Skip Navigation


International Immunology Advance Access originally published online on October 31, 2006
International Immunology 2006 18(12):1759-1769; doi:10.1093/intimm/dxl110
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/12/1759    most recent
dxl110v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Petkova, S. B.
Right arrow Articles by Roopenian, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petkova, S. B.
Right arrow Articles by Roopenian, D. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


Published by Oxford University Press 2006.

Enhanced half-life of genetically engineered human IgG1 antibodies in a humanized FcRn mouse model: potential application in humorally mediated autoimmune disease

Stefka B. Petkova1, Shreeram Akilesh1,4, Thomas J. Sproule1, Gregory J. Christianson1, Hana Al Khabbaz1, Aaron C. Brown1, Leonard G. Presta2,5, Y. Gloria Meng3 and Derry C. Roopenian1

1 Jackson Laboratory, Bar Harbor, ME 04609, USA
2 Department of Antibody Engineering, Genentech Inc., South San Francisco, CA, USA
3 Department of Assay and Automation Technology, Genentech Inc., South San Francisco, CA, USA
4 Present address: Department of Pathology, Washington University, St Louis, MO, USA
5 Present address: Schering-Plough Biopharma, Palo Alto, CA, USA

Correspondence to: D. C. Roopenian; E-mail: dcr{at}jax.org


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The MHC class I-like Fc receptor FcRn plays an essential role in extending the half-life (t1/2) of IgG antibodies and IgG-Fc-based therapeutics in the circulation. The goal of this study was to analyze the effect of human IgG1 (hIgG1) antibodies with enhanced in vitro binding to FcRn on their in vivo t1/2 in mice expressing human FcRn (hFcRn). Mutants of the humanized monoclonal Herceptin antibody (Hu4D5-IgG1), directed against human epidermal growth factor receptor 2 (p185 HER2), show altered pH-dependent binding to hFcRn in vitro. Two engineered IgG1 mutants (N434A and T307A/E380A/N434A) showed a considerably extended t1/2 in vivo compared with wild-type antibody in mice expressing an hFcRn transgene (Tg) but not in mice expressing the endogenous mouse FcRn. The efficiency of hFcRn-mediated protection was dependent on hFcRn Tg copy number. Moreover, when injected into FcRn-humanized mice at a concentration sufficient to partially saturate hFcRn, the engineered IgG1 mutants with an extended serum t1/2 were most effective in reducing the t1/2 of a tracer hIgG1 antibody. Finally, administration of mutant with high binding to hFcRn ameliorated arthritis induced by passive transfer with human pathogenic plasma. These results indicate that Fc regions modified for high binding affinity to hFcRn increases serum persistence of therapeutic antibodies, that the same approach can be exploited as an anti-autoimmune therapy to promote the clearance of endogenous pathogenic IgG and that FcRn-humanized mice are a promising surrogate for hIgG therapeutic development.

Keywords: antibody, FcRn transgenic mice, neonatal receptor FcRn, rheumatoid arthritis


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
IgG differs from other Ig classes in that it has the longest survival time in the circulation, with a half-life (t1/2) ranging from 7 to 21 days in healthy humans (14). The Fc fragment has been implicated in the prolonged survival of IgG, due to the fact that Fc fragments have a t1/2 similar to intact IgG, and much longer survival than Fab fragments (5, 6). This prolongation is explained by the existence of an Fc receptor, which rescues IgG from normal lysosomal degradation (7, 8). The class I MHC family molecule FcRn, comprised of the FcRn heavy chain and the ß2-microglobulin light chain, is the Fc receptor responsible for IgG homeostasis (914). Functional studies with mutant murine IgG-Fc fragments demonstrated impaired binding to FcRn and abnormally short t1/2 (15, 16). Furthermore, mouse IgG (mIgG) is cleared significantly faster in mice deficient in either the FcRn light or heavy chains (11, 12, 17, 18). The steady-state location of FcRn is endosomal, where it binds Fc with high affinity in an acidic environment (19, 20). Endocytic vesicles containing extracellular fluids fuse with the FcRn-containing vesicles, and in that acidic environment, easily protonated residues in the Fc CH2-CH3 domain interact with acidic FcRn residues (9, 2124). IgG that binds FcRn is then recycled either apically or basolaterally to the plasma membrane, where upon exposure to a neutral pH it is released (20, 2529). However, the rescue pathway can be overburdened by excess concentrations of IgG, thus explaining IgGs concentration–fractional catabolism relationship (7, 30).

FcRn's maintenance of IgG homostasis has substantial implications. It is a primary reason why IgG is the most abundant serum Ig and the major serum Ig developed after immunization (11). Second, by enabling the maintenance of copious levels of pathogenic IgG, FcRn promotes the development of humoral autoimmunity (31, 32). Finally, FcRn-mediated homeostasis is responsible for the extended serum t1/2 of therapeutic IgG antibodies and IgG-Fc fusion proteins, which have emerged as a major treatment for a wide array of both neoplastic and autoimmune diseases (33).

Given the importance of therapeutic IgG and the fact that stabilization by FcRn is a key to their extended serum persistence, an attractive approach to improve therapeutic IgG's t1/2 would be to enhance the IgG–FcRn interaction. This improvement could conceivably reduce the dosage or frequency of therapeutic antibody administration without compromising their pharmacologic efficacy. Studies by the Ward laboratory were the first to show that specific mutations in the Fc portion of mIgG that binds mouse FcRn (mFcRn) can shorten or extend their serum t1/2 (15, 28, 34, 35). More recent studies have evaluated human IgG (hIgG) antibodies with their Fc region engineered for enhanced acid-dependent binding to human FcRn (hFcRn) (3639). However, it has been challenging to ascertain whether such antibodies show prolonged serum persistence in vivo. Recent studies with primates analyzing hIgG2 and hIgG1 mutants with increased affinity for hFcRn have shown promise, in that such mutants showed an increased serum t1/2 (36, 40). However, rodent models have not proven as informative for evaluating the hIgG stabilization because of evolutionary differences in rodent IgG and FcRn and hIgG and hFcRn (35, 41). Mice lacking endogenous FcRn and transgenic for hFcRn are a potentially promising surrogate for evaluating the pharmokinetics of hIgG therapeutics (11). Here we describe the use of a humanized FcRn mouse model to evaluate the pharmokinetic efficacy of human Hu4D5-IgG1 mutant antibodies engineered to have enhanced binding to hFcRn. Such mutants show an extension of their serum t1/2, increased ability to saturate the hFcRn protection pathway and increased ability to prevent autoimmune lesions caused by pathogenic hIgG.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Antibodies
The Hu4D5 wild-type (WT) IgG1 antibody was originally derived from the mouse mumAb4D5 antibody which was humanized using a gene conversion mutagenesis strategy (42). Hu4D5-IgG1 WT and the following Fc mutants were used in the study: Hu4D5 Fc8 (I253A), Hu4D5 FcB42 (N434A) and Hu4D5 Fc270 (T307A/E380A/N434A) (numbering according to the EU index) (43). Hu4D5-IgG1 mutants were produced by site-directed mutagenesis, substituting solvent-exposed amino acids in the Fc CH2 and CH3 domains with Ala as previously described by Shields et al. (37, 42). Single amino acid-substituted mutants I253A, N434A and the combination mutant T307A/E380A/N434A were purified from large-scale transient CHO cell cultures using Protein A column (Prosep-A) (Millipore, Billerica, MA, USA) followed by an SP sepharose ion exchange column (Amersham Biosciences, Piscataway, NJ, USA) for use in in vitro and in vivo experiments. The humanized IgG1 antibody [hybridoma clone HuLys11, anti-hen egg-white lysozyme (HEL), a kind gift from Jeffery Foote, Fred Hutchinson Cancer Center, Seattle, WA, USA] (44) or mIgG1 anti-dinitrophenyl (DNP) hybridoma clone 1B7.11 [American Type Culture Collection (ATCC), Rockville, MD, USA] were used as tracer antibodies in vivo. Purified human Ig (Gamma Guard®, Baxter Healthcare Corp., Deerfield, IL, USA) was used for in vivo studies as well. The above-mentioned antibodies were injected intraperitoneally (i.p.) at the appropriate concentration after dilution with 1x PBS to a total final volume of 500 µl per mouse. The anti-hFcRn mAb (DVN24), which cross-reacts with mFcRn, was produced from a hybridoma generated in FcRn–/– mice immunized with hFcRn (D. C. Roopenian, in preparation).

In vitro binding of Hu4D5 antibodies to FcRn
Mouse fibroblast L cells (ATCC, Manassas, VA, USA) were stably transfected with either hFcRn plasmid or mFcRn plasmid (hFL and mFL) to direct FcRn expression on the plasma membrane rather than cytoplasmic endosomes. For mFL, a truncated mFcRn cDNA product was generated from C57BL/6J (B6) RNA isolated from neonatal proximal small intestine (collected on day 10) after amplification of cDNA product using the following oligonucleotide primers—forward: CCCCCCCCCTCGAGGGTCAGAGACCCGCCCCCCA (CTCGAG XhoI site underlined) and reverse: CCCCCCCCGAATTCttaGCGCATCCTGCCCCACAA (GAATTC EcoRI site underlined, premature stop codon in lowercase). CCCCCCCCC nucleotides were added to the primers to improve restriction endonuclease cleavage of the PCR product. The 944-bp PCR product was digested with XhoI and EcoRI and was cloned into the corresponding sites of the peGFP-C1 vector backbone (BD Biosciences, Franklin Lakes, NJ, USA) into which we had already inserted a 118-bp 5' human signal FcRn sequence including those encoding the 23 amino acid hFcRn signal sequence 5' of eGFP. This cloning step eliminated the eGFP coding sequence and positioned mFcRn directly downstream of the FcRn signal peptide. All PCR-amplified inserts were sequence verified bi-directionally across the cloning sites. Purified hFcRn and mFcRn plasmids were transfected into L cells using Lipofectin Plus (Invitrogen, Carlsbad, CA, USA) following the manufacturer's protocol, and stable transfectants were selected using 400 µg ml–1 G418 (Sigma–Aldrich, St Louis, MO, USA) in FBS-supplemented DMEM. The constructs lack the FcRn cytoplasmic endosomal targeting domain, and thus, transfected cells express high levels of hFcRn on their plasma membrane. Plasma membrane expression of mFcRn and hFcRn was verified using the anti-FcRn mAb (DVN24).

IgG binding to FcRn was detected by flow cytometry and all procedures were performed at 4°C. hFcRn-transfected L cells (hFL), mFcRn-transfected L cells (mFL) or untransfected L cells were washed with FACS buffer (pH 6, or pH 7.4 PBS containing 1% BSA, 0.05% NaN3). Cell aliquots (1 x 106) were then incubated in triplicate with 1 µg of Hu4D5-IgG1 antibodies, or mouse monoclonal IgG1 (1B7.11) in 50 µl FACS buffer at pH 6.0 or 7.4 in the round-bottomed wells of a 96-well plate. After 60 min, the cells were washed with buffer (pH 6.0 or 7.4) and stained with either goat anti-human IgG conjugated to PE (Southern Biotechnology Associates, Inc., Birmingham, AL, USA) or goat anti-mouse IgG conjugated to Alexa Fluor 488 (Invitrogen Corp., Carlsbad, CA, USA). After 30 min, the cells were washed with buffer (pH 6.0 or 7.4) and stained with Alexa Fluor 647 (Invitrogen)-conjugated anti-hFcRn antibody, DVN24-AF647. After another incubation for 30 min, the cells were washed with buffer (pH 6.0 or 7.4), acquired by gating on the top 10% brightest DVN24-AF647 positive events on a FACSCalibur and data were analyzed using Cell Quest software (BD Biosciences, San Jose, CA, USA). Propidium iodide (1 µg ml–1) was used to exclude dead cells from the analysis. Results are presented as the mean ± SD of three replicates.

Mice
FcRn-deficient B6-FcgrtTm1Dcr mice were generated as described (11, 45). Mice deficient in mFcRn and carrying hFcRn transgene (Tg) (FcRn–/– hFcRn Tg) were generated by crossing mFcRn-deficient mice (FcRn–/–) with mice expressing hFcRn (hFcRn Tg). The genomic hFcRn transgenic line 32 [hFcRn (32) Tg], isogenic on a B6 background, was produced using a 33-kb cosmid including the complete hFcRn gene and ~10-kb 5' and 3' flanking sequences, as described (11). The cDNA transgenic line 276 [hFcRn (276) Tg] expressing the hFcRn {alpha}-chain cloned into vector E carrying a CMV enhancer and a chicken ß-actin promotor was produced as described (45). Expression of hFcRn in these FcRn–/– hFcRn Tg mice has been validated by reverse transcription (RT)–PCR, western blot and functional assays in vivo (45). Mice deficient in both murine receptors Fc{gamma}RIIB and FcRn but expressing hFcRn Tg [Fc{gamma}RIIB–/– FcRn–/– hFcRn (32) Tg mice] were produced by generating double-knockout FcRn–/– Fc{gamma}RIIB–/– mice and crossing them with FcRn–/– hFcRn Tg mice. B6-Fc{gamma}RIIB–/– mice were originally obtained from Taconic Farms (Germantown, NY, USA). Fc{gamma}RIIB–/– and FcRn–/– mice were crossed to produce mice doubly homozygous for the mFcRn and Fc{gamma}RIIB null alleles. B6-FcRn–/– Fc{gamma}RIIB–/– mice were identified by RT–PCR for FcRn null allele as described (11) and by flow-cytometric analysis of peripheral leukocytes for Fc{gamma}RIIB null allele as described (46). B6-Fc{gamma}RIIB–/– FcRn–/– hFcRn (32) Tg mice were then produced by crossing FcRn–/– Fc{gamma}RIIB–/– with FcRn–/– hFcRn (32) Tg mice, and then selected among the progeny for mice heterozygous for the hFcRn Tg. The following PCR primer set was used for detection of genomic hFcRn forward: AGCCAAGTCCTCCGTGCTC and reverse: CTCAGAGATGCCAGTGTTCC. The amplified genomic product was 740 bp in size as analyzed on a 1.5% agarose gel. Sex matched (8- to 16-weeks old) mice were used in the study. All experiments were performed in pathogen-free Jackson Laboratory research mouse colony, with protocols approved by The Jackson Laboratory Animal Care and Use Committee. The FcRn–/– hFcRn transgenic mice described here are available on request.

In vivo elimination of Hu4D5 antibodies
The elimination of Hu4D5-IgG1 antibodies in vivo was tested using two different transgenic lines: FcRn–/– hFcRn (276) Tg (cDNA transgenic line 276) and FcRn–/– hFcRn (32) Tg (genomic transgenic line 32). Mice caring one (hFcRn Tg) or two copies (hFcRn Tg/Tg) of the hFcRn Tg were included in the study. Both transgenic and control mice (FcRn–/– and FcRn+/+) were injected on day 0 with a single i.p. injection of 100 µg of one of the following hIgG1 antibodies: WT, I253A, N434A or T307A/E380A/N434A diluted to final volume of 500 µl in sterile 1x PBS. The group of hFcRn (32) Tg mice was also pre-treated with 2 mg purified hIgG per animal on day –1 followed by tracer injection with Hu4D5-IgG1 antibodies on day 0. Each human test antibody was co-injected with control mouse anti-DNP IgG1 at the same concentration (100 µg per mouse). Blood samples were obtained from the retro-orbital plexus using non-heparinized capillary pipettes 5 min before injection and several time points after the tracer injection. A Her2 antigen-based ELISA was used to monitor the serum concentrations of the Hu4D5 antibodies. Briefly, 96-well plates were coated with 5 µg ml–1 of Her2 (Genentech Inc., South San Francisco, CA, USA). The plates were blocked with 5% BSA in PBS, incubated with appropriately diluted serum samples (1:200), followed by mouse anti-human IgG-Fc-specific antibody (dilution 1:1000) conjugated to alkaline phosphatase (AP) (Southern Biotechnology Associates, Inc.). Activity was reported at 405 nm after development with colorimetric p-nitrophenyl phosphate (p-NPP) substrate at a concentration of 1 mg ml–1 (Sigma–Aldrich). To determine the serum concentration of the 1B7.11 mIgG1 tracer bovine gammaglobulin-DNP (Calbiochem, La Jolla, CA, USA) was coated onto wells of 96-well plates at concentration of 5 µg ml–1. Serum samples and varying concentrations of standard (mIgG1) were incubated on the plates and detected with goat anti-mouse IgG–AP antibody (Southern Biotechnology Associates, Inc.). The serum concentrations of hIgG1 antibodies or mIgG1 tracer antibodies were presented as percent remaining in the circulation at different time points after injection compared with day 1 values (100%), as described (11).

Competitive assay in vivo
To determine the ability of the Hu4D5 antibodies to promote the serum clearance of an hIgG1 or mIgG1 tracer, the serum clearance of hIgG1 or mIgG1 was analyzed in the presence of competitor Hu4D5 antibodies using FcRn–/– hFcRn (32) Tg mice. Animals (n = 3 per group) were injected i.p. with hIgG1 mAb (HuLys11, anti-HEL) and control mIgG1 antibodies (1B7.11, anti-DNP) at concentrations of 100 µg per mouse diluted with 1x PBS to a 500-µl final volume. The same mice were injected 48 and 72 h later with competitor Hu4D5 antibody (WT, I253A, N434A or T307A/E380A/N434A) at one of the following concentrations: 1, 2 or 5 mg per 20 g body weight (2 x 1 mg, 2 x 2 mg and 2 x 5 mg). FcRn Tg mice were bled serially before and after the injection of tracer and competitor antibody. Sera were collected and stored at –80°C until proceeding with the appropriate ELISA. To test the serum concentration of hIgG1 tracer (anti-HEL, HuLys11 antibody), plates were coated overnight at 4°C with 5 µg ml–1 of HEL (Sigma–Aldrich), washed four times with PBS, blocked with 5% BSA for 1 h at 37°C and incubated with serum samples at appropriate dilution. Mouse anti-human IgG (Fc specific) AP-conjugated antibody was used for detection at dilution 1:1000 in 1x PBS containing 1% BSA. After 1 h incubation at 37°C, plates were washed and incubated with the substrate p-NPP (Sigma–Aldrich). The serum concentrations of hIgG1 or mIgG1 tracer antibodies were calculated based on serial dilutions of appropriate standards and are presented as percent remaining in the circulation at different time points.

Testing the efficacy of Hu4D5-IgG1 antibodies in inducible model of arthritis
In order to induce arthritis, Fc{gamma}RIIB–/– FcRn–/– hFcRn (32) Tg mice were injected i.p. with plasma from a patient with active rheumatoid arthritis (RA). Clinical characteristics of the patient were included in Petkova et al. (47). A total of 2.5 ml of human plasma per mouse was administered as follows: 0.5 ml on day 0, 1 ml day 2 and 1 ml on day 7. Ankles were inspected for inflammation and erythema by two observers. Joint swelling was assessed by measuring the lateral diameter of the knee with a high-precision caliper with 0.02-mm resolution (Chicago Brand Industrial, Fremont, CA, USA). In addition, arthritis was scored by examination of both rear legs as follows: 0, unaffected; 1, questionable; 2, swelling of one rear leg and 3, severe swelling of both rear legs as previously described (31). To test the therapeutic efficacy of the Hu4D5 antibodies, the same mice were treated three (days 1, 3 and 8) or five times (days 1, 3, 8, 10 and 14) with either IgG1 WT or selected Fc mutant antibodies following the injections with human plasma (days 0, 2 and 7). The therapeutic antibodies were administrated i.p. at a concentration 2.5 mg per 20 g body weight diluted with 1x PBS up to a final volume of 500 µl.

Statistical analysis
The t1/2 of the elimination ß-phase for each test antibody was determined using a one-phase exponential decay model provided by JMP statistical software (SAS Institute, Boston, MA, USA), including data points between day 3 or 4 and day 12 or 16 post-injection. The model was fit for each individual mouse per experimental group. Once the t1/2 was calculated for each mouse, a t-test was used to test for differences in the average t1/2 for each group. Results are presented as mean t1/2 (days) ± SD and a P value ≤0.05 was considered significant. Analysis of repeated measures was adopted for ankle measurements. Triplicate measurements for each rear ankle were averaged to produce an average ankle width for each mouse. Results were averaged for both legs of each animal and, subsequently, for each group of animals. Variation was always ≤0.1 mm. Delta ankle thickness (millimeter) was calculated as mean difference between day 0 and each time point of the experiment and the P value was calculated using the Student's t-test. A P value ≤0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In vitro binding of Hu4D5-IgG1 antibodies to hFcRn and mFcRn
A previous study used ELISA techniques to examine the acid-dependent binding of the humanized monoclonal Herceptin antibody, Hu4D5-IgG1 WT and mutant antibodies with amino acid substitutions in the CH2 and CH3 domains of the Fc region to hFcRn (37). The I253A mutant antibody exhibited substantially reduced binding. In contrast, the N434A mutant antibody showed 3.4-fold enhanced binding and the triply substituted mutant T307A/E380A/N434A exhibited 11.8-fold enhanced binding to hFcRn (37). To determine whether these affinity differences resulted in alterations in a more physiological setting, a cell-binding assay was developed. Murine fibroblast cells (L cells) expressing a truncated form of hFcRn (hFL cells) or mFcRn (mFL cells) were produced as described in Methods. The FcRn transfection constructs were engineered to lack the cytoplasmic endosomal targeting domain, causing the FcRn protein to localize to the plasma membrane rather than in the endosomes. As FcRn binds the Fc fragment of IgG at a slightly acidic but not at a neutral pH, flow cytometry-based binding assays were carried out at both pH 6.0 and 7.4 (Fig. 1). Significant binding of WT, N434A and T307A/E380A/N434A antibodies to hFL cells was observed at pH 6.0 with N434A and T307A/E310A/N434A mutants, respectively, exhibiting 1.6-fold (P = 0.007) and 3.3-fold (P = 0.0001) enhanced binding relative to the WT antibody (Fig. 1A). The Hu4D5 antibodies therefore bound to hFcRn expressed on the plasma membrane in a pattern consistent with that observed previously to soluble hFcRn (37). Binding of the WT and N434A antibodies was abolished at pH 7.4, with the exception that T307A/E380A/N434A demonstrated 2.4-fold increased binding to hFcRn as compared with WT antibody (P = 0.0002). Moreover, mIgG1 failed to appreciably bind hFcRn, a finding consistent with previous studies indicating that hFcRn does not stabilize mIgG (35, 45).


Figure 1
View larger version (26K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Flow-cytometric analysis of Hu4D5-IgG1 antibodies binding to L cells expressing the ectodomain of hFcRn or mFcRn at pH 6.0 and 7.4. (A) Binding of Hu4D5 antibodies and mIgG1 antibody to L cells expressing hFcRn (hFL), (B) L cells expressing mFcRn (mFL) and (B) untransfected L cells. Mean ± SD of three replicate determinations is indicated. MFI denotes mean fluorescence intensity.

 
Binding to mFcRn yielded a very different pattern for the functional Hu4D5 antibodies (WT, N434A and T307A/E380A/N434A) (Fig. 1B). These antibodies bound mFcRn at similarly high levels at pH 6.0 and there was no significant difference (P > 0.05) in mean fluorescence intensity values between the WT and high-affinity mutant antibodies (908 ± 28.4 for N434A, 1082 ± 136.5 for T307A/E380A/N434A and 989 ± 41.9 for WT antibody). In contrast, and as expected, substitution of the critical amino acid Ile at position 253 to Ala in the I253A mutant resulted in the abolishment of binding to mFcRn at both pH 6.0 and 7.4. Minimal binding of the WT and mutant Hu4D5 antibodies to both hFcRn and mFcRn was observed at pH 7.4, thus confirming the acidic requirement for FcRn binding. However, as indicated in Fig. 3(B), T307A/E380A/N434A was exceptional in that it retained substantial binding to mFcRn at pH 7.4 (54-fold increase as compared with WT antibody; P < 0.0001). This pattern was observed in three independent experiments (data not shown). There was minimal binding of human Hu4D5 antibodies to control L cells at both pHs (Fig. 1C).


Figure 3
View larger version (7K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Concentration-dependent elimination of hIgG1 in FcRn–/– hFcRn (32) Tg mice after administration of Hu4D5-IgG1 antibodies. Test antibody (hIgG1, anti-HEL HuLys11 antibody) was injected i.p. at a dose of 100 µg per mouse on day 0 (black arrow) followed by two injections with competitor Hu4D5 antibodies on days 2 and 3 (white arrows). Serum was collected and the amount of anti-HEL activity was determined. The following concentrations of competitor antibodies were used: (A) 2 x 1 mg per 20 g body weight, (B) 2 x 2 mg per 20 g body weight and (C) 2 x 5 mg per 20 g body weight. Five mice per group were used in this experiment.

 
In vivo persistence of Hu4D5 antibodies
We then examined whether the binding characteristics of the Hu4D5 antibodies observed in vitro could result in differences in the serum persistence in vivo. The Hu4D5 antibodies were first analyzed in mice lacking mFcRn and expressing one copy of the cDNA hFcRn transgene [mFcRn–/– hFcRn (276) Tg]. The elimination curves of the three Hu4D5-IgG1 mutant antibodies were clearly distinct from that of the WT (Fig. 2A). As predicted by its failure to bind hFcRn in vitro, substitution of Ile at position 253 to Ala in the I253A mutant lead to enhanced clearance of this antibody compared with WT (t1/2 = 1.02 ± 0.13 days versus 1.72 ± 0.07 days, P ≤ 0.01) and was virtually undetectable on day 3 after post-injection. In contrast, mutants N434A and T307A/E380A/N434A demonstrated a substantial increase in serum persistence as compared with WT (Fig. 2A), with N434A and T307A/E380A/N434A showing a significant 2.2- to 2.5-fold increase of their t1/2 (t1/2 = 3.85 ± 0.55 days, P = 0.03 and 4.35 ± 0.53 days, P = 0.02), respectively, compared with the WT antibody (1.72 ± 0.07 days) (Table 1A).


Figure 2
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Elimination of Hu4D5-IgG1 antibodies in vivo. One hundred micrograms of each Hu4D5 antibody along with 100 µg of control mIgG1 antibody was injected i.p. on day 0 into mFcRn–/– hFcRn Tg, mFcRn+/+ and mFcRn–/– mice. The serum levels of the antibodies are presented as percent remaining in the circulation compared with day 1 (100%). Results were averaged for each test antibody and plotted as clearance curves ± SD. (A) mFcRn–/– hFcRn (276) Tg mice (n = 3 for each group). This experiment was performed three times with similar results. (B) mFcRn–/– hFcRn (276) Tg/Tg mice (n = 4). (C) mFcRn–/– hFcRn (32) Tg mice (n = 3); in this experiment, mice were pre-treated with 2 mg per 20 g body weight of hIgG one day before the injection of Hu4D5-IgG1 antibodies to partially saturate hFcRn. This experiment was performed second time using 2.5 mg per 20 g of hIgG pre-treatment and similar results were obtained (data not shown). (D) mFcRn–/– mice (n = 3). Results obtained from in vivo elimination of control mIgG1 antibody were presented as t1/2 (see Table 1B).

 

View this table:
[in this window]
[in a new window]

 
Table 1 Half-lives of Hu4D5-IgG1 and mIgG1 antibodies in vivo

 
The same trend was observed after injection of Hu4D5-IgG1 antibodies into cDNA Tg line 276 expressing two copies of the transgene [mFcRn–/– hFcRn (276) Tg/Tg] (Fig. 2B). In this case, the t1/2 of the WT, N434A and T307A/E380A/N434A antibodies was also extended (5.79 ± 0.34 days, 9.6 ± 0.5 days and 8.78 ± 1.55 days, respectively) compared with those tested in mFcRn–/– hFcRn (276) Tg mice (1.72 ± 0.07 days, 3.85 ± 0.55 days and 4.35 ± 0.53 days, respectively) (Table 1A). This extension caused by hFcRn Tg homozygosity indicates that the amount of hFcRn available for protection of the administered antibodies contributes to the degree of protection from clearance in vivo.

We also evaluated the serum persistence of the Hu4D5 antibodies in mice carrying one copy of the genomic hFcRn Tg [mFcRn–/– hFcRn (32) Tg]. This mouse stock (line 32) was considerably more efficient in extending the serum t1/2 of hIgG compared with cDNA transgenic mice (line 276) (data not shown). Therefore, we failed to detect a significant difference in the normally long t1/2 of the Hu4D5 WT and high-affinity mutant antibodies in mFcRn–/– hFcRn (32) Tg mice (data not shown). We attributed this failure to distinguish among the Hu4D5 antibodies to the overall high efficiency by which this genomic transgene protects hIgG from clearance, masking differences in hFcRn-binding affinity during the period of measurement. To increase the sensitivity of detecting differences in serum t1/2, we argued that it might be possible to attenuate this high protection phenotype by partially saturating hFcRn's protective function. mFcRn–/– hFcRn (32) Tg animals were treated with hIgG1 (2 mg per 20 g body weight) one day before the injection with test Hu4D5-IgG1 antibodies (Fig. 2C). Mice were then bled and the clearance of the test Hu4D5-IgG1 antibodies was determined. The elimination curves of the WT and high-affinity mutants were clearly distinct from that of the I253A mutant. Moreover, WT IgG1 antibody, single (N343A) and combination (T307A/E380A/N434A) mutants demonstrated an increase in serum persistence when tested in the mFcRn–/– hFcRn (32) Tg (t1/2 = 6.48 ± 0.95 days, t1/2 = 10.66 ± 1.1 days and t1/2 = 9.7 ± 1.8 days) as compared with FcRn–/– hFcRn (276) Tg mice, more similar to that observed with the FcRn–/– hFcRn (276) Tg/Tg mice (Table 1A). These overall results indicated that the high-affinity mutants showed a significant increase in the serum t1/2 compared with hIgG1 WT antibody, and that the level of hFcRn expressed had a substantial effect in the overall t1/2 of these antibodies.

Since the Hu4D5 antibodies bind mFcRn (Fig. 1B) we analyzed their clearance in mFcRn+/+ mice (Table 1A). There was no statistical difference (P > 0.1) between the t1/2 of IgG1 WT, N434A and T307A/E380A/N434A antibodies (10.15 ± 0.49 days, 8.03 ± 1.88 days and 8.42 ± 1.8 days, respectively). Once again, I253A had the shortest t1/2 (1.56 ± 0.29 days). These results indicate that the high level of binding of the WT, N434A and T307A/E380A/N434A antibodies to mFcRn in vitro results in the failure to realize differences in serum persistence in vivo. Finally, the persistence of the Hu4D5 antibodies was tested in mFcRn–/– mice. As expected, the pharmacokinetic profiles of all antibodies in FcRn–/– mice were similarly short, from 1.04 to 1.21 days (Fig. 2D and Table 1A). These results indicate that the extension in serum persistence of all the Hu4D5 antibodies is entirely dependent on FcRn.

Finally, we examined the tracer t1/2 of mIgG1 tracer in each mouse group analyzed above. In every case, the t1/2 of mIgG1 in mFcRn–/– hFcRn Tg mice was greatly abbreviated compared with mice possessing a normal mFcRn allele, and as short as that found for mFcRn–/– mice (Table 1B). These results confirm that hFcRn does not extend the t1/2 of mIgG (35, 45).

Concentration-dependent elimination of hIgG1 or mIgG1 in the presence of Hu4D5-IgG1 antibodies
Since FcRn protection pathway is progressively saturated by increasing concentrations of IgG, we wanted to determine whether the high-affinity mutant Hu4D5 antibodies were more effective than the WT antibody in promoting the elimination of tracer IgG1 in vivo. hIgG1 antibody (HuLys11) was injected i.p. into mFcRn–/– hFcRn (32) Tg mice on day 0, followed by injections of competitor WT and mutant antibodies on days 2 and 3. Three doses (1, 2 and 5 mg) of Hu4D5-IgG1 antibodies were administered. Two injections with 1 mg of Hu4D5-IgG1 antibodies (2 x 1 mg) reduced the t1/2 of tracer hIgG1 antibody in the absence of any Hu4D5 antibodies, from t1/2 = 9.21 ± 1.31 days (data not shown) to t1/2 = 5.25 ± 0.53 days for the WT-treated group of mice, t1/2 = 5.17 ± 0.5 days for the N434A-treated group and t1/2 = 4.98 ± 0.52 days for the T307A/E380A/N434A-treated group (Fig. 3A–C, summarized in Table 2A). However, at this dosage, a significant difference in the t1/2 of hIgG1 tracer in the presence of either WT or high-affinity mutants N434A and T307A/E380A/N434A was not achieved (P > 0.1). Administration of 2 x 2 mg of the high-affinity Hu4D5-IgG1 mutant antibodies resulted in a significant decrease (P < 0.05) in the elimination of the tracer antibody in the presence of high-affinity mutants (t1/2 = 3.37 ± 0.81 days and 3.26 ± 0.19 days) compared with WT competitor antibody (t1/2 = 5.44 ± 0.64 days). However, on administration of 5 mg of Hu4D5-IgG1 antibodies (2 x 5 mg), discrimination of the WT, N434A and T307A/E380A/N434A antibodies was lost (t1/2 = 2.94 ± 0.5 days, 2.56 ± 0.71 days and 2.33 ± 0.5 days, respectively). Finally, as expected, because hFcRn does not efficiently engage mIgG (Fig. 1A) and (35, 45), the serum persistence of control tracer mIgG1 in the presence human Hu4D5-IgG1 antibodies did not appreciably deviate from its expected rapid elimination in mice not treated with Hu4D5-IgG1 antibodies (t1/2 = 1.64 ± 0.29 days) (Table 2B). These results indicate that mutant Hu4D5 antibodies that more efficiently bind hFcRn can be more effective than the WT in decreasing the t1/2 of hIgG1, but only in the dosage (2 x 2 mg) at which hFcRn's IgG protection capability is partially compromised.


View this table:
[in this window]
[in a new window]

 
Table 2 Half-lives of hIgG1 and mIgG1 tracers in presence of Hu4D5-IgG1 antibodies

 
Amelioration of experimental arthritis by Hu4D5-IgG1 antibodies
Previous experiments have shown that high doses of IgG (20 mg per 20 g body weight) saturate the mFcRn protection pathway resulting in amelioration of the pathogenic activity of mIgG auto-antibodies (31).

It is therefore possible that IgG antibodies with their Fc moiety engineered for high binding to hFcRn could have enhanced therapeutic potential by promoting even more efficient clearance of pathogenic IgG auto-antibodies. To test this possibility, we used a serum transfer model of experimental arthritis. Mice deficient in the inhibitory Fc receptor, Fc{gamma}RIIB, fail to down-regulate pro-inflammatory Fc receptor signals and are thus hypersensitive to humoral stimuli (46). We have found that plasma or purified IgG from patients with active RA causes inflammatory joint lesions when transferred into Fc{gamma}RIIB–/– mice (47). We generated mice doubly deficient in mFc{gamma}RIIB and mFcRn that express the hFcRn transgene [mFc{gamma}RIIB–/– mFcRn–/– hFcRn (32) Tg mice]. Several groups of mice were injected on days 0, 2 and 7 with human plasma collected from a patient with active RA in conjunction with Hu4D5-IgG1 antibodies (days 1, 3 and 8) (Fig. 4A and B) or days 1, 3, 8, 10 and 15 (Fig. 4C and D). The mice were then monitored for the ankle inflammation and swelling. Mice receiving plasma from the RA patient and treated with 3 x 2.5 mg of WT, N434A and T307A/E380A/N434A antibodies, all developed transient arthritis starting on day 7–8, and resolved the inflammation by day 20 (Fig. 4A). A minor reduction in delta ankle thickness between the groups of animals treated with WT antibody or the mutant N434A and T307A/E380A/N434A antibodies was observed, but only T307A/E380A/N434A mutant showed a significant reduction in ankle swelling on day 11 (P = 0.05) when compared with those treated with the WT antibody. Differences between the WT-treated mice compared with mutant antibodies-treated mice became more pronounced when analyzed using an overall arthritis score, which takes into consideration overall inflammation, in that there was a clear bifurcation on days 11 and 15 (Fig. 4B). We also tested the development of arthritis in a second group of mFc{gamma}RIIB–/– mFcRn–/– hFcRn Tg mice, which were given two additional doses of Hu4D5 antibodies (Fig. 4C and D). Mice received pathogenic RA plasma and were treated with IgG1 WT, T307A/E380A/N434A and I253A antibodies (5 x 2.5 mg per 20 g body weight). In contrast to mice treated with the WT or I253A antibodies, mice injected with T307A/E380A/N434A mutant antibody failed to develop appreciable ankle swelling (P < 0.05) or inflammation. These results indicated that engineered mutant T307A/E380A/N434A antibody was most effective in vivo in ameliorating the inflammatory arthritic lesions in this humanized FcRn mouse model.


Figure 4
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Amelioration of arthritis induced by transfer of human RA plasma in Fc{gamma}RIIB–/–mFcRn–/– hFcRn (32) Tg mice after treatment with Hu4D5-IgG1 antibodies. (A and B) Mice were injected i.p. with human plasma from an RA patient as follows: 0.5 ml on day 0, 1 ml on day 2 and 1 ml on day 7 (black arrows) and treated on days 1, 3 and 8 (open arrows) with WT, N434A or T307A/E380A/N434A antibodies at a concentration 2.5 mg per mouse per injection. Results represent mean delta ankle thickness and arthritis score ± SD. (C and D) Groups of mice (n = 3) were injected with pathogenic serum (black arrows) and treated on days 1, 3, 8, 10 and 14 (open arrows) with the same concentration of WT, T307A/E380A/N434A or I253A mutant antibodies. Results represent mean delta ankle thickness and arthritis score ± SD.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
It is well established that FcRn is required in mammals for the greatly extended serum persistence of IgG antibodies. It does so by rescuing IgG from the normal catabolic fate to which other extracellular proteins are destined. This extension in half-life is a main reason why IgG-based therapeutics and other Fc-conjugated proteins are highly effective in the treatment of multiple diseases. Antibodies engineered to have a high affinity for FcRn may allow for a reduction in the dosage and/or frequency of their administration.

Mutagenesis studies have identified the critical role played by I253, S254, H435 and Y426 amino acids in mediating acid-dependent binding of hIgG1-Fc to hFcRn, based on the fact that replacement of these amino acids with Ala substantially reduced binding (38, 48). In contrast, substitutions at positions 380 and 434, located in the Fc portion of hIgG1 to alanine (E380A and N434A), resulted in improved binding to hFcRn, 2.2- and 3.5-fold, respectively, without affecting binding to Fc{gamma}Rs (37). Further improvement was documented when combination variants (K288A/N434A, E380A/N434A and T307A/E380A/N434A) showed a 2.9-, 8- and 11.8-fold increase, respectively, in binding activity to hFcRn at pH 6.0. We analyzed the effects of Hu4D5-IgG1 antibodies carrying the N434A and T307A/E380A/N434A substitutions on acid-dependent binding to hFcRn using a cell-based binding assay. A similar, but compressed, binding pattern of the N434A and T307A/E380A/N434A mutants was observed with L cells expressing hFcRn on their plasma membrane.

Remarkably, all discrimination among the Hu4D5 WT, and the N434A and T307A/E380A/N434A mutants was lost in binding to mFL. Previous studies document a high inherent affinity of mFcRn for many species forms of IgG, including humans (35). This high affinity may negate any potential binding advantages gained by these selective amino acid modifications. Indeed, we failed to find a clear discrimination in serum persistence among the Hu4D5 variants in mFcRn+/+ mice. Moreover, the T307A/E380A/N434A mutant failed to demonstrate increased serum persistence as compared with WT IgG1 antibody when tested in BALB/c mice (49). These studies underscore the difficulties in extrapolating studies performed in conventional mouse models towards the development of improved hIgG-based therapeutics.

However, the question of greater interest was whether genetically engineering for high affinity interactions with hFcRn results in increased t1/2 in vivo. Studies using primates showed that IgG1-Fc residues at positions 250 and 428 improved binding of IgG1, IgG2 and IgG4 to hFcRn at pH 6.0, when mutated to Q and L (T250Q and M428L). Most importantly, mutagenized hIgG1 and hIgG2 antibodies displayed an extension in their t1/2 in primates (36, 40). Using mice deficient in mFcRn, but expressing hFcRn, we show that a ‘humanized’ mouse model can be used productively to discriminate the pharmacokinetics of hIgG antibodies in vivo. Our data indicate a considerable extension in the serum t1/2 for both the N434A and T307A/E380A/N434A mutants compared with the WT Hu4D5 antibody when tested in mFcRn–/– hFcRn (276) Tg mice. Similar results were obtained when antibodies were tested in a different Tg line [mFcRn–/– hFcRn (32) Tg], but only after pre-loading the mice with hIgG to partially saturate hFcRn.

Despite the demonstrated differences in binding to FcRn in vitro, the serum t1/2 of singly substituted N434A and the triply substituted T307A/E380A/N434A mutants were similar in vivo in mFcRn–/– hFcRn Tg mice. One possibility is that the triply substituted mutant was more immunogenic than the singly substituted mutant in that the former elicited a mouse anti-human response in vivo, thereby reducing its t1/2 to that comparable with the singly substituted mutant. We view this possibility as unlikely because the acquisition of mouse anti-human antibodies would result in biphasic clearance kinetics, which were not observed for any of the Hu4D5 antibodies we tested. Moreover, ELISAs of sera from the T307A/E380A/N434A mutant antibody-injected mice failed to reveal detectable anti-human activity (data not shown). A second possibility is that maximal increase in hFcRn-mediated protection has been achieved by the single N434A substitution with no further extension by the increased affinity gained in the triple mutant. In this context, the triply substituted mutant retained some ability to bind hFcRn at a neutral pH (Fig. 1A). Moreover, the same antibody also demonstrated considerable binding to mFcRn at this neutral pH (Fig. 1B). Retention by hFcRn at a neutral pH may counteract any benefits of the increased avidity that this antibody compared with the singly substituted N434A mutant on the t1/2 in the circulation. Such an argument would argue that there is an upper limit in the gains in serum persistence that can be realized by engineering therapeutic antibodies for high affinity binding to hFcRn.

Our studies also suggest a correlation between the levels of expression of hFcRn and the protection of hIgG. The efficiency of hIgG1 protection was clearly impacted by doubling the transgenic dosage of hFcRn from one copy to two copies of the line 276 cDNA transgene, with a concomitant extension in the t1/2 of the mutants, IgG1 N434A and IgG1 T307A/E380A/N434A over the IgG1 WT antibody. The highly efficient hFcRn genomic transgenic line 32 also resulted in a similar discrimination of the Hu4D5-IgG1 antibodies, but only after pre-loading the mice with hIgG. These results underscore the quantitative importance of FcRn in relation to the maintenance of serum IgG, and raise the interesting possibility that genetic or environmentally induced variation resulting in differences in FcRn expression could profoundly influence the serum persistence of IgG.

Based on studies of mice deficient in either the FcRn heavy or light chains, we have previously argued that the blockade of FcRn could be advantageous for the treatment of autoimmune disease with a humoral component (31, 32, 50, 51). Moreover, many of the anti-inflammatory therapeutic benefits of high-dose IgG treatment can be attributed to the saturation of FcRn, thereby incapacitating its function and promoting the clearance of pathogenic IgG antibodies (31, 52, 53). However, the considerable expense, inconvenience and side-effects of high-dose IgG administration have restricted its use. IgG molecules or Fc fragments modified for high binding affinity for hFcRn, thereby incapacitating FcRn's normal protective function, could be a promising alternative to high-dose IgG therapy in the treatment of humoral autoimmune disease. Indeed, recent studies using hIgG antibodies incorporating amino acid changes resulting in high FcRn binding efficiency demonstrate enhanced elimination of hIgG and the reduction of serum IgG in mice (39). However, as the studies were carried out in mice, a key remaining question is whether the enhanced elimination is also observed in the context of hFcRn and whether it leads to any therapeutic benefits. We found that Hu4D5 antibodies engineered for increased binding to hFcRn more efficiently promote the in vivo elimination of hIgG than the WT Hu4D5 antibody. However, this enhanced efficiency only gained statistical significance at a dosage range (2 x 2 mg), above which the discriminative effects were lost presumably because hFcRn was saturated. Nevertheless, the Hu4D5-IgG1 antibodies with the highest affinity binding was most effective compared in reducing inflammatory lesions caused by the administration of human RA patient plasma. As the Hu4D5 mutations were designed specifically to impact binding to hFcRn (37), this result is unlikely to be explained by engagement of pro-inflammatory Fc{gamma}Rs. This is a proof-of-principle that hFcRn blockade by engineered Fc-IgGs may be a valid approach in treating human autoimmune disease. However, further enhancements in hFcRn binding and efficiency in vivo would be required to justify this therapeutic approach.

Given the profusion of IgG therapeutics, models that facilitate their pre-clinical pharmacokinetic evaluation are needed. It is becoming clear that standard rodent models are sub-optimal for evaluating the pharmacokinetics of hIgG-based therapeutics because of inherent differences in the interaction sites and affinity of rodent FcRn and hFcRn for hIgG antibodies (35, 38, 41). Primates are an option, but are not suitable for routine use. The FcRn-humanized mouse model is a particularly attractive surrogate; however, the extent to which the pharmacokinetic patterns of the Hu4D5 antibodies patterns observed in this model mirror their behavior in humans remains to be determined. Finally, FcRn is also considered to be responsible for prenatal transport of IgG across the placenta (5456), and post-natal transepithelial IgG transport across the intestinal and the pulmonary epithelium (57, 58). Use of the FcRn-humanized model should indicate whether high affinity binding IgG antibodies are a more efficient means for transplacental or transepithelial delivery across these epithelial barriers.


    Acknowledgements
 
We thank Genentech Cell culture and Protein chemistry departments for preparation of Hu4D5 antibodies, David Serreze and Henry Lowman for critical review of the article and Jennifer Torrance for expert graphical assistance. This work was supported by grants from the Alliance for Lupus Research, NIH RO1 DK56597 (D.C.R.) and NIH NRSA F32 AR049695 (S.B.P.)


    Abbreviations
 
AF647, Alexa Fluor 647
AP, alkaline phosphatase
ATCC, American Type Culture Collection
B6, C57BL/6J
DNP, dinitrophenyl
HEL, hen egg-white lysozyme
hFcRn, human FcRn
hFL, hFcRn-transfected L cell
hIgG1, human IgG1
i.p., intraperitoneally
mFcRn, mouse FcRn
mFL, mFcRn-transfected L cell
mIgG, mouse IgG
p-NPP, p-nitrophenyl phosphate
RA, rheumatoid arthritis
RT, reverse transcription
t1/2, half-life
Tg, transgene
WT, wild type

    Notes
 
Transmitting editor: E. Simpson

Received 25 April 2006, accepted 20 September 2006.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Spiegelberg HL and Weigle WO. (1965) Studies on the catabolism of gamma-G subunits and chains. J. Immunol. 95:1034.[Abstract/Free Full Text]
  2. Spiegelberg HL and Fishkin BG. (1972) The catabolism of human G immunoglobulins of different heavy chain subclasses. 3. The catabolism of heavy chain disease proteins and of Fc fragments of myeloma proteins. Clin. Exp. Immunol. 10:599.[Web of Science][Medline]
  3. Spiegelberg HL. (1989) Biological role of different antibody classes. Int. Arch. Allergy Appl. Immunol. 90:(Suppl. 1), 22.
  4. Morell A, Terry WD, Waldmann TA. (1970) Metabolic properties of IgG subclasses in man. J. Clin. Invest. 49:673.[Web of Science][Medline]
  5. Spiegelberg HL and Grey HM. (1968) Catabolism of human gamma-G immunoglobulins of different heavy chain subclasses. II. Catabolism of gamma-G myeloma proteins in heterologous species. J. Immunol. 101:711.[Abstract/Free Full Text]
  6. Fahey JL and Robinson AG. (1963) Factors controlling serum gamma-globulin concentration. J. Exp. Med. 118:845.[Abstract]
  7. Brambell FW, Hemmings WA, Morris IG. (1964) A theoretical model of gamma-globulin catabolism. Nature 203:1352.[CrossRef][Medline]
  8. Brambell FW. (1966) The transmission of immunity from mother to young and the catabolism of immunoglobulins. Lancet 2:1087.[Web of Science][Medline]
  9. Raghavan M and Bjorkman PJ. (1996) Fc receptors and their interactions with immunoglobulins. Annu. Rev. Cell Dev. Biol. 12:181.[CrossRef][Web of Science][Medline]
  10. Simister NE and Mostov KE. (1989) An Fc receptor structurally related to MHC class I antigens. Nature 337:184.[CrossRef][Medline]
  11. Roopenian DC, Christianson GJ, Sproule TJ, et al. (2003) The MHC class I-like IgG receptor controls perinatal IgG transport, IgG homeostasis, and fate of IgG-Fc-coupled drugs. J. Immunol. 170:3528.[Abstract/Free Full Text]
  12. Israel EJ, Wilsker DF, Hayes KC, Schoenfeld D, Simister NE. (1996) Increased clearance of IgG in mice that lack beta 2-microglobulin: possible protective role of FcRn. Immunology 89:573.[CrossRef][Web of Science][Medline]
  13. Junghans RP. (1997) Finally! the Brambell receptor (FcRB). Mediator of transmission of immunity and protection from catabolism for IgG. Immunol. Res. 16:29.[Medline]
  14. Ghetie V, Popov S, Borvak J, et al. (1997) Increasing the serum persistence of an IgG fragment by random mutagenesis. Nat. Biotechnol. 15:637.[CrossRef][Web of Science][Medline]
  15. Kim JK, Tsen MF, Ghetie V, Ward ES. (1994) Identifying amino acid residues that influence plasma clearance of murine IgG1 fragments by site-directed mutagenesis. Eur. J. Immunol. 24:542.[Web of Science][Medline]
  16. Popov S, Hubbard JG, Kim J, Ober B, Ghetie V, Ward ES. (1996) The stoichiometry and affinity of the interaction of murine Fc fragments with the MHC class I-related receptor, FcRn. Mol. Immunol. 33:521.[CrossRef][Web of Science][Medline]
  17. Junghans RP and Anderson CL. (1996) The protection receptor for IgG catabolism is the beta2-microglobulin-containing neonatal intestinal transport receptor. Proc. Natl Acad. Sci. USA 93:5512.[Abstract/Free Full Text]
  18. Ghetie V, Hubbard JG, Kim JK, Tsen MF, Lee Y, Ward ES. (1996) Abnormally short serum half-lives of IgG in beta 2-microglobulin-deficient mice. Eur. J. Immunol. 26:690.[Web of Science][Medline]
  19. Roberts DM, Guenthert M, Rodewald R. (1990) Isolation and characterization of the Fc receptor from the fetal yolk sac of the rat. J. Cell Biol. 111:1867.[Abstract/Free Full Text]
  20. Ober RJ, Martinez C, Vaccaro C, Zhou J, Ward ES. (2004) Visualizing the site and dynamics of IgG salvage by the MHC class I-related receptor, FcRn. J. Immunol. 172:2021.[Abstract/Free Full Text]
  21. Raghavan M, Chen MY, Gastinel LN, Bjorkman PJ. (1994) Investigation of the interaction between the class I MHC-related Fc receptor and its immunoglobulin G ligand. Immunity 1:303.[CrossRef][Web of Science][Medline]
  22. Kim JK, Tsen MF, Ghetie V, Ward ES. (1994) Localization of the site of the murine IgG1 molecule that is involved in binding to the murine intestinal Fc receptor. Eur. J. Immunol. 24:2429.[Web of Science][Medline]
  23. Martin WL, West AP Jr, Gan L, Bjorkman PJ. (2001) Crystal structure at 2.8 A of an FcRn/heterodimeric Fc complex: mechanism of pH-dependent binding. Mol. Cell. 7:867.[CrossRef][Web of Science][Medline]
  24. Ghetie V and Ward ES. (1997) FcRn: the MHC class I-related receptor that is more than an IgG transporter. Immunol. Today 18:592.[CrossRef][Web of Science][Medline]
  25. Waldmann TA and Jones EA. (1972) The role of cell-surface receptors in the transport and catabolism of immunoglobulins. CIBA Found. Symp. 9:5.[Medline]
  26. Simister NE and Ahouse JC. (1996) The structure and evolution of FcRn. Res. Immunol. 147:333.[CrossRef][Web of Science][Medline]
  27. Simister NE, Jacobowitz Israel E, Ahouse JC, Story CM. (1997) New functions of the MHC class I-related Fc receptor, FcRn. Biochem. Soc. Trans. 25:481.[Web of Science][Medline]
  28. Ghetie V and Ward ES. (2000) Multiple roles for the major histocompatibility complex class I-related receptor FcRn. Annu. Rev. Immunol. 18:739.[CrossRef][Web of Science][Medline]
  29. Ober RJ, Martinez C, Lai X, Zhou J, Ward ES. (2004) Exocytosis of IgG as mediated by the receptor, FcRn: an analysis at the single-molecule level. Proc. Natl Acad. Sci. USA 101:11076.[Abstract/Free Full Text]
  30. Waldmann TA and Strober W. (1969) Metabolism of immunoglobulins. Prog. Allergy 13:1.[Web of Science][Medline]
  31. Akilesh S, Petkova S, Sproule TJ, Shaffer DJ, Christianson GJ, Roopenian D. (2004) The MHC class I-like Fc receptor promotes humorally mediated autoimmune disease. J. Clin. Invest. 113:1328.[CrossRef][Web of Science][Medline]
  32. Liu Z, Roopenian DC, Zhou X, et al. (1997) Beta2-microglobulin-deficient mice are resistant to bullous pemphigoid. J. Exp. Med. 186:777.[Abstract/Free Full Text]
  33. Presta LG, Shields RL, Namenuk AK, Hong K, Meng YG. (2002) Engineering therapeutic antibodies for improved function. Biochem. Soc. Trans. 30:487.[CrossRef][Web of Science][Medline]
  34. Medesan C, Matesoi D, Radu C, Ghetie V, Ward ES. (1997) Delineation of the amino acid residues involved in transcytosis and catabolism of mouse IgG1. J. Immunol. 158:2211.[Abstract]
  35. Ober RJ, Radu CG, Ghetie V, Ward ES. (2001) Differences in promiscuity for antibody-FcRn interactions across species: implications for therapeutic antibodies. Int. Immunol. 13:1551.[Abstract/Free Full Text]
  36. Hinton PR, Johlfs MG, Xiong JM, et al. (2004) Engineered human IgG antibodies with longer serum half-lives in primates. J. Biol. Chem. 279:6213.[Abstract/Free Full Text]
  37. Shields RL, Namenuk AK, Hong K, et al. (2001) High resolution mapping of the binding site on human IgG1 for Fc gamma RI, Fc gamma RII, Fc gamma RIII, and FcRn and design of IgG1 variants with improved binding to the Fc gamma R. J. Biol. Chem. 276:6591.[Abstract/Free Full Text]
  38. Dall' Acqua WF, Woods RM, Ward ES, et al. (2002) Increasing the affinity of a human IgG1 for the neonatal Fc receptor: biological consequences. J. Immunol. 169:5171.[Abstract/Free Full Text]
  39. Vaccaro C, Zhou J, Ober RJ, Ward ES. (2005) Engineering the Fc region of immunoglobulin G to modulate in vivo antibody levels. Nat. Biotechnol. 23:1283.[CrossRef][Web of Science][Medline]
  40. Hinton PR, Xiong JM, Johlfs MG, Tang MT, Keller S, Tsurushita N. (2006) An engineered human IgG1 antibody with longer serum half-life. J. Immunol. 176:346.[Abstract/Free Full Text]
  41. Zhou J, Mateos F, Ober RJ, Sally Ward E. (2005) Conferring the binding properties of the mouse MHC class I-related receptor, FcRn, onto the human ortholog by sequential rounds of site-directed mutagenesis. J. Mol. Biol. 345:1071.[CrossRef][Web of Science][Medline]
  42. Carter P, Presta L, Gorman CM, et al. (1992) Humanization of an anti-p185HER2 antibody for human cancer therapy. Proc. Natl Acad. Sci. USA 89:4285.[Abstract/Free Full Text]
  43. Kabat EA. (1988) Antibody complementarity and antibody structure. J. Immunol. 141:S25.[Web of Science][Medline]
  44. Foote J and Winter G. (1992) Antibody framework residues affecting the conformation of the hypervariable loops. J. Mol. Biol. 224:487.[CrossRef][Web of Science][Medline]
  45. Chaudhury C, Mehnaz S, Robinson JM, et al. (2003) The major histocompatibility complex-related Fc receptor for IgG (FcRn) binds albumin and prolongs its lifespan. J. Exp. Med. 197:315.[Abstract/Free Full Text]
  46. Takai T, Ono M, Hikida M, Ohmori H, Ravetch JV. (1996) Augmented humoral and anaphylactic responses in Fc gamma RII-deficient mice. Nature 379:346.[CrossRef][Medline]
  47. Petkova SB, Konstantinov KN, Sproule SJ, Lyons BL, Al Awwami M, Roopenian DC. (2006) Human antibodies induce arthritis in mice deficient in the low-affinity inhibitory IgG receptor FcgRIIB. J. Exp. Med. 203:275.[Abstract/Free Full Text]
  48. Firan M, Bawdon R, Radu C, et al. (2001) The MHC class I-related receptor, FcRn, plays an essential role in the maternofetal transfer of gamma-globulin in humans. Int. Immunol. 13:993.[Abstract/Free Full Text]
  49. Gurbaxani B, Dela Cruz LL, Chintalacharuvu K, Morrison SL. (2006) Analysis of a family of antibodies with different half-lives in mice fails to find a correlation between affinity for FcRn and serum half-life. Mol. Immunol. 43:1462.[CrossRef][Web of Science][Medline]
  50. Christianson GJ, Blankenburg RL, Duffy TM, et al. (1996) Beta2-microglobulin dependence of the lupus-like autoimmune syndrome of MRL-lpr mice. J. Immunol. 156:4932.[Abstract]
  51. Christianson GJ, Brooks W, Vekasi S, et al. (1997) Beta 2-microglobulin-deficient mice are protected from hypergammaglobulinemia and have defective antibody responses because of increased IgG catabolism. J. Immunol. 159:4781.[Abstract]
  52. Jin F and Balthasar JP. (2005) Mechanisms of intravenous immunoglobulin action in immune thrombocytopenic purpura. Hum. Immunol. 66:403.[CrossRef][Web of Science][Medline]
  53. Ning L, Zhao M, Hilario-Vargas J, et al. (2005) Complete FcRn dependence for IVIG therapy in autoimmune skin blistering diseases. J. Clin. Invest. 203:647.
  54. Simister NE and Story CM. (1997) Human placental Fc receptors and the transmission of antibodies from mother to fetus. J. Reprod. Immunol. 37:1.[CrossRef][Web of Science][Medline]
  55. Story CM, Mikulska JE, Simister NE. (1994) A major histocompatibility complex class I-like Fc receptor cloned from human placenta: possible role in transfer of immunoglobulin G from mother to fetus. J. Exp. Med. 180:2377.[Abstract/Free Full Text]
  56. Simister NE. (2003) Placental transport of immunoglobulin G. Vaccine 21:3365.[CrossRef][Web of Science][Medline]
  57. Bitonti AJ, Dumont JA, Low SC, et al. (2004) Pulmonary delivery of an erythropoietin Fc fusion protein in non-human primates through an immunoglobulin transport pathway. Proc. Natl Acad. Sci. USA 101:9763.[Abstract/Free Full Text]
  58. Yoshida M, Claypool SM, Wagner JS, et al. (2004) Human neonatal Fc receptor mediates transport of IgG into luminal secretions for delivery of antigens to mucosal dendritic cells. Immunity 20:769.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
M. Sarav, Y. Wang, B. K. Hack, A. Chang, M. Jensen, L. Bao, and R. J. Quigg
Renal FcRn Reclaims Albumin but Facilitates Elimination of IgG
J. Am. Soc. Nephrol., September 1, 2009; 20(9): 1941 - 1952.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. A. Yeung, M. K. Leabman, J. S. Marvin, J. Qiu, C. W. Adams, S. Lien, M. A. Starovasnik, and H. B. Lowman
Engineering Human IgG1 Affinity to Human Neonatal Fc Receptor: Impact of Affinity Improvement on Pharmacokinetics in Primates
J. Immunol., June 15, 2009; 182(12): 7663 - 7671.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
D. W. Schneider, T. Heitner, B. Alicke, D. R. Light, K. McLean, N. Satozawa, G. Parry, J. Yoo, J. S. Lewis, and R. Parry
In Vivo Biodistribution, PET Imaging, and Tumor Accumulation of 86Y- and 111In-Antimindin/RG-1, Engineered Antibody Fragments in LNCaP Tumor-Bearing Nude Mice
J. Nucl. Med., March 1, 2009; 50(3): 435 - 443.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. P. Montoyo, C. Vaccaro, M. Hafner, R. J. Ober, W. Mueller, and E. S. Ward
Conditional deletion of the MHC class I-related receptor FcRn reveals the sites of IgG homeostasis in mice
PNAS, February 24, 2009; 106(8): 2788 - 2793.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
X. Liu, L. Ye, Y. Bai, H. Mojidi, N. E. Simister, and X. Zhu
Activation of the JAK/STAT-1 Signaling Pathway by IFN-{gamma} Can Down-Regulate Functional Expression of the MHC Class I-Related Neonatal Fc Receptor for IgG
J. Immunol., July 1, 2008; 181(1): 449 - 463.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. R. Mezo, K. A. McDonnell, C. A. T. Hehir, S. C. Low, V. J. Palombella, J. M. Stattel, G. D. Kamphaus, C. Fraley, Y. Zhang, J. A. Dumont, et al.
Reduction of IgG in nonhuman primates by a peptide antagonist of the neonatal Fc receptor FcRn
PNAS, February 19, 2008; 105(7): 2337 - 2342.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Akilesh, G. J. Christianson, D. C. Roopenian, and A. S. Shaw
Neonatal FcR Expression in Bone Marrow-Derived Cells Functions to Protect Serum IgG from Catabolism
J. Immunol., October 1, 2007; 179(7): 4580 - 4588.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
X. Liu, L. Ye, G. J. Christianson, J.-Q. Yang, D. C. Roopenian, and X. Zhu
NF-{kappa}B Signaling Regulates Functional Expression of the MHC Class I-Related Neonatal Fc Receptor for IgG via Intronic Binding Sequences
J. Immunol., September 1, 2007; 179(5): 2999 - 3011.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/12/1759    most recent
dxl110v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (21)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Petkova, S. B.
Right arrow Articles by Roopenian, D. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Petkova, S. B.
Right arrow Articles by Roopenian, D. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?