Skip Navigation


International Immunology Advance Access originally published online on February 15, 2006
International Immunology 2006 18(3):473-484; doi:10.1093/intimm/dxh388
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/3/473    most recent
dxh388v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (8)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mesri, M.
Right arrow Articles by Starling, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mesri, M.
Right arrow Articles by Starling, G. C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Japanese Society for Immunology. 2006. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Inhibition of in vitro and in vivo T cell responses by recombinant human Tim-1 extracellular domain proteins

Mehdi Mesri1,3,*, Glennda Smithson1,4,*, Ashwini Ghatpande1, Andrei Chapoval1, Suresh Shenoy1, Ferenc Boldog1, Craig Hackett1, Carol E. Pena1, Catherine Burgess1, Alison Bendele2, Richard A. Shimkets1 and Gary C. Starling1,5

1 CuraGen Corporation, 322 East Main Street, Branford, CT 06405, USA
2 Bolder BioPATH Inc., Boulder, CO, USA
3 Present address: Celera Genomics, 45 West Gude Drive, Rockville, MD 20850, USA
4 Present address: 675 North Field Drive, Lake Forest, IL 60045, USA
5 Present address: PDL Bio Pharma, 34801 Campus Drive, Fremont, CA 94555, USA

Correspondence to: G. Smithson; E-mail: info{at}curagen.com


   Abstract
Top
 Abstract
Introduction
 Methods
 Results
 Discussion
 References
 
Members of the T cell, Ig domain and mucin domain (Tim) family of proteins have recently been implicated in the control of T cell-mediated immune responses. Tim-1 (HUGO designation HAVCR1) polymorphisms have been linked to the regulation of atopy in mice and humans, suggestive of a role in immune regulation. Tim-1 is expressed upon activation of T cells. In concert with the increased expression of Tim-1, a binding partner for the extracellular domain of Tim-1 (eTim-1) was induced on activated T cells, and mRNA expression data was consistent with the binding partner being Tim-4. We found that co-immobilized recombinant eTim-1 was able to inhibit T cell activation mediated by CD3 + CD28 mAb. eTim-1 mediated its inhibitory effects on proliferation by arresting cell cycle at G0/G1 phase through regulation of cell cycle proteins. In vivo, administration of eTim-1 proteins led to a decrease in both ear (contact hypersensitivity to oxazolone) and joint (methylated BSA antigen-induced arthritis) swelling. The inhibitory activity of eTim-1 in the Th1-dependent models was evidence that eTim-1 is able to modulate T cell responses. Manipulation of the Tim-1 interaction with its binding partner on T cells may therefore provide a novel target for therapeutic intervention in T cell-mediated diseases.

Keywords: arthritis, co-stimulation, DTH, HAVcr1, proliferation


   Introduction
Top
 Abstract
 Introduction
Methods
 Results
 Discussion
 References
 
An optimal T cell response is achieved through signals delivered by the antigen-specific TCR in combination with co-stimulatory signals (1, 2). Chronic antigenic stimulation results in the polarization of Th subsets, namely Th1 and Th2 (3). Th1 cells release IFN{gamma}, IL-2 and tumor necrosis factor-{alpha}, whereas Th2 cells express IL-4, IL-5 and IL-13. Delayed-type hypersensitivity reactions (4) and a variety of organ-specific autoimmune disorders including multiple sclerosis, inflammatory bowl disease, rheumatoid arthritis and type I diabetes mellitus are associated with aberrant Th1 responses (5). In contrast, Th2 cell activation is a hallmark of allergic asthma (4, 6). Much effort has gone into understanding the checkpoints that control T cell polarization and the magnitude of the T cell response. Regulatory mechanisms include receptors such as CTLA-4 and PD-1, cytokines such as transforming growth factor ß and IL-10 and regulatory CD4+CD25+ T cells (7).

A new family of genes encoding T cell, Ig domain and mucin domain (Tim) proteins (three in humans and eight in mice) have recently been described with emerging roles in immunity (8, 9). Tim gene family members reside in chromosomal regions 5q33.2 in humans and 11B1.1 in mice, and have been linked to allergy and autoimmune diseases (7–10). Tim-2 is expressed by activated mouse CD4+ T cells (9, 11), and the interaction of Tim-2 with semaphorin 4A induces tyrosine phosphorylation of Tim-2. Tim-2 phosphorylation leads to enhanced production of cytokines and in vivo generation of antigen-specific T cells (11).

Tim-3 was identified by virtue of its Th1-specific expression (12). In vivo administration of anti-Tim-3 mAb in experimental allergic encephalomyelitis (a Th1-mediated autoimmune model) resulted in more severe inflammatory events in the brain and exacerbation of the disease phenotype (12). Furthermore, Tim-3 pathway blockade through treatment with a Tim-3–Ig fusion protein accelerated diabetes onset in non-obese diabetic mice and abrogated the capacity of co-stimulatory blockade to induce tolerance (13). Therefore, Tim-3 engagement by its putative ligand inhibits Th1-mediated inflammatory responses in vivo.

Tim-1 (HUGO designation HAVCR1) was originally identified in African green monkeys as a cellular receptor for Hepatitis A virus (14). An ortholog of Tim-1 was later identified in rat post-ischemic kidney tubules and named kidney injury molecule-1 (15, 16), and hypothesized to play an important role in the restoration of the morphological integrity and function to post-ischemic kidney. Injured kidney tubule cells in patients with acute tubular necrosis have been shown to secrete high levels of the protein into the urine (16). A role for Tim-1 in immune responses was first suggested following the identification of the Tapr locus and subsequent cloning of Tim-1 in a mouse model of allergic asthma (9). McIntire et al. (9) hypothesized that the interaction of hepatitis A virus and Tim-1 on CD4+ T cells may result in an inhibition of Th2 differentiation and lead to a reduction in the development of asthma and allergy. Such a hypothesis may explain findings of an inverse association of hepatitis A virus infection with the development of asthma and allergy (17–19). Tim-1 polymorphism, specifically a six-amino acid insertion in the mucin domain of Tim-1, is strongly linked to protection from asthma (20). Furthermore, Tim-1 mRNA expression has been reported to be higher during the clinically inactive phase of multiple sclerosis, and was accompanied by low expression of IFN{gamma} and therefore may be involved in an anti-inflammatory response (21). Since completion of the current study, Meyers et al. (22) demonstrated that mouse Tim-1 binds to Tim-4 on antigen-presenting cells (APCs). Tim-4 (SMUCKLER) had previously been shown to be expressed on stromal cells of secondary lymphoid tissues and not cells of hematopoietic origin (23).

Consistent with its expression on injured kidney cells, Tim-1 is also expressed at high levels by kidney tumor cell lines (24) and clear cell renal cell carcinoma (25). Tim-1 protein has also been found in the urine of patients with renal cell carcinoma and may be a marker of the disease (26). Given that other Tim family members are involved in regulating T cell responses and the proposed link between Tim-1 and atopy, we hypothesized that Tim-1 may also have a role in regulating immune responses. To investigate the role of Tim-1 on human T cell function, we expressed and purified the recombinant extracellular domain of Tim-1 (eTim-1) and a fusion protein in which the eTim-1 was fused to the Fc domain of human IgG1 (eTim-1–Fc). We found that both eTim-1 proteins were able to down-regulate T cell proliferation and production of both Th1 and Th2 cytokines following stimulation by CD3 + CD28 mAb. In vivo administration of eTim-1 proteins attenuated swelling in contact hypersensitivity and antigen-induced arthritis (AIA) models. Perturbation of the interaction of Tim-1 with its binding partner on T cells is therefore able to inhibit T cell-mediated immune responses.


   Methods
Top
 Abstract
 Introduction
 Methods
Results
 Discussion
 References
 
Cells and reagents
Blood was drawn from healthy volunteers under protocol C-224 approved by Goodwyn IRB (Cincinnati, OH, USA). Human PBMC were prepared by density gradient centrifugation over lymphoprep (Greiner Bio-one Inc., Longwood, FL, USA). T cells were further isolated from PBMC by positive selection using the magnetic cell separation system (autoMACS), according to the manufacturer's recommendations (Miltenyi Biotech, Auburn, CA, USA). Briefly, PBMC were first incubated for 20 min at 4°C with CD14 microbeads and separated by positive selection over the magnetic column. The CD14-negative cells were then washed and incubated with CD8 or CD4 microbeads for 20 min at 4°C and separated by positive selection as above over a magnetic column system.

Mouse CD4+ and CD8+ T cells were prepared from spleens of 6-week-old female C57BL/6 mice, treated with Tris–NH4Cl to deplete erythrocytes and purified by magnetic activated cell sorting separation column as described above. Cell lines were obtained from American Type Culture Collection (Rockville, MD, USA). A fully human Tim-1 mAb was generated as described previously (27) by Abgenix, Inc. (Fremont, CA, USA) with the following modifications. Briefly, the human IgG4-bearing XenoMouse® strain (8- to 10-week old) was immunized twice weekly by footpad injection with 10 µg of V5-tagged soluble Tim-1 (eTim-1, described below) in CFA. Hybridomas were generated using electrocell fusion. Control human IgG4 was purchased from Sigma. Purified anti-human CD3 (clone UCHT1), anti-human CD28 (clone CD28.2), anti-mouse CD3e (clone 145-2C11) and anti-mouse CD28 (clone 37.51) mAbs were all from Pharmingen, San Diego, CA, USA. Dynabeads M-450-Epoxy were purchased from Dynal Biotech Inc. (Brown Deer, WI, USA). Mouse MAdCAM-1–Fc was from R&D systems (Minneapolis, MN, USA).

Isolation and cloning of eTim-1
Restriction enzymes were obtained from New England Biolabs (Beverly, MA, USA) and Taq polymerase from Clontech (Palo Alto, CA, USA). The PCR and molecular cloning were done according to standard protocols. The pCR2.1 vector was obtained from Invitrogen (Carlsbad, CA, USA). The pEE14.4Sec2 and pEE14.4SecFc3' mammalian expression vectors are derivatives of the pEE14.4 backbone (Lonza Biologics, Slough, UK). Both vectors encoded the mouse Ig{kappa} secretion signal, and in frame C-terminal V5 and His6 tags. In addition, the expression construct, in the pEE14.4SecFc3' vector, encoded the hinge-CH2-CH3 domains of human IgG1 fused to the C-terminus of the Tim-1 insert.

On the basis of the predicted sequence, oligonucleotide primers were designed to amplify the mature form of the eTim-1 cDNA (forward primer: GGATCCTCTGTAAAGGTTGGTGGAGAGGCAGGTCC, reverse primer: CTCGAGCAGTAGACTATGTTCTAGGAACAGTTGAG) The template was 5 ng of a mixture containing equal parts of cDNAs derived from human testis, mammary, skeletal muscle and fetal brain tissues. A single 750-bp-large PCR product was obtained and cloned into pCR2.1 vector. The resultant Tim-1 cDNA encoded a protein that differed from the original GenBank-deposited sequence (accession number AF043724) by one amino acid at position 184. This polymorphism corresponded T -> A. The frequency of the allele with A is 20% in non-redundant GenBank.

The BamHI–XhoI fragment from pCR2.1/Tim-1 was cloned into pEE14.4Sec2 and pEE14.4SecFc3' expression vectors. Stable CHOK1 cell lines which expressed either the mature extracellular domain (eTim-1) or the mature extracellular domain fused to the hinge, CH2-CH3 domains of human IgG1 (eTim-1–Fc) were established.

Expression, purification, and biochemical characterization of recombinant eTim-1 proteins
The stable cell lines were adapted to suspension conditions, and were cultured using the disposable bioreactor Wave technology (Wave Biotech, Bridgewater, NJ, USA). The conditioned medium was loaded onto a Ni2+ affinity column (Qiagen, Valencia, CA, USA). The column was washed with PBS (pH 7.4), containing 500 mM NaCl, followed by the same buffer containing 50 mM imidazole. The bound protein was eluted with PBS (pH 7.4), containing 500 mM NaCl and 500 mM imidazole, pooled and dialyzed overnight in PBS (pH 7.4) containing 500 mM NaCl. The protein was further purified by a second round of purification over a Ni2+ affinity column and dialyzed against Tris-buffered saline (pH 7.4). Protein concentrations were determined using the Bradford reagent (Bio-Rad, Hercules, CA, USA). Protein purity was assessed by Coomassie Blue staining after SDS-PAGE analysis using a 4–20% Tris/glycine gradient gel. Immunoblot analysis was performed with anti-V5 tag mAb (1:5000) conjugated to HRP, followed by enhanced chemiluminescence (Amersham Biosciences, Piscataway, NJ, USA). Proteins were tested for endotoxin using the end-point colorimetric method (Cambrex Bio Science Walkersville, Walkersville, MD, USA) and found to have <7 EU mg–1. The tagged control proteins used for this study were produced as described above. The control proteins used to assess the effect of the V5 and His6 tags were derived from amino acids 20–582 of GenBank accession number AX084239 and amino acids 105–574 of GenBank accession number AX359697.

RT-PCR
Falcon 6-well plates (BD Biosiences, San Jose, CA, USA) were coated overnight at 4°C with 1 ml per well, 1x Dulbecco's PBS containing 2 µg ml–1 of CD3 mAb and 10 µg ml–1 CD28 mAb. The next day, the wells were washed with PBS and CD4+ T cells were added in 10% FBS containing DMEM medium. Plates were incubated at 37°C, 5% CO2. CD4 T cells (5 x 106) were removed from the plates from day 1 through day 8 of activation, spun down, washed with PBS and cell pellets were re-suspended in 1 ml of TRIzol reagent (Invitrogen) for total RNA isolation. For the day 0 time point, 5 x 106 of fresh CD4+ T cells were used. Total RNA was extracted by TRIzol reagent and reverse transcribed with 1 x 104 unit ml–1 SuperScript II ribonuclease (RNase) H reverse transcriptase (Superscript II Kit, Invitrogen) using oligo(dT). The reverse transcription (RT) reaction containing 3 µg of total RNA or 50 ng of control RNA, 0.5 µg of oligo(dT), 1 x 104 unit ml–1 reverse transcriptase in the presence of 25 mM MgCl2, 10 mM deoxyribonucleotide triphosphate mix and 0.1 M dithiothreitol was incubated for 1 h at 42°C. At the end of the incubation, samples were heated for 15 min at 70°C, chilled on ice, mixed with 1 µl of RNase H for 20 min at 37°C and amplified by PCR using platinum high fidelity Taq DNA polymerase (Invitrogen) with oligonucleotides (forward primer: GTCACACTACCCTGCCACTACA, reverse primer: CTGGTGGGTTCTCTCCTTATTG) derived from the sequence of Tim-1. Thirty cycles of amplification were carried out in a PerkinElmer 480 thermal cycler with pre-denaturation at 94°C for 2 min and cycled for 45 s at 94°C, annealing for 45 s at 60°C, and extension for 1 min at 68°C for 30 cycles. PCR products were analyzed on 1% agarose gels by ethidium bromide staining. ß-Actin was used as a control.

Activation of T cells
Nunc 96-well plates (Rochester, NY, USA) were pre-coated overnight at 4°C with 150 ng ml–1 of CD3 mAb and 1 µg ml–1 of CD28 mAb, aspirated and coated for 4 h at 37°C with control or Tim-1 protein variants at different concentrations. Wells were washed and human or mouse T cells were plated in DMEM (Life Technologies, Grand Island, NY, USA) supplemented with 10% FCS (Invitrogen), L-glutamine (2 mM), 100 U ml–1 penicillin, 100 µg ml–1 streptomycin, 10 mM HEPES and 50 µM 2-mercaptoethanol (all from Life Technologies) and incubated for 72 h.

Tim-4 expression analysis using DNA microarray hybridization
Cells were collected, activated and their RNA isolated as described above. Biotin-labeled cDNA was generated and hybridized to the proprietary CuraChip DNA microarray (CuraGen Corporation, Branford, CT, USA) as previously described (28). Data were subjected to 90th percentile normalization, and expression of the Tim-4 gene was analyzed in comparison to that of the housekeeping gene GAPDH. The oligonucleotide sequence used to detect Tim-4 was 5'-AAACACACAAGGCTAGACTACATTGGAGAT, corresponding to basepairs 1099–1128 of the Tim-4 transcript (accession number NM_138379). The oligonucleotide sequence used to detect GAPDH was 5'-ACCTTGTCATGTACCATCAATAAAGTACCC, corresponding to basepairs 1243–1272 of the GAPDH transcript (accession number NM_002046).

Proliferation assays
For T cell proliferation assays, 96-well flat bottom Nunc plates were pre-coated as above. Wells were washed and cells were plated at a density of 1 x 105 cells per well and proliferation was measured by [3H]thymidine incorporation (0.5 µCi per well) for the final 6 h of a 72-h culture. Cells were harvested on a Packard FilterMate harvester (PerkinElmer Life and Analytical Sciences, Boston MA, USA). The incorporated radiolabeled thymidine was measured with a Wallac MicroBeta TriLux scintillation counter (PerkinElmer Life and Analytical Sciences).

Cytokine ELISA
Aliquots of supernatants were collected 72 h after initiation of cultures. IL-2 and IFN{gamma} were analyzed by two-step ELISA with kits purchased from Pharmingen.

Flow cytometry
For detection of a Tim-1-binding partner, 1 x 106 T cells or Jurkat cells were incubated with 10 µg ml–1 eTim-1–Fc. Bound protein was detected following staining with PE-conjugated goat anti-human IgG (Jackson Immunoresearch, West Grove, PA, USA). For detection of expression of Tim-1 protein on T cells, cells were incubated with 10 µg ml–1 of control human IgG4 (Sigma) or fully human anti-Tim-1 mAb and detected with PE-conjugated goat anti-human IgG. After each step, cells were washed twice with 1% BSA in PBS with 0.005% sodium azide (staining buffer). Ten thousand events were analyzed on a FACSCalibur (Becton Dickinson, Mountain,View, CA, USA).

For detection of IL-2R{alpha} (CD25), CD4+ T cells were stimulated for 72 h with immobilized CD3 mAb (150 ng ml–1) and CD28 mAb (1 ug ml–1) in the presence or absence of immobilized eTim-1 (10 µg ml–1) or control protein (10 µg ml–1). Cells were then harvested and stained with CD25-Cy-Chrome-conjugated antibody (BD Biosicences) or isotype-matched control antibody. After each step, cells were washed twice with staining buffer.

Cell division and cell cycle analysis
For cell division measurement, freshly isolated CD4+ T cells were labeled with CFSE (Molecular Probes, Eugene, OR, USA) according to the manufacturer's instructions, and plated on 6-well plates pre-coated for 18 h at 4°C with CD3 mAb (150 ng ml–1), CD28 mAb (1 µg ml–1) and eTim-1 (10 µg ml–1) or control protein (10 µg ml–1) in the presence or absence of IL-2 (5 ng ml–1) for 96 h and then analyzed by flow cytometry. For cell cycle analysis, unlabeled CD4+ T cells were stimulated as above and after 96 h, cells were washed in PBS, fixed in ethanol (70%) for 1 h on ice and then re-suspended in PBS containing RNase (10 µg ml–1, Sigma) and propidium iodide (50 µg ml–1, Sigma). Flow cytometric analysis was carried out within 1 h of staining.

Immunoblot analysis
CD4+ T cells (3 x 106) were lysed in Triton lysis buffer [100 mM NaCl, 25 mM Tris–HCl (pH 7.4), 0.1% SDS, 0.5% sodium deoxycholate, 1% Triton X-100 and protease inhibitor cocktail (Roche, Mannheim, Germany)] for 20 min on ice. The protein concentration of the lysates was determined by BCA assay (Pierce Biotechnology, Rockford, IL, USA). Twenty micrograms of each sample or 40 ng of recombinant purified eTim-1 protein was loaded onto a gradient 4–20% SDS-polyacrylamide gel (Invitrogen) and resolved by electrophoresis. The gel was then transferred to a nitrocellulose membrane (Invitrogen). The membrane was blocked in 5% dry milk/0.1% Tween 20–PBS overnight at 4°C, and immunoblotted with 1 µg ml–1 human anti-Tim-1 mAb or control human IgG4 (Sigma). For analysis of cell cycle-related proteins, membranes were immunoblotted with anti-cdk4, anti-cdk6, anti-cyclin D3 or anti-p27 antibodies (all from Santa Cruz Biotechnology, Santa Cruz, CA, USA). The bound antibody was detected by the appropriate HRP-conjugated secondary antibody (Jackson ImmunoResearch) and visualized using chemiluminescence (ECL, Amersham).

Induction of contact hypersensitivity
Female BALB/c mice ranging in age from 9 to 14 weeks and in weight from 17–20 g were obtained from Harlan TEKLAD (Madison, WI, USA). Mice were housed in rooms with constant temperature and humidity, under 12 h light/dark cycles, and fed with standard laboratory diet and water ad libitum. Animals were sensitized by applying a 5% solution of oxazolone (Sigma) in 3:1 ethanol:acetone solvent onto the shaved skin of the abdomen. Six days after sensitization, mice were challenged by applying 3% oxazolone onto the right ear and solvent alone onto the left ear as a control. Mice were given 10 mg kg–1 cyclosporin, 5 mg kg–1 each of eTim-1–Fc, eTim-1, hIgG1 (Sigma) or PBS intraperitoneally (i.p.) 1 day before the day of sensitization, the day of sensitization and 2 days after sensitization. The thickness of the ears was measured daily with a digital caliper (Mitutoyo, Kawasaki, Japan) starting immediately before challenge and continuing until sacrifice.

Murine AIA
For disease induction, 6-week-old male Swiss Webster mice were sensitized with 0.2 mg methylated BSA (mBSA) in CFA containing Mycobacterium tuberculosis. Mice were injected intra-dermally at the base of the tail on days 0 and 7. On day 14, animals were challenged with 20 µl of 10 mg ml–1 mBSA in the right hind footpad and 10 µl of 10 mg ml–1 mBSA in water injected into the right knee. Mice were treated i.p. every day with eTim-1, eTim–Fc or human IgG1 (Sigma) or 0.2 mg kg–1 dexamethasone on days –1, 0, 2 and 6, 7 and 9 or on days 13–18. The ankles of the animals were measured with calipers (medial to lateral) once a day for 5 days (days 15–19).

On day 19, the knees and paws were harvested. The paws were transected at the medial and lateral malleolus, fixed in formalin and embedded in paraffin for histopathologic evaluation of soft tissue inflammation. The right knee was harvested for histopathologic scoring of knee arthritis. The knee joints were placed for 1–2 days in fixative and 4–5 days in decalcifier and knees were processed, embedded in paraffin in the frontal plane, sectioned and stained with toluidine blue. Processed knee joints were scored for inflammation, pannus formation, cartilage damage and bone resorption. The left hind paws and knees of unsensitized mice were collected for use as normal controls.


   Results
Top
 Abstract
 Introduction
 Methods
 Results
Discussion
 References
 
Tim-1 expression on T cells
To investigate the kinetics of the induction of Tim-1, human CD4+ T cells were stimulated with CD3 + CD28 mAb, and Tim-1 mRNA expression was visualized by RT-PCR. Resting CD4+ T cells expressed low levels of Tim-1 mRNA, but stimulation with immobilized CD3 + CD28 mAb resulted in a strong increase in the expression of Tim-1 mRNA at 72-h post-stimulation and was sustained over a 7-day period (Fig. 1a). To confirm that the increase in expression of Tim-1 mRNA led to an increase in Tim-1 protein, an anti-Tim-1 mAb was used to immunoblot Tim-1 protein. Immunoblotting confirmed an increase in expression of Tim-1 protein at 72 h on CD3 + CD28 mAb-activated T cells as compared with non-activated T cells. Lysates derived from activated T cells revealed a major band at ~110 kDa as well as two other bands at ~70 and 40 kDa (Fig. 1b). This is consistent with previous reports which also indicate that human Tim-1 from kidney tumor cell lines and rat Tim-1 protein appear as three distinct bands after SDS-PAGE (15, 24). Human Tim-1 contains a heavy pattern of glycosylation (8), and therefore the protein will likely have a higher apparent mobility than the predicted size of 36 kDa. In comparison, the tagged recombinant eTim-1 had a molecular weight at ~75 kDa (Fig. 1b).


Figure 1
View larger version (31K):
[in this window]
[in a new window]
  		Fig. 1. Tim-1 is expressed by activated T cells. (a) Kinetics of Tim-1 mRNA transcript expression in anti-CD3- and anti-CD28-stimulated (stimulation period as noted, 0–8 days) CD4+ T cells were detected by RT-PCR from multiple blood donors with analysis of amplified bands by ethidium bromide staining. The Tim-1 band is ~647 bp and the ß-actin band 582 bp. Data is representative of one of seven donors. (b) A total of 3 x 106 freshly isolated (resting) or 72-h anti-CD3 mAb (150 ng ml–1)- and anti-CD28 (1 µg ml–1)-stimulated (72 h) human CD4+ T cell lysates or 40 ng of recombinant human Tim-1 protein (eTim-1) were analyzed by western blotting using control hIgG4 or fully human anti-Tim-1 mAb. The data is representative of two independent experiments. (c) Freshly isolated or 72-h anti-CD3 mAb (150 ng ml–1)- and anti-CD28 (1 µg ml–1)-stimulated human CD4+ T cells, stained with control hIgG4 (filled histograms) or fully human anti-Tim-1 mAb (open histograms) followed by FACS analysis. The data are representative of two independent experiments.

 
Surface expression of Tim-1 protein on T cells was examined by flow cytometry. Freshly isolated human CD4+ T cells expressed minimal levels of Tim-1 protein as determined by immunofluorescence with the anti-Tim-1 mAb, however after 72 h of stimulation, CD4+ T cells markedly induced protein expression (Fig. 1c). Visualization of cell-surface expression of Tim-1 following activation was confirmation of the mRNA expression and immunoblot data.

Activated T cells express a Tim-1-binding partner
In order to determine the functional activity of Tim-1 in T cell immune responses, we produced various versions of the extracellular domain of the Tim-1 protein in CHO cells (eTim-1). To determine if Tim-1 had a binding partner on human T cells, we incubated resting and activated T cells with eTim-1–Fc and analyzed binding by detection of the Fc tag with PE-conjugated anti-human IgG. We found that eTim-1–Fc did not measurably bind to freshly isolated human CD4+ or CD8+ T cells. However, upon stimulation with CD3 + CD28 mAb for 72 h, both T cell subsets showed a distinct peak shift compared with the human IgG1 control (Fig. 2a and b). These results suggested that both CD4+ and CD8+ T cells express a binding partner for Tim-1 upon activation. Confirming the data from resting T cells, we also found that eTim-1–Fc bound to Jurkat cells, and that the level of binding could be further increased by treatment of the cells with phorbol myristate acetate and ionomycin (Fig. 2c). Likewise, eTim-1–Fc also bound to 72-h CD3 + CD28 mAb-stimulated mouse CD4+ or CD8+ T cells (data not shown), indicating cross-species conservation of the Tim-1-binding partner.


Figure 2
View larger version (22K):
[in this window]
[in a new window]
  		Fig. 2. Expression of a binding partner for Tim-1 on activated T cells. Freshly isolated or 72-h anti-CD3 mAb (500 ng ml–1)- and anti-CD28 (5 µg ml–1)-stimulated human CD4+ T cells (a), or CD8+ T cells (b), and untreated or phorbol myristate acetate (10 ng ml–1)- and ionomycin (1 µg ml–1)-stimulated Jurkat cells (c), were stained with control human IgG (filled histograms), or eTim-1–Fc (open histograms), followed by anti-human IgG–PE and subjected to FACS analysis. (d) Microarray analysis of Tim-4 expression in CD4+ and CD8+ T cells activated with mAb as noted. Tim-4 relative expression is presented as a ratio of the Tim-4 oligonucleotide hybridization signal to the GAPDH oligonucleotide signal (Tim-4/GAPDH), and the maximum ratio (0.018) set at 100%. Data are representative of three independent experiments.

 
Tim-4 has recently been shown to be a binding partner for Tim-1 (22). In the mouse strains studied, Tim-4 mRNA was not detected in non-activated T cells or polarized T cells. To determine if human T cells expressed Tim-4 after activation, we examined Tim-4 transcript expression on freshly isolated human T cells and human T cells cultured under a variety of conditions. Transcript expression was evaluated on a microarray developed at CuraGen (28). Tim-4 expression was detected in human T cells (both CD4 and CD8 subsets) and specific hybridization was greater in activated T cells (stimulated with either CD3 mAb alone or CD3 + CD28 mAb) than in resting T cells (Fig. 2d). These data are consistent with the Tim-1-binding protein on activated T cells being Tim-4, but definitive proof awaits development of a Tim-4-specific mAb.

Co-immobilized eTim-1 inhibits T cell activation
To determine if the binding of eTim-1–Fc protein was functionally relevant, we investigated whether eTim-1–Tim-1-binding partner interactions were able to inhibit optimal TCR-mediated stimulation driven by CD3 + CD28 mAb. Purified human CD4+ and CD8+ T cells were stimulated by immobilized CD3 + CD28 mAb in the presence of eTim-1 proteins or control protein for 72 h. We found that both the eTim-1 and eTim-1–Fc proteins inhibited the proliferation of CD4+ T cells (Fig. 3a). Three comparisons were made to determine that the inhibition of T cell activation was specific for eTim-1. Human IgG1 was used as an isotype control for the Fc portion of eTim-1–Fc. To evaluate the effects of the V5–His tag on eTim-1 and eTim-1–Fc, the experiment was controlled with proteins as described in the Methods. The third comparison was with a related protein–Fc fusion protein that had a similar mucin domain (MadCAM-1–Fc). These proteins showed little or no inhibitory activity in this assay, indicating that the inhibition of T cell activity was specific for the eTim-1. In contrast to immobilized eTim-1–Fc, soluble eTim-1–Fc did not inhibit T cell proliferation stimulated by CD3 + CD28 mAb at the concentrations tested (Fig. 3a). The inhibition of T cell activity was consistent, both eTim-1 or eTim-1–Fc treatment inhibited CD3 + CD28-driven cytokine production from CD4+ and CD8+ T cells (represented in Fig. 3b by the inhibition of IL-2 production from CD4+ T cells). We also observed inhibition of IL-5 and IFN{gamma} from CD4+ and CD8+ T cell subsets (data not shown).


Figure 3
View larger version (12K):
[in this window]
[in a new window]
  		Fig. 3. Inhibition of CD3 + CD28-mediated T cell responses by eTim-1 proteins. The 96-well plates were coated with anti-CD3 and anti-CD28 mAb at 150 ng ml–1 and 1 µg ml–1, respectively in PBS overnight at 4°C, aspirated and coated with the indicated eTim-1 protein variants or controls for 4 h at 37°C (eTim-1–Fc, closed squares; eTim-1, closed triangles; control IgG1, open squares; control protein, open triangles solid line; MAdCAM-1–Fc, open triangles dashed line). Wells were aspirated and plated with 150 µl of (a) purified Human CD4+ (additional wells with soluble proteins, dashed lines; control IgG1, open circle; eTim-1–Fc, closed circle), (b) human CD8+, (c) B6 mouse T cells, at a concentration of 0.7 x 106 cells ml–1. Proliferation was measured by [3H]thymidine incorporation in triplicate wells after 72 h. Aliquots of supernatants were collected at 72 h after initiation of cultures and IFN{gamma} measured by ELISA. These data are representative of at least three independent experiments.

 
Inhibition of mouse T cell activation with human eTim-1 proteins
As predicted from our observation that activated mouse T cells also bound eTim-1 proteins, we found that eTim-1 proteins were able to inhibit CD3 + CD28 mAb-induced murine T cell responses. eTim-1 blocked mouse T cell proliferation (data not shown) and inhibited the production of IFN{gamma} from mouse CD8+ T cells in a concentration-dependent manner (Fig. 3c). The cross-species reactivity enabled the use of human eTim-1 proteins in mice to examine the effects of these proteins in vivo.

eTim-1 treatment inhibits the induction of IL-2R{alpha} (CD25) expression on T cells
A hallmark of T cell activation is up-regulation of expression of CD25, the IL-2R{alpha} chain. We used flow cytometry to assess the expression of CD25 on T cells following CD3 + CD28 co-stimulation with and without concomitant eTim-1 ligation of Tim-1-binding partner. Stimulation of T cells resulted in the expression of CD25 on the majority of T cells. When eTim-1 was co-immobilized with the mAb, up-regulation of CD25 expression was almost completely inhibited (Fig. 4). Therefore, along with inhibition of T cell cytokine production, eTim-1 is able to inhibit cytokine receptor expression.


Figure 4
View larger version (22K):
[in this window]
[in a new window]
  		Fig. 4. eTim-1 inhibits up-regulation of IL-2R{alpha} chain expression on T cells. CD4+ T cells from healthy blood donors were cultured in anti-CD3 (150 ng ml–1), anti-CD28 (1 µg ml–1) and control protein or eTim-1 (10 µg ml–1)-coated six-well plates. Cells were harvested at 72 h, stained with anti-CD25–PE (open histograms) or control isotype-matched IgG–PE (filled histograms) and analyzed by FACS.

 
eTim-1 treatment arrests T cells in G0/G1 phase
The profound inhibitory effect of eTim-1 in T cell proliferation, cytokine production and cell-surface receptor expression suggests that eTim-1 may inhibit cell division and arrest cell cycle. To test these possibilities, purified CD4+ T cells were labeled with CFSE, incubated with immobilized CD3 + CD28 mAb and eTim-1 or control protein in the presence or absence of IL-2 (5 ng ml–1) for 96 h and then analyzed by flow cytometry. Stimulation of CD4+ T cells induced significant cell division, with cells exhibiting more than four cell divisions at 96 h. This response was not affected by the presence of the control protein. A marked inhibition of cell division was observed in the cells treated with eTim-1 proteins, as assessed by the significantly lower percentage of cells in the dividing peaks (5%) and decreased number of peaks (Fig. 5a). Inclusion of IL-2 in these cultures restored cell division in a sub-population of cells consistent with eTim-1 protein inhibiting most but not all IL-2R expression of T cells (Fig. 5a).


Figure 5
View larger version (25K):
[in this window]
[in a new window]
  		Fig. 5. eTim-1 inhibits progression into the cell cycle. (a) CD4+ T cells from healthy blood donors were labeled with CFSE (10 µM) and cultured in the anti-CD3 (150 ng ml–1), anti-CD28 (1 µg ml–1) and control protein or eTim-1 (10 µg ml–1)-coated six-well plates and in the presence or absence of IL-2 (5 ng ml–1). Cells were harvested at 96 h and analyzed using flow cytometry. (b) Unlabeled CD4+ T cells as treated in (a) were washed in PBS, fixed in ethanol (70%) for 1 h on ice and then re-suspended in PBS containing RNase (10 µg ml–1, Sigma) and propidium iodide (50 µg ml–1, Sigma). Analysis was carried out within 1 h of staining by flow cytometry. The results are representative of three independent experiments. (c) CD4+ T cells cultured in the absence or presence of coated anti-CD3 (150 ng ml–1), anti-CD28 (1 µg ml–1) and control protein or eTim-1–Fc (10 µg ml–1) in six-well plates for 24 h. Cell lysates were obtained, protein quantitated and 20 µg per lane was analyzed by immunoblotting as described in Methods. The data are representative of two independent experiments.

 
To determine the effect of eTim-1 treatment on the cell cycle, CD4+ T cells were labeled with propidium iodide for the analysis of cell cycle progression and apoptosis. Inclusion of eTim-1–Fc decreased the cell numbers in S/G2M phase (from 22 to 10%) while the cell numbers in G0/G1 phase increased (from 53 to 76%), compared with cells treated with control protein (Fig. 5b), indicating that eTim-1 arrests T cells in G0/G1 phase. The percentage of apoptotic cells (as determined by the sub-diploid population that showed low staining of propidium iodide) was unaffected by treatment, indicating that programmed cell death is not the mechanism responsible for the observed inhibition of T cell responses.

Cell cycle progression is regulated by a series of cyclins, cyclin kinases and inhibitors. To confirm that eTim-1 blocked cell cycle progression, we investigated regulatory elements involved in G0/G1 to S transition. Stimulation of resting T cells through the TCR complex results in transcriptional activation of cyclin D3, cdk4 and cdk6, as well as degradation of p27 (29, 30). CD3 + CD28 engagement led to cyclin D3, cdk4 and cdk6 protein expression, which were faintly detectable in resting T cells. Interestingly, immobilized eTim-1 protein dramatically inhibited the induction of these kinase elements when cross-linked in conjunction with CD3 + CD28 ligation. Conversely, degradation of the inhibitor p27 initiated by CD3 + CD28 mAb stimulation was inhibited by coated eTim-1 protein (Fig. 5c).

eTim-1 inhibits contact hypersensitivity
To determine the in vivo effects of administration of eTim-1 protein, we dosed BALB/c mice in an oxazolone-induced contact hypersensitivity model. Mice were treated with 5 mg kg–1 eTim-1 or eTim-1–Fc proteins on day –1, 0 and 2 and sensitized to the oxazolone on day 0. Mice were challenged with oxazolone on day 6, and the ear swelling measured until after no difference was discerned between control and challenged ears. Both eTim-1 and eTim-1–Fc proteins significantly blocked the ear swelling response 24 h post-challenge when compared with hIgG1 control or PBS diluent (P < 0.0003) (Fig. 6). The inhibition of the ear swelling response was maintained on days 9 (P < 0.02), 11 (P < 0.03) and 13 (P < 0.04).


Figure 6
View larger version (21K):
[in this window]
[in a new window]
  		Fig. 6. eTim-1 inhibits in vivo immune responses to foreign antigen. (a) Mice were challenged with oxazolone on the 6th day after sensitization with antigen. eTim-1–Fc (5 mg kg–1, closed squares) or eTim-1 (5 mg kg–1, open triangles) were administered i.p. 1 day prior and on days 1 and 2 following sensitization. eTim-1–Fc, eTim-1 or cyclosporin (10 mg kg–1, open diamonds) decreased ear swelling response when compared with PBS (open circles) or hIgG1 (open squares). The data are representative of two independent experiments.

 
eTim-1 inhibits joint swelling but not joint damage in AIA
The ability of eTim-1 proteins to inhibit ear swelling in a contact hypersensitivity model led us to further investigate the activity of eTim-1–Fc in other Th1-mediated models. We chose the AIA model, using mBSA as our antigen. We examined both soft tissue inflammation in the paw and ankle and the changes in inflammatory infiltrate and joint destruction in the knee. Proteins and controls were administered either around the time of sensitization (prophylactic administration) with mBSA or around the time of challenge (therapeutic administration). Joint swelling was reduced by prophylactic treatment of the mice with eTim-1–Fc to a level similar to prophylactic dexamethasone treatment (Fig. 7a), indicating that eTim-1–Fc was able to alter the priming phase of the T cell response. Likewise, therapeutic treatment with eTim-1–Fc also reduced joint swelling (Fig. 7b), demonstrating that eTim-1–Fc was able to down-regulate ongoing immune responses. The inhibition observed following therapeutic administration of eTim-1–Fc was less than observed with dexamethasone treatment. The major difference in the activity of dexamethasone and eTim-1–Fc with both treatment regimes was seen in histological analyses of the knee joints, where dexamethasone treatment was relatively effective at inhibiting joint inflammatory cell infiltration and provided a degree of protection from joint destruction, whereas eTim-1–Fc showed only a minor degree of inhibition of both joint inflammatory cell infiltration and joint destruction (data not shown).


Figure 7
View larger version (21K):
[in this window]
[in a new window]
  		Fig. 7. eTim-1–Fc inhibition of joint swelling in the AIA model. Ankle swelling in mice challenged with mBSA on day 14 and treated (a) on days –1, 0, 2 and 6, 7, 9 (prophylactic dosing) or (b) days 13–18 (therapeutic dosing) with eTim-1–Fc (15 mg kg–1, closed squares; 5 mg kg–1, closed circles; 1 mg kg–1, closed triangles), PBS (open circles) or human IgG1 (15 mg kg–1, open squares) compared with an unsensitized control group (open diamonds). Dexamethasone (closed diamonds) was used as a positive control and given either prior to challenge on days –1 to 9 or following challenge on days 13–18 (0.1 mg kg–1 prior or 0.3 mg kg–1 following; p.o.). Treatment with eTim-1–Fc at 15 mg kg–1 significantly reduced inflammation as compared with IgG1 with P values of P = 0.028 for prophylactic treatment and P = 0.018 for therapeutic treatment. The x-axis label is study day, where sensitization to mBSA was performed on day 0. This experiment is one of two representative experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
References
 
Administration of eTim-1 protein in vitro and in vivo has marked inhibitory effects on T cell immune responses. The data support one of two potential mechanisms of action. eTim-1 may have agonist activity on the T cell population by binding and triggering a negative signal through its binding partner. Alternatively, the interaction of eTim-1 and its binding partner on T cells is vital for T cell activation, a process that could be blocked by exogenous eTim-1. We found that soluble eTim-1 protein was ineffective at inhibiting in vitro T cell responses, suggesting that cross-linking and thus agonistic activity via a direct signal through a binding partner of Tim-1 is required for T cell inhibition. The co-expression of the Tim-1 molecule and its binding partner at an equivalent stage of the activation program of T cells supports the hypothesis that the Tim-1–Tim-1-binding partner interaction has a role in modulating T cell responses. Meyers et al. recently identified Tim-4 (SMUCKLER) as a binding partner for Tim-1. Tim-4 is also expressed on APCs and stromal cells of secondary lymphoid follicles. The confirmation of Tim-4 as the Tim-1-binding partner on T cells awaits development of specific anti-human mAb; however, the results from our microarray analyses are consistent with this notion.

Our results indicated that eTim-1 inhibits T cell responses by cell cycle arrest rather than by the induction of T cell apoptosis. The eTim-1 protein blocked at a relatively early stage of T cell activation prior to the onset of differentiation. This is supported by the finding that eTim-1 inhibited both Th1- and Th2-type cytokines. The inhibitory effects of eTim-1 on T cell proliferation could not be completely restored by exogenous IL-2 supplement, indicating that eTim-1 may be a direct attenuator of T cell responses. Since IL-2 has been shown to up-regulate IL-2R{alpha} in human peripheral T cells and in murine T cell clones (31, 32), inhibition of its expression may be an indirect consequence of the inhibition of IL-2 production by eTim-1. On the other hand, it has been recently reported that CD28 co-stimulation can directly induce IL-2R{alpha} expression on virgin murine T cells by an IL-2-independent mechanism (33).

Similar to the potential inhibitory activity of the Tim-1-binding partner, CTLA-4 and BTLA inhibit TCR-induced T cell proliferation and IL-2 production (34–37). In addition, similar to CTLA-4 signaling (38, 39), plate-bound eTim-1 arrested cell cycle progression by inhibiting the production of components of the cell cycle machinery necessary for progression through the G0/G1 checkpoint including cyclin D3, cyclin-dependent kinase (cdk) 4 and cdk 6 and inhibition of p27 degradation when the T cells were stimulated with CD3 + CD28 mAb.

Structurally, Tim family members consist of an Ig V domain and a mucin domain rich in threonine, serine and proline and heavily glycosylated. Both of the domains may play an important role in the function of the protein. The mucin domain of Tim-1 is predicted to have an extended conformation and contains up to 56 and 3 O- and N-linked glycosylation sites, respectively (8). Mucins have been previously implicated in immune suppression. Affinity-purified MUC1 from cancer patients was reported to have immunosuppressive effects on T cell proliferative responses (40). Moreover, it has been shown that activated T cells (41) express MUC1, and MUC1-null mice were reported to have developmental defects in certain T cell populations (42). In addition, over-expression of rat MUC4 inhibited killing by lymphokine-activated T cells (43). High concentrations of circulating mucins found in most patients with advanced adenocarcinomas have the potential to affect inflammatory and immune responses (44). These data, along with our findings of the ability of eTim-1 to inhibit immune responses, point to a generalized mechanism of immune suppression that is frequently observed in mucin-over-expressing malignancies (45).

Mucins also have protective functions for the cell surface of epithelial cells (46). Tim-1 mRNA is expressed at low levels in normal kidney, but increases dramatically in the regenerating proximal tubule epithelial cells of post-ischemic kidney (15). These epithelial cells are known to repair and regenerate the damaged region of the nephron in post-ischemic kidney. Tim-1 could conceivably play an important defensive role in protection and restoration of the kidney morphological integrity by inhibiting T cells from mounting an immune response and by limiting inflammation in the luminal space of the kidney. Furthermore, a soluble form of Tim-1 can be detected in the urine of patients with ischemic acute renal failure (16) and renal cell carcinoma (26), as well as being shed by kidney cell lines (16, 24). The expression and release of Tim-1 by cancer cells may be a mechanism of immune evasion: tumor Tim-1 binding the activated T cell via the Tim-1-binding partner resulting in T cell down modulation.

A potential anti-inflammatory role for Tim-1 was also recently speculated when enhanced Tim-1 mRNA expression was shown in the clinical remission phase of the autoimmune disease, multiple sclerosis (21). It has previously been suggested that Tim-1 is differentially expressed by Th2, but not Th1 cells, in mice and humans (8, 9, 21). Our data demonstrate that recently activated non-polarized human T cells also express high levels of Tim-1.

To investigate Tim-1 function, Meyers et al. (22) produced a mouse Tim-1–Fc chimera (Tim-1Ig) and showed differential functional effects on certain Th1 cytokines versus Th2 cytokines following administration of protein in vivo of PLP (139–151)-immunized animals and subsequent in vitro re-stimulation. They found that at sub-optimal antigen concentrations in the re-stimulation, T cells from Tim-1Ig-treated animals were hyperproliferative. However, at higher antigen concentrations, Tim-1Ig treatment of the mice led to inhibition of T cell proliferation upon re-stimulation. They found similar inhibitory effects on production of IFN{gamma}, a Th1 cytokine. We found that eTim-1 proteins inhibited ear and joint swelling in two different Th1-dependent models. The data of Meyers et al. are consistent with ours in that they show an inhibitory effect on Th1 responses. Although our in vitro data is wholly consistent with Tim-4 being the Tim-1-binding partner, it is conceivable that human Tim-1 could have different activities and/or binding partners due to variation in the mucin domain between species. In line with this notion, Umetsu et al. (47) suggest that the difference in the length of the mucin domain in BALB/c compared with HBA mice may affect Tim-1 function. Human Tim-1 has a considerably longer mucin tail than that of rodent species (9), therefore providing a potential opportunity for binding with different affinity and/or specificity.

In summary, eTim-1 has a profound effect on the inhibition of T cell responses by binding to a molecule up-regulated upon T cell activation. Engagement of early-primed T cells by Tim-1 may constitute a checkpoint in negative control of T cell activation. Together with an inducible expression pattern, Tim-1 may be involved in attenuation of inflammatory responses in peripheral tissues. This study further illustrates the relevance of the Tim-1 and Tim-1-binding partner interaction to the regulation of immunity and points to the possibility of developing the extracellular region of Tim-1 as an immunosuppressive therapeutic for T cell-mediated pathologies.


   Acknowledgements
 
We thank our colleagues at Abgenix, Inc., Fremont, CA, USA, and Mike Gallo (Abgenix Biopharma Inc., Burnaby, BC, Canada) for production of the fully human Tim-1 mAb; Christy Yu Sun and Nan-Xin Qian for construction of eTim-1 and eTim-1–Fc-expressing stable cell lines and Mike Jeffers and Bill LaRochelle for helpful comments.


   Abbreviations
 
AIA   antigen-induced arthritis
APC   antigen-presenting cell
eTim-1   extracellular domain of Tim-1
eTim-1–Fc   extracellular domain of Tim-1 fused to the Fc portion of human IgG1
mBSA   methylated BSA
RNase   ribonuclease
RT   reverse transcription
Tim   T cell, Ig domain and mucin domain

   Notes
 
* These authors contributed equally to this study. Back

Transmitting editor: P. Kincade

Received 14 September 2005, accepted 22 December 2005.


   References
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Lenschow, D. J., Walunas, T. L. and Bluestone, J. A. 1996. CD28/B7 system of T cell costimulation. Annu. Rev. Immunol. 14:233.[CrossRef][ISI][Medline]
  2. Watts, T. H. and DeBenedette, M. A. 1999. T cell co-stimulatory molecules other than CD28. Curr. Opin. Immunol. 11:286.[CrossRef][ISI][Medline]
  3. Murphy, K. M. and Reiner, S. L. 2002. The lineage decisions of helper T cells. Nat. Rev. Immunol. 2:933.[CrossRef][ISI][Medline]
  4. Sher, A. and Coffman, R. L. 1992. Regulation of immunity to parasites by T cells and T cell-derived cytokines. Annu. Rev. Immunol. 10:385.[CrossRef][ISI][Medline]
  5. Kamradt, T. and Mitchison, N. A. 2001. Tolerance and autoimmunity. N. Engl. J. Med. 344:655.[Free Full Text]
  6. Abbas, A. K., Murphy, K. M. and Sher, A. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[CrossRef][Medline]
  7. Wills-Karp, M., Belkaid, Y. and Karp, C. L. 2003. I-Tim-izing the pathways of counter-regulation. Nat. Immunol. 4:1050.[CrossRef][ISI][Medline]
  8. Kuchroo, V. K., Umetsu, D. T., DeKruyff, R. H. and Freeman, G. J. 2003. The TIM gene family: emerging roles in immunity and disease. Nat. Rev. Immunol. 3:454.[CrossRef][ISI][Medline]
  9. McIntire, J. J., Umetsu, S. E., Akbari, O. et al. 2001. Identification of Tapr (an airway hyperreactivity regulatory locus) and the linked Tim gene family. Nat. Immunol. 2:1109.[CrossRef][ISI][Medline]
  10. Shevach, E. M. 2002. CD4+ CD25+ suppressor T cells: more questions than answers. Nat. Rev. Immunol. 2:389.[ISI][Medline]
  11. Kumanogoh, A., Marukawa, S., Suzuki, K. et al. 2002. Class IV semaphorin Sema4A enhances T-cell activation and interacts with Tim-2. Nature 419:629.[CrossRef][Medline]
  12. Monney, L., Sabatos, C. A., Gaglia, J. L. et al. 2002. Th1-specific cell surface protein Tim-3 regulates macrophage activation and severity of an autoimmune disease. Nature 415:536.[CrossRef][Medline]
  13. Sanchez-Fueyo, A., Tian, J., Picarella, D. et al. 2003. Tim-3 inhibits T helper type 1-mediated auto- and alloimmune responses and promotes immunological tolerance. Nat. Immunol. 4:1093.[CrossRef][ISI][Medline]
  14. Kaplan, G., Totsuka, A., Thompson, P., Akatsuka, T., Moritsugu, Y. and Feinstone, S. M. 1996. Identification of a surface glycoprotein on African green monkey kidney cells as a receptor for hepatitis A virus. EMBO J. 15:4282.[ISI][Medline]
  15. Ichimura, T., Bonventre, J. V., Bailly, V. et al. 1998. Kidney injury molecule-1 (KIM-1), a putative epithelial cell adhesion molecule containing a novel immunoglobulin domain, is up-regulated in renal cells after injury. J. Biol. Chem. 273:4135.[Abstract/Free Full Text]
  16. Han, W. K., Bailly, V., Abichandani, R., Thadhani, R. and Bonventre, J. V. 2002. Kidney injury molecule-1 (KIM-1): a novel biomarker for human renal proximal tubule injury. Kidney Int. 62:237.[CrossRef][ISI][Medline]
  17. Matricardi, P. M., Rosmini, F., Ferrigno, L. et al. 1997. Cross sectional retrospective study of prevalence of atopy among Italian military students with antibodies against hepatitis A virus. BMJ 314:999.[Abstract/Free Full Text]
  18. Matricardi, P. M., Rosmini, F., Rapicetta, M., Gasbarrini, G. and Stroffolini, T. 1999. Atopy, hygiene, and anthroposophic lifestyle. San Marino Study Group. Lancet 354:430.[ISI][Medline]
  19. Matricardi, P. M., Rosmini, F., Riondino, S. et al. 2000. Exposure to foodborne and orofecal microbes versus airborne viruses in relation to atopy and allergic asthma: epidemiological study. BMJ 320:412.[Abstract/Free Full Text]
  20. McIntire, J. J., Umetsu, S. E., Macaubas, C. et al. 2003. Immunology: hepatitis A virus link to atopic disease. Nature 425:576.[CrossRef][Medline]
  21. Khademi, M., Illes, Z., Gielen, A. W. et al. 2004. T Cell Ig- and mucin-domain-containing molecule-3 (TIM-3) and TIM-1 molecules are differentially expressed on human Th1 and Th2 cells and in cerebrospinal fluid-derived mononuclear cells in multiple sclerosis. J. Immunol. 172:7169.[Abstract/Free Full Text]
  22. Meyers, J. H., Chakravarti, S., Schlesinger, D. et al. 2005. TIM-4 is the ligand for TIM-1, and the TIM-1-TIM-4 interaction regulates T cell proliferation. Nat. Immunol. 6:455.[CrossRef][ISI][Medline]
  23. Shakhov, A. N., Rybtsov, S., Tumanov, A. V. et al. 2004. SMUCKLER/TIM4 is a distinct member of TIM family expressed by stromal cells of secondary lymphoid tissues and associated with lymphotoxin signaling. Eur. J. Immunol. 34:494.[CrossRef][ISI][Medline]
  24. Bailly, V., Zhang, Z., Meier, W., Cate, R., Sanicola, M. and Bonventre, J. V. 2002. Shedding of kidney injury molecule-1, a putative adhesion protein involved in renal regeneration. J. Biol. Chem. 277:39739.[Abstract/Free Full Text]
  25. Vila, M. R., Kaplan, G. G., Feigelstock, D. et al. 2004. Hepatitis A virus receptor blocks cell differentiation and is overexpressed in clear cell renal cell carcinoma. Kidney Int. 65:1761.[CrossRef][ISI][Medline]
  26. Han, W. K., Alinani, A., Wu, C. L. et al. 2005. Human kidney injury molecule-1 is a tissue and urinary tumor marker of renal cell carcinoma. J. Am. Soc. Nephrol. 16:1126.[Abstract/Free Full Text]
  27. Yang, X. D., Corvalan, J. R., Wang, P., Roy, C. M. and Davis, C. G. 1999. Fully human anti-interleukin-8 monoclonal antibodies: potential therapeutics for the treatment of inflammatory disease states. J. Leukoc. Biol. 66:401.[Abstract]
  28. Gunther, E. C., Stone, D. J., Gerwien, R. W., Bento, P. and Heyes, M. P. 2003. Prediction of clinical drug efficacy by classification of drug-induced genomic expression profiles in vitro. Proc. Natl Acad. Sci. USA 100:9608.[Abstract/Free Full Text]
  29. Firpo, E. J., Koff, A., Solomon, M. J. and Roberts, J. M. 1994. Inactivation of a Cdk2 inhibitor during interleukin 2-induced proliferation of human T lymphocytes. Mol. Cell. Biol. 14:4889.[Abstract/Free Full Text]
  30. Nourse, J., Firpo, E., Flanagan, W. M. et al. 1994. Interleukin-2-mediated elimination of the p27Kip1 cyclin-dependent kinase inhibitor prevented by rapamycin. Nature 372:570.[CrossRef][Medline]
  31. Smith, K. A. and Cantrell, D. A. 1985. Interleukin 2 regulates its own receptors. Proc. Natl Acad. Sci. USA 82:864.[Abstract/Free Full Text]
  32. Cerdan, C., Martin, Y., Courcoul, M. et al. 1992. Prolonged IL-2 receptor alpha/CD25 expression after T cell activation via the adhesion molecules CD2 and CD28. Demonstration of combined transcriptional and post-transcriptional regulation. J. Immunol. 149:2255.[Abstract]
  33. Toyooka, K., Maruo, S., Iwahori, T. et al. 1996. CD28 co-stimulatory signals induce IL-2 receptor expression on antigen-stimulated virgin T cells by an IL-2-independent mechanism. Int. Immunol. 8:159.[Abstract/Free Full Text]
  34. Salomon, B. and Bluestone, J. A. 2001. Complexities of CD28/B7: CTLA-4 costimulatory pathways in autoimmunity and transplantation. Annu. Rev. Immunol. 19:225.[CrossRef][ISI][Medline]
  35. Watanabe, N., Gavrieli, M., Sedy, J. R. et al. 2003. BTLA is a lymphocyte inhibitory receptor with similarities to CTLA-4 and PD-1. Nat. Immunol. 4:670.[CrossRef][ISI][Medline]
  36. Prasad, D. V., Richards, S., Mai, X. M. and Dong, C. 2003. B7S1, a novel B7 family member that negatively regulates T cell activation. Immunity 18:863.[CrossRef][ISI][Medline]
  37. Sica, G. L., Choi, I. H., Zhu, G. et al. 2003. B7-H4, a molecule of the B7 family, negatively regulates T cell immunity. Immunity 18:849.[CrossRef][ISI][Medline]
  38. Krummel, M. F. and Allison, J. P. 1996. CTLA-4 engagement inhibits IL-2 accumulation and cell cycle progression upon activation of resting T cells. J. Exp. Med. 183:2533.[Abstract/Free Full Text]
  39. Brunner, M. C., Chambers, C. A., Chan, F. K., Hanke, J., Winoto, A. and Allison, J. P. 1999. CTLA-4-mediated inhibition of early events of T cell proliferation. J. Immunol. 162:5813.[Abstract/Free Full Text]
  40. Agrawal, B., Krantz, M. J., Reddish, M. A. and Longenecker, B. M. 1998. Cancer-associated MUC1 mucin inhibits human T-cell proliferation, which is reversible by IL-2. Nat. Med. 4:43.[CrossRef][ISI][Medline]
  41. Agrawal, B., Krantz, M. J., Parker, J. and Longenecker, B. M. 1998. Expression of MUC1 mucin on activated human T cells: implications for a role of MUC1 in normal immune regulation. Cancer Res. 58:4079.[Abstract/Free Full Text]
  42. Agrawal, B., Gendler, S. J. and Longenecker, B. M. 1998. The biological role of mucins in cellular interactions and immune regulation: prospects for cancer immunotherapy. Mol. Med. Today 4:397.[CrossRef][ISI][Medline]
  43. Komatsu, M., Yee, L. and Carraway, K. L. 1999. Overexpression of sialomucin complex, a rat homologue of MUC4, inhibits tumor killing by lymphokine-activated killer cells. Cancer Res. 59:2229.[Abstract/Free Full Text]
  44. Chan, A. K., Lockhart, D. C., von Bernstorff, W. et al. 1999. Soluble MUC1 secreted by human epithelial cancer cells mediates immune suppression by blocking T-cell activation. Int. J. Cancer 82:721.[CrossRef][ISI][Medline]
  45. Hollingsworth, M. A. and Swanson, B. J. 2004. Mucins in cancer: protection and control of the cell surface. Nat. Rev. Cancer 4:45.[CrossRef][ISI][Medline]
  46. Van Klinken, B. J., Dekker, J., Buller, H. A. and Einerhand, A. W. 1995. Mucin gene structure and expression: protection vs. adhesion. Am. J. Physiol. 269:G613.[ISI][Medline]
  47. Umetsu, S. E., Lee, W. L., McIntire, J. J. et al. 2005. TIM-1 induces T cell activation and inhibits the development of peripheral tolerance. Nat. Immunol. 6:447.[CrossRef][ISI][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Immunol.Home page
A. J. de Souza, J. S. Oak, R. Jordanhazy, R. H. DeKruyff, D. A. Fruman, and L. P. Kane
T Cell Ig and Mucin Domain-1-Mediated T Cell Activation Requires Recruitment and Activation of Phosphoinositide 3-Kinase
J. Immunol., May 15, 2008; 180(10): 6518 - 6526.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
M. Mizui, T.