 on these APCs was expected to permit IL-12 inhibition. However, it was noted that unlike the wild-type APCs, CD36 KO APCs failed to up-regulate their TSP expression after TGFß exposure. This result may explain the unaltered levels of IL-12 secreted by these APCs. Ligation of CD36 by TSP in endothelial cells and resulting signaling events have been studied in the context of antiangiogenic properties of TSP. These signals led to activation of kinases involved in apoptotic cell death (48, 49). Signaling events in macrophages have been examined after ligation of CD36 by amyloid proteins indicated in the pathogenesis of Alzeimer's disease and atherosclerosis (50, 51). Target gene activated by these signaling events has been demonstrated to be TNF{alpha}. It is possible that such a signaling cascade induced in TGFß- or TSP-treated APCs leads to increased TNF{alpha} secretion by these cells. However, it is not known whether TSP binding of CD36 is equivalent to amyloid protein binding of this receptor with respect to signaling events induced in macrophages. Also, so far, no direct link has been reported between TSP ligation of CD36 and TSP gene expression. It is possible that increased TSP expression in TGFß-treated APCs is an indirect effect of subsequently synthesized and activated TGFß and CD36-deficient cells incapable of activating newly synthesized TGFß fail to express TSP. Overall, these results underscore requirement of CD36–TSP interaction in tolerance induced by TGFß-treated APCs. An important side benefit of the binding of TSP-1 to CD36 is that the ‘nanoenvironment’ of the APCs surface can become highly enriched for TGFß. We speculate that this may be a physical mechanism to insure that T cell recognition of antigenic peptides on class I and II MHC molecules of antigen-pulsed, TGFß-treated APCs occurs in a TGFß-rich environment. The fact that TSP-1 binds CD47 and that CD47 is also constitutively expressed on T cells (41, 52) offers the further possibility that TSP-1 promotes tolerance induction by forming a trimolecular bridge (CD36 on APC–TSP–CD47 on T cell). Recent reports have indicated that CD47 ligation on T cells interferes with TCR-mediated signals and can prevent development of Th1 effectors (24, 25). Moreover, such a ligation of this receptor on human naive T cells can promote generation of regulatory T cells (53). Therefore, a trimolecular bridge between APCs and T cells may not only help stabilize their interaction but may also negatively regulate TCR-mediated signals in the responder T cells, thereby preventing generation of Th1 effectors while permitting emergence of regulatory T cells.

Thus, TSP-1 acts as though it is a TGFß surrogate in eye-derived tolerance induction. This view is strengthened by our findings that APCs treated with TSP (and not IFNß) exhibited tolerance-inducing properties and up-regulated expression of molecules essential for the induction of immune deviation (MIP-2, TGFß2 and TNF{alpha}) (12, 17, 19, 54). While our results clearly support an autocrine role of TSP in TGFß-treated APCs, IFNß appears to lack such an effect. Since TSP up-regulates TGFß gene expression, and since TGFß up-regulates this same spectrum of genes, we cannot rule out indirect effect of TSP via TGFß. Together, our data suggest a possibility that TSP may achieve its protean effects solely by promoting the efficient conversion of TGFß from its latent to its active form.

At present, we consider TSP-1 to be the molecular organizer of the tolerance-inducing signal that arises when antigen-pulsed APCs are treated with TGFß. Moreover, we regard TGFß as the chief molecular target of TSP's actions. By promoting TGFß gene expression, by tethering latent TGFß to the surface of the APC, and by promoting the conversion of latent to active TGFß, TSP-1 insures that APCs that must migrate from the eye to the spleen will create and maintain on their surface a TGFß-rich nanoenvironment. This environment then presides over the subsequent steps in induction of immune deviation (ACAID) that allows emergence of the T regulators that suppress systemically the induction and expression of T cell-mediated immunogenic inflammation.


    Acknowledgements
 
The authors wish to thank Jacqueline Doherty for the managerial support, Marie Ortega and Stephanie Carol for help with breeding of TSP-1 and CD36-deficient mice. This research was supported by National Institute of Health grant EY013775.


    Abbreviations
 
ACAID, assay for tolerance induction or immune deviation
APC, antigen-presenting cell
DC, dendritic cell
DTH, delayed type hypersensitivity
ECM, extracellular matrix
EMEM, Eagle's minimum essential medium
GAPDH, glyceraldehyde-3-phosphate dehydrogenase
i.v., intravenously
KO, knockout
MIP-2, macrophage inflammatory protein-2
NEAA, non-essential amino acid
OVA, ovalbumin peptide
PEC, peritoneal exudate cell
RT, reverse transcription
SFM, serum-free medium
TGF, transforming growth factor
TNF, tumor necrosis factor
TSP, thrombospondin

    Notes
 
* Deceased, March 15, 2004. Back

Transmitting editor: W. Strober

Received 4 March 2005, accepted 5 February 2006.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Streilein J. W. and Cousins S. W. 1990. Aqueous humor factors and their effect on the immune response in the anterior chamber. Curr. Eye Res. 9(Suppl.): 175.
  2. Streilein J. W. and Bradley D. 1991. Analysis of immunosuppressive properties of iris and ciliary body cells and their secretory products. Investig. Ophthalmol. Vis. Sci. 32: 2700.[Abstract/Free Full Text]
  3. Ishida K., Panjwani N., Cao Z. and Streilein J. W. 2003. Participation of pigment epithelium in ocular immune privilege. 3. Epithelia cultured from iris, ciliary body, and retina suppress T-cell activation by partially non-overlapping mechanisms. Ocul. Immunol. Inflamm. 11: 91.
  4. Sugita S. and Streilein J. W. 2003. Iris pigment epithelium expressing CD86 (B7-2) directly suppresses T cell activation in vitro via binding to cytotoxic T lymphocyte-associated antigen 4. J. Exp. Med. 198: 161.[Abstract/Free Full Text]
  5. Wilbanks G. A., Mammolenti M. and Streilein J. W. 1991. Studies on the induction of anterior chamber-associated immune deviation (ACAID). II. Eye-derived cells participate in generating blood-borne signals that induce ACAID. J. Immunol. 146: 3018.[Abstract]
  6. Williamson J. S., Bradley D. and Streilein J. W. 1989. Immunoregulatory properties of bone marrow-derived cells in the iris and ciliary body. Immunology 67: 96.[Web of Science][Medline]
  7. Hara Y., Caspi R. R., Wiggert B., Dorf M. and Streilein J. W. 1992. Analysis of an in vitro-generated signal that induces systemic immune deviation similar to that elicited by antigen injected into the anterior chamber of the eye. J. Immunol. 149: 1531.[Abstract]
  8. Hara Y., Caspi R. R., Wiggert B., Chan C. C., Wilbanks G. A. and Streilein J. W. 1992. Suppression of experimental autoimmune uveitis in mice by induction of anterior chamber-associated immune deviation with interphotoreceptor retinoid-binding protein. J. Immunol. 148: 1685.[Abstract]
  9. Hara Y., Okamoto S., Rouse B. and Streilein J. W. 1993. Evidence that peritoneal exudate cells cultured with eye-derived fluids are the proximate antigen-presenting cells in immune deviation of the ocular type. J. Immunol. 151: 5162.[Abstract]
  10. Kosiewicz M. M., Okamoto S., Miki S., Ksander B. R., Shimizu T. and Streilein J. W. 1994. Imposing deviant immunity on the presensitized state. J. Immunol. 153: 2962.[Abstract]
  11. Wilbanks G. A., Mammolenti M. and Streilein J. W. 1992. Studies on the induction of anterior chamber-associated immune deviation (ACAID). III. Induction of ACAID depends upon intraocular transforming growth factor-beta. Eur. J. Immunol. 22: 165.[Web of Science][Medline]
  12. Takeuchi M., Kosiewicz M. M., Alard P. and Streilein J. W. 1997. On the mechanisms by which transforming growth factor-beta 2 alters antigen-presenting abilities of macrophages on T cell activation. Eur. J. Immunol. 27: 1648.[Web of Science][Medline]
  13. Kezuka T. and Streilein J. W. 2000. Analysis of in vivo regulatory properties of T cells activated in vitro by TGFbeta2-treated antigen presenting cells. Investig. Ophthalmol. Vis. Sci. 41: 1410.[Abstract/Free Full Text]
  14. Kezuka T. and Streilein J. W. 2000. In vitro generation of regulatory CD8+ T cells similar to those found in mice with anterior chamber-associated immune deviation. Investig. Ophthalmol. Vis. Sci. 41: 1803.[Abstract/Free Full Text]
  15. D'Orazio T. J. and Niederkorn J. Y. 1998. A novel role for TGF-beta and IL-10 in the induction of immune privilege. J. Immunol. 160: 2089.[Abstract/Free Full Text]
  16. Takeuchi M., Alard P. and Streilein J. W. 1998. TGF-beta promotes immune deviation by altering accessory signals of antigen-presenting cells. J. Immunol. 160: 1589.[Abstract/Free Full Text]
  17. Hecker K. H., Niizeki H. and Streilein J. W. 1999. Distinct roles for transforming growth factor-beta2 and tumour necrosis factor-alpha in immune deviation elicited by hapten-derivatized antigen-presenting cells. Immunology 96: 372.[CrossRef][Medline]
  18. Masli S., Turpie B., Hecker K. H. and Streilein J. W. 2002. Expression of thrombospondin in TGFbeta-treated APCs and its relevance to their immune deviation-promoting properties. J. Immunol. 168: 2264.[Abstract/Free Full Text]
  19. Faunce D. E., Sonoda K. H. and Stein-Streilein J. 2001. MIP-2 recruits NKT cells to the spleen during tolerance induction. J. Immunol. 166: 313.[Abstract/Free Full Text]
  20. Murphy-Ullrich J. E. and Poczatek M. 2000. Activation of latent TGF-beta by thrombospondin-1: mechanisms and physiology. Cytokine Growth Factor Rev. 11: 59.[CrossRef][Web of Science][Medline]
  21. Lawler J. 2000. The functions of thrombospondin-1 and -2. Curr. Opin. Cell Biol. 12: 634.[CrossRef][Web of Science][Medline]
  22. Armant M., Avice M. N., Hermann P. et al. 1999. CD47 ligation selectively downregulates human interleukin 12 production. J. Exp. Med. 190: 1175.[Abstract/Free Full Text]
  23. Johansson U. and Londei M. 2004. Ligation of CD47 during monocyte differentiation into dendritic cells results in reduced capacity for interleukin-12 production. Scand. J. Immunol. 59: 50.[Medline]
  24. Avice M. N., Rubio M., Sergerie M., Delespesse G. and Sarfati M. 2000. CD47 ligation selectively inhibits the development of human naive T cells into Th1 effectors. J. Immunol. 165: 4624.[Abstract/Free Full Text]
  25. Li Z., He L., Wilson K. and Roberts D. 2001. Thrombospondin-1 inhibits TCR-mediated T lymphocyte early activation. J. Immunol. 166: 2427.[Abstract/Free Full Text]
  26. Yehualaeshet T., O'Connor R., Green-Johnson J. et al. 1999. Activation of rat alveolar macrophage-derived latent transforming growth factor beta-1 by plasmin requires interaction with thrombospondin-1 and its cell surface receptor, CD36. Am. J. Pathol. 155: 841.[Abstract/Free Full Text]
  27. Doyen V., Rubio M., Braun D. et al. 2003. Thrombospondin 1 is an autocrine negative regulator of human dendritic cell activation. J. Exp. Med. 198: 1277.[Abstract/Free Full Text]
  28. Latour S., Tanaka H., Demeure C. et al. 2001. Bidirectional negative regulation of human T and dendritic cells by CD47 and its cognate receptor signal-regulator protein-alpha: down-regulation of IL-12 responsiveness and inhibition of dendritic cell activation. J. Immunol. 167: 2547.[Abstract/Free Full Text]
  29. Demeure C. E., Tanaka H., Mateo V., Rubio M., Delespesse G. and Sarfati M. 2000. CD47 engagement inhibits cytokine production and maturation of human dendritic cells. J. Immunol. 164: 2193.[Abstract/Free Full Text]
  30. Kawasaki H., Martin C. A., Uchida T. et al. 1986. Functional analysis of cloned macrophage hybridomas. V. Induction of suppressor T cell responses. J. Immunol. 137: 2145.[Abstract]
  31. Maruyama K., Ii M., Cursiefen C. et al. 2005. Inflammation-induced lymphangiogenesis in the cornea arises from CD11b-positive macrophages. J. Clin. Invest. 115: 2363.[CrossRef][Web of Science][Medline]
  32. Crawford S. E., Stellmach V., Murphy-Ullrich J. E. et al. 1998. Thrombospondin-1 is a major activator of TGF-beta1 in vivo. Cell 93: 1159.[CrossRef][Web of Science][Medline]
  33. Schultz-Cherry S., Chen H., Mosher D. F. et al. 1995. Regulation of transforming growth factor-beta activation by discrete sequences of thrombospondin 1. J. Biol. Chem. 270: 7304.[Abstract/Free Full Text]
  34. Takeuchi M., Alard P., Verbik D., Ksander B. and Streilein J. W. 1999. Anterior chamber-associated immune deviation-inducing cells activate T cells, and rescue them from antigen-induced apoptosis. Immunology 98: 576.[CrossRef][Web of Science][Medline]
  35. Perez V. L., Biuckians A. J. and Streilein J. W. 2000. In-vivo impaired T helper 1 cell development in submandibular lymph nodes due to IL-12 deficiency following antigen injection into the anterior chamber of the eye. Ocul. Immunol. Inflamm. 8: 9.[CrossRef][Web of Science][Medline]
  36. Streit M., Velasco P., Brown L. F. et al. 1999. Overexpression of thrombospondin-1 decreases angiogenesis and inhibits the growth of human cutaneous squamous cell carcinomas. Am. J. Pathol. 155: 441.[Abstract/Free Full Text]
  37. Iruela-Arispe M. L., Lombardo M., Krutzsch H. C., Lawler J. and Roberts D. D. 1999. Inhibition of angiogenesis by thrombospondin-1 is mediated by 2 independent regions within the type 1 repeats. Circulation 100: 1423.[Abstract/Free Full Text]
  38. Lawler J. 2002. Thrombospondin-1 as an endogenous inhibitor of angiogenesis and tumor growth. J. Cell. Mol. Med. 6: 1.[Web of Science][Medline]
  39. Schultz-Cherry S., Lawler J. and Murphy-Ullrich J. E. 1994. The type 1 repeats of thrombospondin 1 activate latent transforming growth factor-beta. J. Biol. Chem. 269: 26783.[Abstract/Free Full Text]
  40. Tada H. and Isogai S. 1998. The fibronectin production is increased by thrombospondin via activation of TGF-beta in cultured human mesangial cells. Nephron 79: 38.[CrossRef][Web of Science][Medline]
  41. Li Z., Calzada M. J., Sipes J. M. et al. 2002. Interactions of thrombospondins with alpha4beta1 integrin and CD47 differentially modulate T cell behavior. J. Cell Biol. 157: 509.[Abstract/Free Full Text]
  42. Beppu R., Nakamura K., Miyajima-Uchida H. et al. 2001. Soluble thrombospondin-1 suppresses T cell proliferation and enhances IL-10 secretion by antigen presenting cells stimulated with phytohemagglutinin. Immunol. Investig. 30: 143.[CrossRef][Medline]
  43. Sheibani N., Sorenson C. M., Cornelius L. A. and Frazier W. A. 2000. Thrombospondin-1, a natural inhibitor of angiogenesis, is present in vitreous and aqueous humor and is modulated by hyperglycemia. Biochem. Biophys. Res. Commun. 267: 257.[CrossRef][Web of Science][Medline]
  44. Hiscott P., Seitz B., Schlotzer-Schrehardt U. and Naumann G. O. 1997. Immunolocalisation of thrombospondin 1 in human, bovine and rabbit cornea. Cell Tissue Res. 289: 307.[CrossRef][Web of Science][Medline]
  45. Hiscott P., Sorokin L., Nagy Z. Z., Schlotzer-Schrehardt U. and Naumann G. O. 1996. Keratocytes produce thrombospondin 1: evidence for cell phenotype-associated synthesis. Exp. Cell Res. 226: 140.[CrossRef][Web of Science][Medline]
  46. Cursiefen C., Masli S., Ng T. F. et al. 2004. Roles of thrombospondin-1 and -2 in regulating corneal and iris angiogenesis. Investig. Ophthalmol. Vis. Sci. 45: 1117.[Abstract/Free Full Text]
  47. Carron J. A., Hiscott P., Hagan S., Sheridan C. M., Magee R. and Gallagher J. A. 2000. Cultured human retinal pigment epithelial cells differentially express thrombospondin-1, -2, -3, and -4. Int. J. Biochem. Cell Biol. 32: 1137.[CrossRef][Web of Science][Medline]
  48. Jimenez B., Volpert O. V., Crawford S. E., Febbraio M., Silverstein R. L. and Bouck N. 2000. Signals leading to apoptosis-dependent inhibition of neovascularization by thrombospondin-1. Nat. Med. 6: 41.[CrossRef][Web of Science][Medline]
  49. Jimenez B., Volpert O. V., Reiher F. et al. 2001. c-Jun N-terminal kinase activation is required for the inhibition of neovascularization by thrombospondin-1. Oncogene 20: 3443.[CrossRef][Web of Science][Medline]
  50. Medeiros L. A., Khan T., El Khoury J. B. et al. 2004. Fibrillar amyloid protein present in atheroma activates CD36 signal transduction. J. Biol. Chem. 279: 10643.[Abstract/Free Full Text]
  51. Moore K. J., El Khoury J., Medeiros L. A. et al. 2002. A CD36-initiated signaling cascade mediates inflammatory effects of beta-amyloid. J. Biol. Chem. 277: 47373.[Abstract/Free Full Text]
  52. Avice M. N., Rubio M., Sergerie M., Delespesse G. and Sarfati M. 2001. Role of CD47 in the induction of human naive T cell anergy. J. Immunol. 167: 2459.[Abstract/Free Full Text]
  53. Grimbert P. R. M., Allakverdi Z, Levesque M, Delespesse G. and Sarfati M. 2004. CD47 ligation on naive cells promotes the generation of distinct human anergic/regulatory T cells. In 4th Annual Meeting of Federation of Clinical Immunology Societies (FOCIS). Montreal, Canada.
  54. Ferguson T. A., Herndon J. M. and Dube P. 1994. The immune response and the eye: a role for TNF alpha in anterior chamber-associated immune deviation. Investig. Ophthalmol. Vis. Sci. 35: 2643.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
IOVSHome page
T. F. Ng, B. Turpie, and S. Masli
Thrombospondin-1-Mediated Regulation of Microglia Activation after Retinal Injury
Invest. Ophthalmol. Vis. Sci., November 1, 2009; 50(11): 5472 - 5478.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
B. Turpie, T. Yoshimura, A. Gulati, J. D. Rios, D. A. Dartt, and S. Masli
Sjogren's Syndrome-Like Ocular Surface Disease in Thrombospondin-1 Deficient Mice
Am. J. Pathol., September 1, 2009; 175(3): 1136 - 1147.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
P. Ghafoori, T. Yoshimura, B. Turpie, and S. Masli
Increased I{kappa}B{alpha} expression is essential for the tolerogenic property of TGF-{beta}-exposed APCs
FASEB J, July 1, 2009; 23(7): 2226 - 2234.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. A. Derks, E. Jankowska-Gan, Q. Xu, and W. J. Burlingham
Dendritic Cell Type Determines the Mechanism of Bystander Suppression by Adaptive T Regulatory Cells Specific for the Minor Antigen HA-1
J. Immunol., September 15, 2007; 179(6): 3443 - 3451.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/5/689    most recent
dxl006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (5)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Masli, S.
Right arrow Articles by Streilein, J W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masli, S.
Right arrow Articles by Streilein, J W.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?