International Immunology Advance Access originally published online on February 28, 2006
International Immunology 2006 18(4):581-589; doi:10.1093/intimm/dxh400
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Germ line transcription in mice bearing neor gene downstream of I
3 exon in the Ig heavy chain locus
1 CNRS UMR 6101, Groupe Instabilité génétique et régulation transcriptionnelle, Faculté de Médecine, 2 rue du Dr Marcland, F-87025 Limoges cedex, France
2 Department of Clinical Sciences, Birzeit University, Birzeit, Palestine
3 CNRS UMR 6101, Groupe Génétique moléculaire de la cellule B et des syndromes immunoprolifératifs, Faculté de Médecine, Limoges, France
4 Present address: CNRS UMR 5089-IPBS, Equipe "Instabilité génétique et régulation transcriptionnelle", 205 route de Narbonne, 31077 Toulouse cedex 4, France
Correspondence to: A. A. Khamlichi; E-mail: ahmed.khamlichi{at}unilim.fr
| Abstract |
|---|
|
|
|---|
Class switch recombination (CSR) is preceded by germ line transcription that initiates from promoters upstream of switch (S) sequences and terminates downstream of associated constant genes. Previous work showed that germ line transcripts and their processing are required for CSR and that germ line transcription is regulated in a major part by a regulatory region located downstream of the Ig heavy chain locus. This long-range, polarized effect can be disturbed by inserting an expressed neomycine resistance (neor) gene. To contribute to a better understanding of the mechanism of such a long-distance regulation, we generated knock-in mice in which a neor gene was inserted downstream of I
3 exon leaving intact all the necessary elements for germ line transcription and splicing. We show that the expressed neor gene interferes with transcription initiation from I
3, and that it impairs but does not block S recombination to C
3. Moreover, we show for the first time that the neor gene provides through chimeric neor-C
3 transcripts the necessary elements for splicing of germ line transcripts by activating two novel cryptic splice sites, one in the coding region of the intronless neor gene and the other in the I
3-C
3 intron.
Keywords: B lymphocyte, class switch recombination, long-range interaction, splicing
| Introduction |
|---|
|
|
|---|
In the mouse, the constant region (C) genes are organized in the following order: 5'-Cµ-C
-C
3-C
1-C
2b-C
2a-C
-C
-3'. Upon antigen challenge, populations of mature B cells expressing IgM and/or IgD can undergo a class switch recombination (CSR) that specifically affects C genes through a deletional process whereby a downstream C gene is brought to proximity of a rearranged VDJ gene, enabling expression of one of the downstream isotypes (IgG, IgE or IgA) (1).
CSR occurs between highly repetitive switch (S) sequences located upstream of all the C genes except C
. This process is controlled by a series of signals in which the B cell antigen receptor, cytokines and B cellT cell interactions play a critical role. Activation and targeting of CSR can be mimicked in vitro by a combination of certain mitogens and cytokines to induce or suppress germ line transcription of specific C genes (1).
CSR is often directed to the same S sequences on both homologous chromosomes (24) and is preceded by a biallelic germ line transcription directed by I germ line promoters located upstream of S sequences (5). The transcripts run through the I exon and the S sequences and undergo polyadenylation downstream of the C exons. Splicing enables fusion of the I exon to the C and excision of the intervening sequences yielding sterile, non-coding transcripts (6).
Previous work suggested that germ line transcription was necessary for the accessibility of S sequences to putative recombinases affecting cleavage (6). Several studies also showed that germ line transcripts form RNADNA hybrids with the template strand (711), whereas the single-stranded, non-template strand form long and stable R loops in vivo which may serve as substrates for activation-induced cytidine deaminase (12). The latter was shown to associate with the chromatin of the target S sequences in a germ line transcription-dependent manner, maybe through a direct interaction with the transcription machinery (13).
Different knockout experiments highlighted the importance of the germ line transcription for efficient CSR to the target genes (1418). However, although necessary, germ line transcription is not sufficient and processing of germ line transcripts is required for efficient CSR (16, 1922), but the role of the splicing machinery in CSR remains unclear.
Cis-regulatory elements located upstream of the germ line promoters or downstream of the Ig heavy chain (IgH) locus control CSR by regulating germ line transcription from the target I promoters (1, 2327). The Ig heavy chain 3' regulatory region (3'RR) which contains four DNase I hypersensitive sites (5'-hs3a, hs1-2, hs3b, hs4-3') (25) was suggested to function as a long-range control region that regulates various germ line promoters following appropriate stimulation (23, 24). Mutant mice were generated in which hs3a, hs1-2 or hs3b/hs4 were replaced with an LPS-inducible neomycine resistance (neor) gene. The mutant B cells were severely impaired in their ability to switch to most isotypes due to altered germ line transcription of the corresponding C genes spread over
100 kb (23, 24). However, the removal of the neor cassette had no remarkable effect on CSR for individual deletions of hs3a or hs1-2 (24), whereas the joint deletion of hs3b/hs4 affected CSR to most isotypes but still less severely than with the replacement mutation (26). Additional insights into the mechanisms by which the 3'RR modulates germ line transcription came from the analyses of mutant mice in which the expressed selectable marker was inserted within the IgH C locus upstream of the 3'RR (18, 21, 28, 29). For example, C
or the I
2b exon was replaced with a neor gene. Analysis of mutant B cells showed that germ line transcription and CSR to upstream C genes were impaired (with the exception of C
1) but the downstream C genes were not affected (29).
Based on the above studies, it has been proposed that the inhibition of CSR resulted from a neo effect that may reflect a potential competition of the neor promoter for control elements in the 3'RR, and that CSR could be regulated by the relative ability of various I promoters to compete for activities displayed by the 3'RR (23, 24). In addition, neor gene insertion into the IgH C locus seems to disturb the polarized long-range effect of the 3'RR on germ line promoters as long as they are located upstream, but not downstream, of the neor insertion site (29).
These phenotypes illustrate the usefulness of neo effect approach in gaining some insights into the mechanisms underlying long-range interactions in complex loci. However in the studies where the 3'RR was left intact, the structure of the elements known to be required for accurate germ line transcription and processing, namely the I promoter, the canonical splice sites or the C gene was altered (1422, 28, 29). Therefore, it was interesting to study the neo effect by leaving intact all these elements. To this end, we generated knock-in mice bearing the neor gene in a sense orientation downstream of the I
3 exon leaving intact all the necessary elements for proper germ line transcription of
3 gene. We asked if and how neor gene insertion would alter transcription initiation from I
3 promoter and from the upstream Iµ promoter and how this would affect long-range interaction between the 3'RR and I
3.
| Methods |
|---|
|
|
|---|
Targeting vector and mice
A
3 targeting construct was generated using a plasmid containing an
8-kb XhoIBamHI fragment spanning I
3 and S
3. An SphI site 250 bp downstream of the I
3 donor splice site was replaced by a ClaI site. A neor cassette in which the selectable marker is under the control of the thymidine kinase (tk) promoter was then introduced as a 1.3-kb ClaI fragment in the sense orientation. An HSV tk gene was inserted in NotI site for negative selection. ES cells (cell line CK35) were transfected by electroporation, and selected using G418 (400 µg ml1) and ganciclovir (2 µM). Recombinant clones were identified by Southern blot analysis with an external probe (1.0-kb EcoRIXhoI as a 5' probe) after an EcoRI digest. An internal probe (1.9-kb HindIIIBamHI at the end of the 3' arm) was also used after an EcoRI + BamHI digest. Two ES clones showing homologous recombination were injected into C57Bl/6 blastocysts, the male chimeras were then mated with C57Bl/6 females. Germ line transmission of the mutation was checked by Southern blot by using the same digests and probes.
Spleen cell cultures
Splenocytes from 6- to 8-week-old mice were activated in vitro in RPMI 1640 medium supplemented with 10% FCS, 50 µM of 2 ß-mercaptoethanol and 20 µg ml1 of LPS (Salmonella typhimurium; Sigma, St Louis, MO, USA) at a density of 106 cells ml1. At days 0, 2, 4 and 5, aliquots of cells were removed for RNA preparation.
Flow cytometry analysis
At day 5 of LPS stimulation, splenocytes (5 x 105 cells per assay) were labeled by using spectral red-conjugated anti-B220 and PE-conjugated anti-IgM, anti-IgG3 or anti-IgG2b (Southern Biotechnology). Data were obtained on 1.5 x 104 viable cells by using a Coulter XL apparatus (Beckman Coulter, Fullerton, CA, USA).
ELISA assays
Sera or supernatants from spleen cell cultures (harvested after 5 days of stimulation) were analyzed for the presence of IgM, IgG3 and IgG2b by ELISA as described (26). For statistical analysis, we used Student's t-test; P values of less than 0.017 were considered to be statistically significant.
Northern blots
Total cellular RNA preparation and northern blotting were carried out as described (26). Probes used for hybridization were the following: for Cµ transcripts, a 1.2-kb XbaIHindIII genomic fragment containing the murine Cµ1 to Cµ3 region; for
transcripts, a 1.7-kb BamHISphI genomic fragment containing the C
3 region and cross-hybridizing with all
constant transcripts; for mb-1 transcripts, a 0.5-kb PvuII mb-1 cDNA fragment and for neor transcripts, a 1.0-kb version of the cassette devoid of the tk promoter.
Oligonucleotides and reverse transcriptionPCR analysis of germ line transcription
NeoATG primer: 5' ATGGGATCGGCCATTGAACAA 3'. Primers Imf, Cmr, Ig3f, Cg3r, Ig2bf, Cg2br, Acti-4 and Acti-5, the reverse transcription (RT)PCR conditions and the expected sizes of the PCR products have been described (26, 30).
Neo-C
3 cloning and sequencing
The two PCR products (using NeoATG and Cg3 primers) were eluted, cloned in Topo I vector (Invitrogen, Gröningen, The Netherlands) and transfected in TG1 bacterial strain. Sequences were determined on both strands by using M13 universal and internal primers.
| Results |
|---|
|
|
|---|
Generation of mice carrying a neor cassette downstream of I
3 exonA targeting vector was designed in order to insert the tk-neor cassette downstream of I
3 but without altering the structure of I
3 or that of the splice donor site and its surrounding sequences. To this end, we inserted the cassette between I
3 and S
3, in an SphI site located 250 bp downstream of the canonical splice donor site (Fig. 1A). Among 360 resistant clones, four clones showed a recombinant band with the expected size (
4.6 kb, with EcoRI digest) by using an external 5' probe. Two recombinant clones were injected into blastocysts and both allowed germ line transmission. Heterozygous (N/+) and homozygous (N/N) mice were analyzed by Southern blot using the same digest and 5' probe (Fig. 1B). The use of an internal probe confirmed the absence of random integration (not shown).
|
Serum antibodies and in vitro Ig production by LPS-activated splenocytes
In order to analyze the sera, N/N mice were bred, the progeny was bled at week 6 and the serum content in IgM, IgG3 and IgG2b was analyzed by ELISA. No difference could be detected between the mutant N/+ or N/N mice and the wild-type (wt) controls with regard to IgM, IgG3 or IgG2b (Fig. 2A).
|
To check if IgG3 production in vitro would be affected by neor insertion, we used LPS that induces splenic B cells to switch to IgG3 and IgG2b. Since
2b gene is located far downstream of the insertion site, it was used as an internal control for a potential alteration of Ig production by LPS-stimulated splenic B cells. Total splenocytes from littermates were stimulated with LPS for 5 days and supernatants were analyzed by ELISA. Whereas no difference was detected for IgM and IgG2b production between +/+, N/+ and N/N mice, a statistically significant impairment was found for IgG3 production by N/N splenocytes. IgG3 levels were roughly half those from wt (P = 0.0003) or N/+ splenocytes (P = 0.0008) (Fig. 2B). These results indicate that the neo effect specifically alters IgG3 production with no detectable effect on IgM or IgG2b production.
Cell-surface Ig expression in mutant mice
We also checked potential alteration of CSR in the mutant mice by studying cell-surface expression of IgM, IgG3 and IgG2b isotypes on activated splenic B cells. Splenocytes from +/+, N/+ or N/N mutant mice were activated with LPS for 5 days to induce switching to IgG3 and IgG2b. Cell-surface expression of IgM, IgG3 and IgG2b was then monitored among the B220+ populations. Whereas no difference could be detected between +/+ and mutant N/+ and N/N splenic B cells for IgM and IgG2b surface expression, a slight defect on IgG3 cell-surface expression was found on mutant N/+ splenocytes (7.57 ± 1.57% instead of 9.96 ± 1.71% in wt) and a more severe decrease in the case of N/N splenocytes (4.53 ± 0.61%) (Fig. 3). These data further show that neo effect specifically targets the IgG3 isotype.
|
Gene expression in stimulated mutant splenocytes
We then asked if the LPS-inducible expression of neor, µ and
3 genes would mirror the profiles found by ELISA and FACS. To this end, total RNA from unstimulated or LPS-stimulated splenocytes was hybridized with a neo probe, a Cµ probe and a C
3 probe that cross-hybridizes with all
transcripts. Abundant neo transcripts could readily be detected in the mutant mice but not in the wt control upon LPS stimulation, clearly indicating that neor gene is induced by LPS. The same pattern holds true for µ gene expression which was vigorously induced by LPS in all the samples. For
gene expression, although an LPS inducibility was obvious, we could not draw a definitive conclusion about the specific alteration of
3 gene expression since the probe recognized all
transcripts (not shown).
Germ line transcription in stimulated mutant splenocytes
To gain insight into the neo effect at the germ line transcriptional level, we resorted to RTPCR in semi-quantitative conditions using a set of specific primers for germ line promoters and C exons that enable a clear distinction between the different isotypes.
We found no obvious alteration in Iµ-Cµ and I
2b-C
2b transcripts in LPS-stimulated mutant splenocytes. In contrast, transcripts in the form of I
3-C
3 were hardly detectable in the N/N LPS-stimulated mutant splenocytes (Fig. 4B). Attempts to detect chimeric transcripts in the form of I
3-Neo in homozygous LPS-stimulated mutant splenocytes failed (not shown), suggesting that, within the sensitivity limits of our PCR assay, germ line transcription from I
3 promoter was impaired.
|
Interestingly, we detected chimeric Neo-C
3 transcripts (see below) in the N/+ and the N/N LPS-stimulated mutant splenocytes but not in the wt control. To our surprise, two weak fragments were consistently amplified in LPS-stimulated splenocytes by using the NeoATG and Cg3r primers. The two fragments were readily detectable by Southern blot using neo-coding sequence as a probe (Fig. 4C), though only in the undiluted sample from unstimulated splenocytes, which may be due to the basal activity of the neor gene promoter or to some pre-activated splenocytes. Quantification of the two signals using an Instant imager following hybridization with a neo probe revealed an equivalent abundance of the two transcript species (not shown).
Conversely, post-switch hybrid transcripts in the form of Iµ-Cx (x denoting any C gene after CSR) (31) were reduced in the case of Iµ-C
3 but not in the case of Iµ-C
2b in LPS-stimulated N/N mutant splenocytes (Fig. 4D) confirming the profiles seen by FACS and ELISA of supernatants from in vitro LPS-stimulated splenocytes (Figs 2 and 3).
Altogether, these results show that insertion of an expressed neor gene downstream of I
3 exon impairs transcription initiation from I
3 promoter, but not from Iµ located far upstream or from I
2b downstream of
3 gene. Instead, tk promoter is used to initiate germ line transcription which runs through the neor coding sequence, and at least in part through the S
3 and C
3 sequences.
neor insertion activates two cryptic splice sites
Previous work showed that although necessary, germ line transcription is not sufficient and processing of germ line transcripts is required to achieve normal levels of CSR (16, 1921). In our mice, neor gene promoter was able to substitute for I
3 promoter. In addition, we consistently detected two cDNA species by RTPCR using NeoATG and Cg3r primers. Therefore, in order to delineate the splice junctions between the neor and C
3 transcripts, we cloned and sequenced the two fragments from three independent PCRs. Surprisingly, analysis of the junction sequence in the shorter fragment (
0.8 kb) showed that a cryptic splice site had been activated within the coding sequence of the intronless neor gene, whereas in the larger fragment (
1.1 kb) another cryptic splice site, located in the intron sequence between neor insertion site and S
3, had been used. In both cases, the donor sites were normally spliced to the canonical C
3 splice acceptor site (Fig. 5A and C).
|
These results strengthen the idea that processing of germ line transcripts is a critical parameter in the molecular mechanisms leading from germ line transcription to CSR.
| Discussion |
|---|
|
|
|---|
Besides its use as a selectable marker, neor gene has been used as a tool to unravel the mechanisms underlying long-range interactions in complex loci. Of note, other selectable markers were also used (17, 21), but for the sake of coherence, we will keep on using the term neo effect as long as it is probably the promoter that counts in this effect and not the coding sequence of the selectable marker. It is noteworthy that, at least within the IgH locus, the neo effect does not seem to depend on the neor transcription orientation or on the widely used phosphoglycerate kinase (21, 23, 24, 28, 29) or tk (26, 32, this study) promoters driving neor gene expression.
The neo effect was shown to alter the effect of the 3'RR on I promoters (except maybe for I
1) located upstream but not downstream of neor insertion site (21, 29), indicating that the neor gene somehow disturbs the interaction between the 3'RR and I promoters at a distance that may exceed 100 kb. However, the replacement mutations described in these studies (21, 29) altered the structure of critical elements for germ line transcription (I promoter, I or C exons). This does not affect the interpretation of the phenotypes analyzed as far as intact upstream or downstream promoters (relative to neor insertion site) are concerned. For the replaced sequences, it remains uncertain whether the phenotype obtained results from the alteration of these elements themselves, from neo effect or from both. Therefore, it was interesting to analyze the neo effect by leaving intact all the necessary elements for germ line transcription and CSR. To this end, we inserted a neor cassette in the sense orientation between the I
3 exon and S
3 sequence. Both I
3 and I
2b promoters are LPS-responsive, thus germ line transcription of and CSR to
2b gene (located downstream of neor insertion site) can be used as internal controls in LPS-mediated CSR to IgG3 and IgG2b.
We found that the LPS-inducible neor gene specifically impairs germ line transcription from the upstream I
3 promoter but not from the downstream I
2b promoter in agreement with previous findings (29). In addition, neor insertion in the IgH C locus has no effect on the upstream µ gene expression. It would be interesting to check if neor interference is confined to a chromatin domain (under the influence of the 3'RR) whose 5' boundary lies within the large matrix attachment region upstream of the
3 locus (33).
Previous work showed that germ line transcription per se is not sufficient for CSR and processing of germ line transcripts is a critical parameter in CSR (1922, 30) but the mechanism remains unclear. Our results support these findings and show that in the absence of the canonical I
3 splice donor site, and within the sensitivity limits of our RTPCR assay, two other cryptic splice sites were activated, and were equally used for splicing to the normal C
3 acceptor site. Cryptic splice sites are not detectably used in wt pre-mRNA, but are activated as a result of a mutation occurring most often at the canonical splice site. Surprisingly, one of the donor sites was activated within the neor coding sequence leading to a Neo-C
3 fusion protein. Whether the latter protein plays a role in any aspect of CSR to C
3 is presently unclear. The second cryptic site was located between neor gene and S
3 sequences, and therefore led to no fusion protein. The two Neo-C
3 hybrid transcripts occurred on the same allele since the corresponding cDNAs could be amplified in the heterozygous B cells. The activation of a cryptic splice site within the coding region of neor gene could explain the phenotype seen in mice in which most of the I
2b exon (including the splice donor site) was replaced by a neor gene leading to normal CSR to C
2b (18). However, we cannot exclude the possibility that the activation of the cryptic splice site within neor in our mice depends on the insertion site of the cassette, obviously on its transcription orientation and its distance from endogenous splice sites.
We found that neor gene could substitute for I
3 promoter for germ line transcription initiation and provided (or activated) splice sites, however, CSR to C
3 was still lower in LPS-activated mutant N/N splenic B cells than in their N/+ or +/+ counterparts. Although we cannot rule out other possibilities, one likely explanation is that most of the transcription process ends at the polyadenylation sites of the neor gene leading to normal neor transcripts, while some transcription runs through the whole neor gene and proceeds through the S
3 and C
3 sequences leading to hybrid Neo-C
3 transcripts. It could be that only the latter ones have bearing on CSR to C
3 since they will alone enable the formation of R loops and not normal neor transcripts that contain no S
3 sequences. This leaves open the question whether transcribed neor sequence itself forms an R loop. Alternatively, one might speculate that transcribed neor sequence somehow impairs CSR to C
3 through an alteration of S
3 chromatin or by generating a secondary (or higher order) structure that may impair access of CSR machinery to S
3 sequences. Although we cannot formally exclude this possibility, we think it unlikely, because we should then expect a more drastic decrease in CSR to C
3 due to the cumulative effect of both the decreased germ line transcription of S
3 sequences (most of transcription stops at neor polyadenylation sites) and the limited access of CSR machinery to S
3 sequences by the expressed neor gene. Clearly, this topic requires further investigations.
Within the IgH locus, neo effect seems to be associated with the LPS inducibility of the neor gene (24, 26, 32, 34, this study), a feature that is lost when the neor gene is inserted outside the IgH locus (24). Therefore, the LPS inducibility could have a predictive value in that it may enable delimitation of domains under the influence of Eµ (32) or of the 3'RR (21, 28, 29). It may thus be used to delineate the boundaries of the 3'RR activity required for CSR. Indeed, mutant mice bearing neor gene downstream of hs4 displayed no obvious alteration of CSR (34) strongly suggesting that the activity that enhances transcription from upstream germ line promoters is mainly effected by (a combination of) elements contained within the
34 kb spanning hs3a, hs1-2, hs3b and hs4.
How the long-range interaction between the 3'RR and the I promoters takes place and how an LPS-inducible neor gene interferes with this interaction are presently unclear. Whether neo effect is exerted through alteration of local chromatin structure or through promoter competition with specific upstream I promoters (29) awaits further analyses. In any case, we think it unlikely that competition or higher affinity of neor promoter to transcription factors recruited under the influence of the 3'RR can explain the available data. If it were the case, one might expect an alteration of germ line transcription from downstream as well as from upstream I promoters relative to neor insertion site (with the seemingly exception of I
1). Further, rather than through a strict looping model (35), the effect of the 3'RR on upstream I promoters may result from the propagation of a signal from the 3'RR (35, 36) that is somehow stopped by the expressed neor gene leading to an insulation of upstream but not of downstream I promoters, except maybe for I
1 promoter which has additional regulatory sequences (3740) that may enable a relative 3'RR-independent germ line transcription.
| Acknowledgements |
|---|
We thank Chantal Kress (Institut Pasteur, Paris) for the kind gift of ES cells (CK35) and Ahmed Boumediene for help with flow cytometry. M.S. was supported by a fellowship from the french Ministère des Affaires Etrangères (PAI CS/TP 11) and in part by a fellowship from the United Nations Educational, Scientific and Cultural Organization. Work in our laboratory is funded by Association pour la Recherche sur le Cancer (Grant N° 4403), Ligue Nationale Contre le Cancer (Equipe labellisée), The Switch Network and Conseil Régional du Limousin. We thank an unknown referee for his interesting suggestion.
| Abbreviations |
|---|
| C | constant region |
| CSR | class switch recombination |
| IgH | Ig heavy chain |
| neor | neomycine resistance |
| 3'RR | Ig heavy chain 3' regulatory region |
| RT | reverse transcription |
| S | switch |
| tk | thymidine kinase |
| wt | wild type |
| Notes |
|---|
Transmitting editor: A. Radbruch
Received 31 August 2005, accepted 17 January 2006.
| References |
|---|
|
|
|---|
- Stavnezer, J. 2000. Molecular processes that regulate class switching. Curr. Top. Microbiol. Immunol. 245:127.[ISI][Medline]
- Radbruch, A., Muller, W. and Rajewsky, K. 1986. Class switch recombination is IgG1 specific on active and inactive IgH loci of IgG1-secreting B-cell blasts. Proc. Natl. Acad. Sci. USA 83:954.
- Hummel, M., Berry, J. K. and Dunnick, W. 1987. Switch region content of hybridomas: the two spleen cell Igh loci tend to rearrange to the same isotype. J. Immunol. 138:3539.[Abstract]
- Winter, E., Krawinkel, U. and Radbruch, A. 1987. Directed Ig class switch recombination in activated murine B cells. EMBO J. 6:1663.[ISI][Medline]
- Delpy, L., Le Bert, M., Cogné, M. and Khamlichi, A. A. 2003. Germ-line transcription occurs on both the functional and the non-functional alleles of immunoglobulin constant heavy chain genes. Eur. J. Immunol. 33:2108.[CrossRef][ISI][Medline]
- Chaudhury, J. and Alt, F. W. 2004. Class-switch recombination: interplay of transcription, DNA deamination and DNA repair. Nat. Rev. Immunol. 4:541.[CrossRef][ISI][Medline]
- Reaban, M. E. and Griffin, J. A. 1990. Induction of RNA-stabilized DNA conformers by transcription of an immunoglobulin switch region. Nature 348:342.[CrossRef][Medline]
- Reaban, M. E., Lebowitz, J. and Griffin, J. A. 1994. Transcription induces the formation of a stable RNA.DNA hybrid in the immunoglobulin alpha switch region. J. Biol. Chem. 269:21850.
[Abstract/Free Full Text] - Daniels, G. A. and Lieber, M. R. 1995. RNA:DNA complex formation upon transcription of immunoglobulin switch regions: implications for the mechanism and regulation of class switch recombination. Nucleic Acids Res. 23:5006.
[Abstract/Free Full Text] - Mizuta, R., Iwai, K., Shigeno, M. et al. 2003. Molecular visualization of immunoglobulin switch region RNA/DNA complex by atomic force microscope. J. Biol. Chem. 278:4431.
[Abstract/Free Full Text] - Tian, M. and Alt, F. W. 2000. Transcription-induced cleavage of immunoglobulin switch regions by nucleotide excision repair nucleases in vitro. J. Biol. Chem. 275:24163.
- Yu, K., Chedin, F., Hsieh, C. L., Wilson, T. E. and Lieber, M. R. 2003. R-loops at immunoglobulin class switch regions in the chromosomes of stimulated B cells. Nat. Immunol. 4:442.[CrossRef][ISI][Medline]
- Nambu, Y., Sugai, M., Gonda, H. et al. 2003. Transcription-coupled events associating with immunoglobulin switch region chromatin. Science 302:2137.
[Abstract/Free Full Text] - Zhang, J., Bottaro, A., Li, S. C., Stewart, V. and Alt, F. W. 1993. A selective defect in IgG2b switching as a result of targeted mutation of the I gamma 2b promoter and exon. EMBO J. 12:3529.[ISI][Medline]
- Jung, S., Rajewsky, K. and Radbruch, A. 1993. Shutdown of class switch recombination by deletion of a switch region control element. Science 259:984.[Abstract]
- Bottaro, A., Lansford, R., Xu, L., Zhang, J., Rothman, P. and Alt, F. W. 1994. S region transcription per se promotes basal IgE class switch recombination but additional factors regulate the efficiency of the process. EMBO J. 13:665.[ISI][Medline]
- Harriman, G. R., Bradley, A., Das, S., Rogers-Fani, P. and Davis, A. C. 1996. IgA class switch in I alpha exon-deficient mice. Role of germline transcription in class switch recombination. J. Clin. Invest. 97:477.[ISI][Medline]
- Seidl, K. J., Bottaro, A., Vo, A., Zhang, J., Davidson, L. and Alt, F. W. 1998. An expressed neor cassette provides required functions of the I
2b exon for class switching. Int. Immunol. 10:1683.[Abstract/Free Full Text] - Lorenz, M., Jung, S. and Radbruch, A. 1995. Switch transcripts in immunoglobulin class switching. Science 267:1825.
[Abstract/Free Full Text] - Hein, K., Lorenz, M. G. O., Siebenkotten, G., Petry, K., Christine, R. and Radbruch, A. 1998. Processing of switch transcripts is required for targeting of antibody class switch recombination. J. Exp. Med. 188:2369.
[Abstract/Free Full Text] - Qiu, G., Harriman, G. R. and Stavnezer, J. 1999. I
exon-replacement mice synthesize a spliced HPRT-C
transcript which may explain their ability to switch to IgA. Inhibition of switching to IgG in these mice. Int. Immunol. 11:37.[Abstract/Free Full Text] - Kuzin, I. I., Ugine, G. D., Wu, D., Young, F., Chen, J. and Bottaro, A. 2000. Normal isotype switching in B cells lacking the Iµ exon splice donor site: evidence for multiple Iµ-like germline transcripts. J. Immunol. 164:1451.
[Abstract/Free Full Text] - Cogné, M., Lansford, R., Bottaro, A. et al. 1994. A class switch control region at the 3' end of the immunoglobulin heavy chain locus. Cell 77:737.[CrossRef][ISI][Medline]
- Manis, J. P., Vander Stoep, N., Tian, M. et al. 1998. Class switching in B cells lacking 3' immunoglobulin heavy chain enhancers. J. Exp. Med. 188:1421.
[Abstract/Free Full Text] - Khamlichi, A. A., Pinaud, E., Decourt, C., Chauveau, C. and Cogné, M. 2000. The 3' IgH regulatory region: a complex structure in a search for a function. Adv. Immunol. 75:317.[ISI][Medline]
- Pinaud, E., Khamlichi, A. A., Le Morvan, C. et al. 2001. Localization of the 3' IgH locus elements that effect long-distance regulation of class switch recombination. Immunity 15:187.[CrossRef][ISI][Medline]
- Manis J. P., Tian, M. and Alt, F. W. 2002. Mechanism and control of class-switch recombination. Trends Immunol. 23:31.[CrossRef][ISI][Medline]
- Harriman, G. R., Bogue, M., Rogers, P. et al. 1999. Targeted deletion of the IgA constant region in mice leads to IgA deficiency with alterations in expression of other Ig isotypes. J. Immunol. 162:2521.
[Abstract/Free Full Text] - Seidl, K., Manis, J. P., Bottaro, A. et al. 1999. Position-dependent inhibition of class-switch recombination by PGK-neor cassettes inserted into the immunoglobulin heavy chain constant region locus. Proc. Natl. Acad. Sci. USA 96:3000.
[Abstract/Free Full Text] - Khamlichi, A. A., Glaudet, F., Oruc, Z., Denis, V., Le Bert, M. and Cogné, M. 2004. Immunoglobulin class switch recombination in mice devoid of any Sµ tandem repeat. Blood 103:3828.
[Abstract/Free Full Text] - Li, S. C., Rothman, P. B., Zhang, J., Chan, C., Hirsh, D. and Alt, F. W. 1994. Expression of Iµ-C
hybrid germline transcripts subsequent to immunoglobulin heavy chain class switching. Int. Immunol. 6:491.[Abstract/Free Full Text] - Delpy, L., Decourt, C., Le Bert, M. and Cogné, M. 2002. B cell development arrest upon insertion of a neo gene between JH and Eµ: promoter competition results in transcriptional silencing of germline JH and complete V(D)J rearrangements. J. Immunol. 169:6875.
[Abstract/Free Full Text] - Cockerill, P. N. 1990. Nuclear matrix attachment occurs in several regions of the IgH locus. Nucleic Acids Res. 18:2643.
[Abstract/Free Full Text] - Manis, J. P., Michaelson, J. S., Birshtein, B. K. and Alt, F. W. 2003. Elucidation of a downstream boundary of the 3' IgH regulatory region. Mol. Immunol. 39:753.[CrossRef][ISI][Medline]
- Bulger, M. and Groudine, M. 1999. Looping versus linking: toward a model for long-distance gene activation. Genes Dev. 13:2465.
[Free Full Text] - Blackwood, E. M. and Kadonaga, J. T. 1998. Going the distance: a current view of enhancer action. Science 281:61.[CrossRef]
- Xu, M. Z. and Stavnezer, J. 1992. Regulation of transcription of immunoglobulin germ-line gamma 1 RNA: analysis of the promoter/enhancer. EMBO J. 11:145.[ISI][Medline]
- Elenich, L. A., Ford, C. S. and Dunnick, W. A. 1996. The gamma 1 heavy chain gene includes all of the cis-acting elements necessary for expression of properly regulated germ-line transcripts. J. Immunol. 157:176.[Abstract]
- Cunningham, K., Ackerly, H., Alt, F. W. and Dunnick, W. A. 1998. Germline transcription and recombination of a murine VDJmudeltagamma1 transgene. Int. Immunol. 10:527.
[Abstract/Free Full Text] - Adams, K., Ackerly, H., Cunningham, K. and Dunnick, W. 2000. A DNase I hypersensitive site near the murine gamma1 switch region contributes to insertion site independence of transgenes and modulates the amount of transcripts induced by CD40 ligation. Int. Immunol. 12:1705.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
Z. Oruc, A. Boumediene, M. Le Bert, and A. A. Khamlichi Replacement of I{gamma}3 germ-line promoter by I{gamma}1 inhibits class-switch recombination to IgG3 PNAS, December 18, 2007; 104(51): 20484 - 20489. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





