Skip Navigation


International Immunology Advance Access originally published online on October 31, 2006
International Immunology 2006 18(12):1737-1747; doi:10.1093/intimm/dxl108
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/12/1737    most recent
dxl108v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Irie, A.
Right arrow Articles by Nishimura, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Irie, A.
Right arrow Articles by Nishimura, Y.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Japanese Society for Immunology. 2006. All rights reserved. For permissions, please e-mail: journals.permissions@oxfordjournals.org

Protein kinase D2 contributes to either IL-2 promoter regulation or induction of cell death upon TCR stimulation depending on its activity in Jurkat cells

Atsushi Irie1, Kumiko Harada1, Hirotake Tsukamoto1, Jeong-Ran Kim1, Norie Araki2 and Yasuharu Nishimura1

1 Department of Immunogenetics, Graduate School of Medical Sciences, Kumamoto University, Honjo 1-1-1, Kumamoto 860-8556, Japan
2 Department of Tumor Genetics and Biology, Graduate School of Medical Sciences, Kumamoto University, Honjo 1-1-1, Kumamoto 860-8556, Japan

Correspondence to: Y. Nishimura; E-mail: mxnishim{at}gpo.kumamoto-u.ac.jp


   Abstract
Top
 Abstract
Introduction
 Methods
 Results
 Discussion
 References
 
Members of protein kinase D (PKD) family serine/threonine kinases (PKD1, PKD2 and PKD3) are expressed in wide range of cells and regulate various cellular responses including immune responses. We have previously shown that PKD is involved in the signaling pathways of a human CD4+ T cell clone stimulated with its cognate antigen. Contrary to foregoing publications, PKD1 mRNA was not detected in human T cells, Jurkat cells and mouse thymocytes and splenocytes. Instead, mass-spectrometric and reverse transcription–PCR analyses revealed that PKD2 was predominant in T cells. To investigate the roles of PKD2, wild-type (WT) and constitutively active (CA) PKD2 were expressed in Jurkat cells together with IL-2 promoter-driven reporter gene. Expression of WT-PKD2 enhanced IL-2 promoter activity upon stimulation with anti-CD3 mAb, while expression of CA-PKD2 inhibited IL-2 promoter activity and induced cell death. Although the cell death was suppressed by the treatment with caspase inhibitor, the IL-2 promoter activity was rarely recovered in CA-PKD2-expressing cells upon TCR stimulation. WT-PKD2 localized mainly in the cytoplasm translocated into the nucleus after TCR stimulation, while CA-PKD2 was present in both the cytoplasm and the nuclei before and after stimulation. Proteomic analyses revealed that CA-PKD2 enhanced the amount of phosphorylated SET protein, a histone chaperon that regulates histone acetylation, in Jurkat cells and the recombinant SET protein was phosphorylated by CA-PKD2 in vitro. The data provide a renewing insight into the subset of PKD family kinases expressed in T cells and suggest that PKD2 is involved in IL-2 promoter regulation and cell death depending on its activity upon TCR stimulation.

Keywords: activation induced cell death, protein kinase Cµ, protein kinase D, SET protein, T cell activation


   Introduction
Top
 Abstract
 Introduction
Methods
 Results
 Discussion
 References
 
Protein kinase D1 (PKD1), also known as PKCµ, was first classified as a member of atypical PKCs (1); however, it turned out to have structurally and enzymologically different properties from those of PKCs. Recently, the identification of two serine protein kinases PKC{nu} (2) and PKD2 (3), which are similar to PKCµ in the overall structure and primary amino acid sequences, gave rise to a notion that PKCµ, PKD2 and PKC{nu} constitute a new protein kinase subfamily distinct from PKCs, the PKD family. According to this classification, PKCµ and PKC{nu} are designated as PKD1 and PKD3, respectively. The members of PKD family kinases are present in wide range of cells and regulate various cellular responses such as cell proliferation, cell survival, apoptosis, Golgi organization, trafficking and immune responses (4). Extensive works have been done to elucidate functions of PKD1 for the antigen receptor-mediated signaling pathways in B, T and mast cells (5–10). These studies showed that PKD1 is activated by the antigen receptor engagement; however, precise mechanisms for its activation, the downstream molecules and behavior in the cell after antigen stimulation largely remained to be investigated.

Using a human CD4+ T cell clone of which specific antigen and responses to the analogue peptides are well characterized, we found that over-expression of some analogue peptide–HLA complexes induced strong T cell proliferation without detectable tyrosine phosphorylation and kinase activity of zeta-associated protein-70 (ZAP-70) (11–13). The observation suggested the presence of ZAP-70-independent signaling pathway and identification of the molecules involved in this pathway became a major target for our study. In our previous study, the investigation using several pharmacological inhibitors suggested that PKD was involved not only in the signaling pathways to induce full CD4+ T cell responses stimulated with the specific antigen but also in the unique ZAP-70-independent T cell activation pathway stimulated by the analogue peptide–HLA complexes.

To investigate the role of PKD in T cell activation, we identified subtype of PKD family kinase mainly expressed in T cells and expressed the recombinant kinase in Jurkat cells using a lentiviral gene transfer system. It was shown in this study that the PKD family protein kinase predominantly expressed in T cells was PKD2 but not PKD1. Expression of wild-type (WT)-PKD2 revealed that PKD2 was involved in IL-2 promoter activation upon TCR stimulation. However, expression of constitutively active (CA)-PKD2 resulted in T cell death upon TCR stimulation, suggesting that PKD2 regulates IL-2 promoter activity and T cell death depending on its kinase activity.


   Methods
Top
 Abstract
 Introduction
 Methods
Results
 Discussion
 References
 
Cells and reagents
The human leukemic T cell line Jurkat (E6-1) and ZAP-70-deficient mutant of Jurkat (P116) were obtained from American Type Culture Collection (Manassas, VA, USA). Human peripheral T cells were obtained by collecting nylon–wool pass-through fraction of PBMCs of healthy donors. Mouse thymocytes and spleen cells were prepared from C57BL/6 mice. The human CD4+ T cell clone T5-32 was established in our laboratory (11, 14). An IL-2 promoter-driven green fluorescence protein (GFP) reporter construct (see below) was stably transfected into Jurkat cells to evaluate the effect of PKD2 activity on IL-2 promoter activation upon TCR stimulation. Anti-human CD3{epsilon} mAb (UCHT-1) and anti-GFP antibody were purchased from BD Biosciences (Franklin Lakes, NJ, USA). Rabbit anti-human PKCµ polyclonal antibody (D-20) was from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Anti-human PKD2 antibody, z-VAD-FMK, Gö6976 and Gö6983 were from Calbiochem (San Diego, CA, USA). Porcine-modified trypsin and 2,5-dihydroxybenzoic acid (DHB) were obtained from Promega (Madison, WI, USA) and Aldrich (St Louis, MO, USA), respectively.

Plasmids
The full-length human PKD1, PKD2 and PKD3 cDNAs were amplified from total RNAs of Jurkat, Hela or 293 cells using reverse transcription (RT)–PCR and sub-cloned into pGEM-T easy vectors (Promega). For the production of glutathione S-transferase (GST) and 6x His tag fusion proteins, pGEX4T vectors (Amersham Biosciences, Braunschweig, Germany) and pET28a vector (Novagen, Darmstadt, Germany) were used. To introduce GFP tag, the stop codon of PKD2 was replaced with the restriction AgeI site and PCR-amplified linker plus GFP fragment using the primer set of 5'-AACCGGTGGTGGTGGCTCAGGAGGAGGTGGGTCCGGAGGTGGAGGATCTATGGTGAGCAAGGGCGAGGAG-3' and 5'-AACCGGTTACTTGTACAGCTCGTCCATGC-3' was inserted to the AgeI site. cDNAs for GFP-tagged WT-PKD2 (WT-PKD2-GFP), CA mutant [deletion of the pleckstrin homology (PH) domain] of PKD2 (CA-PKD2-GFP) (15, 16), kinase dead (KD) mutant (Lys580 to Asn, Ser706 and Ser710 to Ala) of PKD2 (KD-PKD2-GFP) and CA mutant of PKD2 with Lys580 to Asn, Ser706 and Ser710 to Ala mutations ({Delta}PH-KD-PKD2-GFP) were sub-cloned into a pENTR vector (Invitrogen, Leek, The Netherlands) and then transferred into self-inactivating vectors CSII-CMV-RfA or CSII-EF-RfA (17) by LR recombination reaction (Gateway System, Invitrogen). The plasmids, CSII-CMV-RfA, CSII-EF-RfA, pCMV-VSV-G-RSV-Rev and pHIVgp, necessary for lentiviral gene expression were kindly donated by H. Miyoshi (RIKEN Tsukuba Institute). The IL-2 promoter-driven GFP reporter construct was prepared by replacing the luciferase gene with GFP gene in the IL-2-luc plasmid donated by V. Boussiotis (Dana-Farber Cancer Institute) (18).

RT–PCR
Total RNAs were prepared using RNeasy (Qiagen, Hilden, Germany) according to the manufacturer's recommendation. Five micrograms of RNA was used for the first-strand synthesis using Superscript II reverse transcriptase (Invitrogen). For detection of human PKD1, PKD2 and PKD3, primer sets of CGCTCTCTAGACATGTGGTC and GAGATGGAACTCAGAGGATGC, GACCACATGTCCAGCGAGCG and CCTCAGAGAACACTGATGCGC, and CGTTCCCTAGATATGTGGTC and CAGTGATTAAGGATCTTCTTCC, respectively, were used for PCRs. For detection of mouse PKD1, PKD2 and PKD3, primer sets of CCGTGGAAGGAGATTTCTCA and ATCAGGT-GCGCCGGGTACTG, CCCTGGAGCCACATCTCATC and AGGTCCCCTTCTGCAGGAGT, and CCATGGCGAGAAATTTCCAG and ATGAAATGCTTTGGGTATTC were used, respectively. A 30-cycle PCR with denaturation at 95°C, annealing at 55°C and extension at 72°C was performed using a thermal cycler (MJ Research, Watertown, MA, USA).

Lentiviral gene transfer
Lentiviral vector-mediated gene transfer was performed as described (19). Briefly, 17 µg of either CSII-CMV-RfA or CSII-EF-RfA self-inactivating vectors (17) with PKD2 cDNAs and 10 µg of pCMV-VSV-G-RSV-Rev and pHIVgp were transfected into the 293T cells grown in the 10-cm culture dish using Lipofectamine 2000 reagent (Invitrogen). After 60 h of transfection, the medium was recovered and pelleted the viral particles by ultracentrifugation (50 000 x g, 2 h). The pellet was suspended in 50 µl per 10-cm dish of RPMI 1640 medium and various amount of viral suspension was added to 5 x 104 Jurkat cells in a U-bottom 96-well plate. The expression of the recombinant PKD2 proteins was monitored by fluorescent microscopic observation.

Immunoprecipitation, western blot and in vitro kinase assay
Jurkat cells (5 x 106) were stimulated with anti-CD3 mAb UCHT-1 (10 µg ml–1) for 10 min at 37°C followed by the addition of the anti-mouse IgG antibody (5 µg ml–1) and incubated for 1 h at 37°C. The cells were lysed with lysis buffer [50 mM Tris–HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 1 mM dithiothreitol (DTT), 1 mM Na3VO4, 10 mM NaF and proteinase inhibitor cocktail] and immunoprecipitated with anti-PKCµ antibody D-20 plus protein-A beads. The immune complex was incubated in the kinase buffer containing [{gamma}-32P]ATP at 30°C for 10 min. The beads were then washed with ice-cold kinase buffer without ATP and the proteins were separated using SDS-PAGE and transferred onto a nitrocellulose membrane. The membrane was exposed to X-ray films (Fujifilm, Tokyo, Japan) to monitor incorporated radioactivity through autophosphorylation of PKD and then subjected to western blotting using an anti-PKCµ antibody to confirm equal loading.

To detect GFP-tagged PKD2 proteins or IL-2 promoter-driven free GFP, 2 x 105 cells per 0.2 ml in 48-well plate were stimulated with anti-CD3 mAb and anti-mouse IgG antibody as described above for the indicated time. The lysates were separated by SDS-PAGE and transferred onto a nitrocellulose membrane. The membrane was blotted with anti-GFP antibody and HRP-conjugated anti-rabbit IgG antibody followed by enhanced chemiluminescent detection (Amersham Biosciences). Then the same membrane was stripped and reprobed using an anti-human PKD2 antibody.

Mass spectrometry
Jurkat cells (1 x 107) were lysed with lysis buffer and immunoprecipitated with anti-PKCµ antibody D-20 plus protein-A beads. The immunoprecipitated proteins were subjected to SDS-PAGE and the gel was stained with Syproruby (Invitrogen). The major band of apparent molecular weight of 100 kDa was excised and digested with trypsin. The tryptic peptides were extracted with 0.1% trifluoroacetic acid (TFA) in 50% CH3CN and dried. The peptide mixture was dissolved in 0.1% TFA, desalted with Zip-Tip µC18 (Millipore, Billerica, MA, USA) and eluted with 0.5% TFA in 50% CH3CN.

The eluate was mixed with equal amount of matrix solution (20 mg DHB in 0.1% TFA/30% CH3CN) and coated onto a matrix-assisted laser desorption ionization (MALDI) target plate. The plate was then equipped in the API QStar Pulser i mass spectrometer (Applied Biosystems, Foster, CA, USA) and time of flight (TOF)-mass spectrum was obtained under the ion source voltage of 950 V. Then product ion scan was performed with a collision energy of 30–40 V in low resolution mode. The tandem mass spectra were analyzed and the amino acid sequences were searched using MASCOT (http://www.matrixscience.com).

2D-gel electrophoresis
Jurkat cells (1 x 108) were stimulated with anti-CD3 mAb UCHT-1 (10 µg ml–1) for 10 min at 37°C followed by the addition of the anti-mouse IgG antibody (5 µg ml–1) and incubated overnight at 37°C. Phosphoproteins were fractionated from the cell lysate using PhosphoProtein Purification Kit (Qiagen) according to the manufacturer's instruction and applied to precast immobilized pH gradient (IPG) dry gels (7 cm, pH 3–10, Bio-Rad, Hercules, CA, USA) using the swelling buffer (8 M urea, 2% 3-[(3-Cholamidopropyl)dimethylammonio]propanesulfonic acid 0.5% IPG buffer pH 3–10) and electric focusing electrophoresis was performed under the following conditions: 0.3 h at 200 V, 1.3 h at 500 V and 6 h at 3500 V with Multiphore II (Amersham Biosciences). The strips were incubated successively in 10 mg ml–1 DTT in equilibration buffer [50 mM Tris–HCl (pH 8.8), 6 M urea, 30% glycerol and 2% SDS] for 15 min and in 25 mg iodoacetamide in equilibration buffer for 15 min. The strips were then subjected to 11% SDS-PAGE. The protein spots were visualized using Syproruby (Molecular Probes) staining and excised with a spot picker (Fluorophorester 3000, Anatec Inc., Tokyo, Japan). In-gel digestion and mass-spectrometric analyses were performed as described above.

Confocal microscopy
Jurkat cells were cultured in poly-L-lysine-coated 35-mm glass-based dish and fixed with 4% PFA for 10 min and endogenous PKD2 was stained with anti-PKCµ antibody D-20 and fluorescein-conjugated anti-mouse IgG. Jurkat transfectants expressing recombinant PKD2-GFP fusion proteins or GFP only were cultured in poly-L-lysine-coated 35-mm glass-based dish and stimulated by adding the anti-CD3 mAb and anti-mouse IgG antibodies. The fluorescence was observed using a Fluoview FV500 (Olympus, Tokyo, Japan) laser scanning microscope.


   Results
Top
 Abstract
 Introduction
 Methods
 Results
Discussion
 References
 
PKD2 but not PKD1 was expressed in human and mouse T cells
We have previously shown that activation of PKD was involved in the signaling pathway leading to proliferation and IFN-{gamma} production in a human CD4+ T cell clone T5-32 stimulated with its cognate TCR ligand (11–13). To further analyze PKD function in the T cells, we tried to obtain PKD1 cDNA by RT–PCR. Although the PKD protein and the kinase activity were detected in the immune complex using anti-human PKCµ antibody D-20, we could not detect the cDNA of PKD1 using RNA from T5-32 or Jurkat cells by RT–PCR as described below. To identify the protein precipitated with the anti-PKCµ antibody, the immune complex from Jurkat cell lysate was subjected to SDS-PAGE and the major band corresponding to the molecular weight of PKD1 (100 kDa) was excised. The gel slice was trypsin digested and the peptides were analyzed with a MALDI quadrupole (Q)-TOF mass spectrometer. The product ion scans were performed for the major peaks found in the TOF-MS spectrum (Fig. 1A) and the corresponding amino acid sequences were searched using MASCOT (http://www.matrixscience.com). Interestingly, except for myosin 1C and trypsin, all identified peptide ions were tryptic fragments of PKD2, a serine/threonine protein kinase closely related to PKD1 (Fig. 1A). No tryptic fragments corresponding to amino acid sequences of PKD1 and PKD3 were detected by the mass-spectrometric analyses.


Figure 1
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 MALDI Q-TOF analyses revealed the protein immunoprecipitated from Jurkat cell lysate using anti-PKCµ antibody as PKD2. (A) To identify the protein immunoprecipitated from Jurkat cell lysate using anti-PKCµ antibody D-20, mass-spectrometric analyses were performed as described in Methods. All major peaks shown in the TOF-mass spectrum were analyzed by precursor ion scan mode. The tandem mass spectra were analyzed using MASCOT (http://www.matrixscience.com) and identified peptides were shown: M and T represent peptide fragments derived from human myosin 1C and porcine trypsin, respectively. The amino acid sequences shown in the mass spectrum were all coincided with the PKD2 tryptic fragments, of which starting and ending positions are indicated. (B) Lysates of Escherichia coli expressing GST fusion proteins of human PKD1 and PKD2 were separated with SDS-PAGE and transferred onto a nitrocellulose membrane. The membrane was blotted with the same anti-PKCµ antibody D-20 used for the immunoprecipitation. The protein bands corresponding to the expected sizes of 128 and 123 kDa for GST-PKD1 and GST-PKD2, respectively, were indicated (top right). The membrane was stripped and reprobed with anti-GST antibody (middle right). In parallel experiment, the same amount of the samples were subjected to SDS-PAGE and stained with Coomassie Brilliant Blue (CBB, bottom right). The lysate of E. coli expressing GST only (27 kDa) was not detected with the anti-PKCµ antibody. Production of the GST fusion proteins were induced by the addition of isopropyl-ß-D-thiogalactopyranoside (IPTG).

 
The MS data suggested that the anti-human PKCµ antibody D-20 used for the immunoprecipitation should react to both PKD1 and PKD2. To confirm this, lysates of Escherichia coli expressing GST fusion proteins of human PKD1 and PKD2 were subjected to western blot analysis using the D-20 antibody. As expected, both protein bands corresponding to the molecular weight of GST-PKD1 (128 kDa) and GST-PKD2 (123 kDa) were detected (Fig. 1B). Lysate of E. coli expressing GST only did not give positive staining. Therefore, D-20 anti-human PKCµ antibody was shown to cross-react to PKD1 and PKD2.

The low abundance of PKD1 was not specific to Jurkat cells because the primer set for human PKD2 cDNA amplified an expected size of DNA band by RT–PCR using mRNAs from T5-32 cells and peripheral T cells, while the primer set for human PKD1 did not (Fig. 2A). Gel slices that covered the expected size of DNA fragment for PKD1 and PKD3 were excised and used as a template for the second round of PCR. As shown in Fig. 2(B), PKD1 cDNA was not detected even in the second round of PCR and thus we conclude that very little amount, if any, of PKD1 is present in human T cells. Since PKD3 cDNA was detected in the second round of PCR (Fig. 2B), PKD2, but not PKD1 and PKD3, is the major PKD family kinase expressed in human T cells. The same observations were obtained in mouse thymocytes and spleen cells, since the cDNA fragment for PKD2, but not for PKD1 or PKD3, was detected in the first round of RT–PCR using total RNAs from both cells (Fig. 2C). On the other hand, PKD1, PKD2 and PKD3 cDNAs were detected in the first round of RT–PCR products using total RNA prepared from NIH3T3 cells (Fig. 2D). These data indicate that the PKD family kinase predominantly expressed in human and mouse T cells was PKD2 and that there is little PKCµ/PKD1 if any in human peripheral T cells as well as in mouse thymocytes and spleen cells.


Figure 2
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 PKD2, but not PKD1, mRNA is expressed in human T cells, mouse thymocytes and spleen cells. (A) Total RNAs were prepared from a human T cell clone T5-32 (T) and peripheral T cells from two healthy donors (1 and 2) were used for RT–PCR with the primer set for PKD1, PKD2 and PKD3 described in Methods. The expected sizes of cDNAs were amplified when the plasmids containing the full-length human PKD1, PKD2 and PKD3 cDNAs were used as templates (P). Although PKD2 cDNAs were detected from any T cell preparations, PKD1 and PKD3 cDNAs were not detected. (B) Gel slices covering the expected size of PKD1 and PKD3 cDNAs in the lanes of T cell clone in (A) were used as the templates for the second round of PCR amplification. The expected size of PKD3 cDNA was detected and the sequence was verified by DNA sequencing. On the other hand, PKD1 cDNA was again failed to be amplified. (C) Similar results were obtained using total RNAs from B57BL/6 mouse thymocytes (Thy) and spleen cells (Spl), in which PKD2 but neither PKD1 nor PKD3 were detected by the RT–PCR using primers sets for murine PKDs. (D) All three murine PKD family cDNAs were detected from total RNA extracted from NIH3T3 cells under the same RT–PCR condition used in (C).

 
PKD2 was activated by TCR stimulation in ZAP-70-independent manner in Jurkat cells
Previously, we reported that T5-32 cells strongly proliferated in recognition of analogue peptide covalently linked with HLA–DR4 complex without ZAP-70 activation but with up-regulation of PKD activity (11). In accordance with the observation, activation of PKD2 was observed not only in anti-CD3 antibody-stimulated Jurkat cells but also in ZAP-70-deficient P116 cells as deduced from autophosphorylation of PKD2 immunoprecipitated with anti-PKCµ antibody D-20 (Fig. 3, left panels). The up-regulation of the kinase activity was effectively blocked by the presence of the conventional PKC and PKD inhibitor Gö6976 (3 µM) but not by the presence of Gö6983 (3 µM), an inhibitor for all categories of PKC except for PKD (20) (Fig. 3, right panels). The data indicate that PKD2 kinase activity could be up-regulated by TCR stimulation regardless of the presence of ZAP-70 in Jurkat cells.


Figure 3
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 Endogenous PKD2 kinase activity is up-regulated with TCR stimulation in a ZAP-70-independent manner. Jurkat cells and its ZAP-70-deficient mutant cell line P116 were pre-treated with PKC inhibitors Gö6976 or Gö6983, or left untreated and stimulated with anti-CD3 mAb. Gö6976 is an effective inhibitor for PKD, while Gö6983 is not effective for PKD. Endogenous PKD2 immunoprecipitated from the cell lysates using anti-PKCµ (D-20) antibody was subjected to in vitro kinase assay to detect autophosphorylation of PKD2 in the presence or absence of the 3 µM of the indicated inhibitors (top panels). Western blotting using the same anti-PKCµ antibody was performed to confirm equal PKD2 loading (bottom panels).

 
Expression of functional recombinant PKD2 gene by lentiviral vector
To investigate PKD2 functions in T cells, we expressed recombinant WT-PKD2 and CA-PKD2, in which the PH domain was deleted (15, 16) into Jurkat cells using lentiviral vectors (17). To distinguish the recombinant proteins from endogenous PKD2, both proteins were GFP tagged at the C-terminus through (Gly-Gly-Gly-Ser)3 linker and designated as WT-PKD2-GFP and CA-PKD2-GFP, respectively. CMV promoter-driven WT-PKD2-GFP and CA-PKD2-GFP were stably expressed in Jurkat cells. The cells were stimulated with anti-CD3 mAb followed by cross-linking with anti-mIgG antibody for 1 h and were subjected to in vitro kinase assay. As shown in Fig. 4(A), CA-PKD2-GFP exhibited relatively higher kinase activity estimated by the autophoshorylation even in the absence of TCR stimulation and the kinase activities of both PKD2-GFP proteins were up-regulated by the TCR stimulation (Fig. 4A). This up-regulation of the kinase activity seemed to be in part due to the increase of the amount of recombinant PKD2 protein after TCR stimulation (Fig. 4A, bottom).


Figure 4
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 IL-2 promoter activation upon TCR stimulation in Jurkat cells introduced with WT-PKD2 gene using a lentiviral system. (A) Jurkat cells were infected with the recombinant lentiviruses harboring CMV promoter-driven WT-PKD2-GFP and CA-PKD2-GFP genes and were stimulated with anti-CD3 mAb for 1 h. The immunoprecipitates of the cell lysates using anti-GFP antibody were then subjected to in vitro kinase assay to evaluate kinase activities of the recombinant PKD2. The kinase activities of WT-PKD2-GFP and CA-PKD2-GFP were up-regulated by the TCR stimulation as evidenced by the incorporated radioactivity by autophosphorylation, although the CA-PKD2-GFP had considerable amount of kinase activity even in the unstimulated cells (top). Uninfected Jurkat cells showed no kinase activity because of the lack of anti-GFP-reactive recombinant PKD2. The same membrane was blotted with anti-PKD2 antibody, revealing that expected size of protein bands were detected in the lanes loaded with the immunoprecipitates from infected cells but not in those from uninfected Jurkat cells (bottom). (B) Jurkat cells expressing CMV promoter-driven WT-PKD2-GFP and CA-PKD2-GFP were harvested at the indicated time after TCR stimulation. The amount of recombinant PKD2-GFP expressed after TCR stimulation was evaluated by western blot analyses using anti-GFP antibody. (C) To evaluate the effect of PKD2 activity on IL-2 promoter activation upon TCR stimulation, we prepared Jurkat cells stably transfected the IL-2 promoter-driven GFP reporter gene. The cells were infected with indicated amount of culture supernatant containing viruses harboring WT-PKD2-GFP gene and stimulated with anti-CD3 mAb for 24 h or left unstimulated. The expression levels of the recombinant PKD2-GFP (top) protein and reporter GFP (middle) were monitored by the western blot analyses using the anti-GFP antibody. After stripping, the membrane was reprobed with anti-PKD2 antibody (bottom). endo. PKD2: endogenous PKD2.

 
To check the changes in expression levels of the recombinant PKD2 proteins after TCR stimulation, western blot analyses were performed using anti-GFP antibody. CMV promoter-driven recombinant PKD2 proteins were markedly up-regulated after 2 h of TCR stimulation (Fig. 4B). Similarly, CMV promoter-driven free GFP expression in Jurkat cells was also up-regulated after TCR stimulation; however, no such up-regulation was observed if the elongation factor-1{alpha} (EF-1{alpha}) promoter was used for the expression of the recombinant proteins in Jurkat cells after TCR stimulation (Fig. 6A). Apparently, when Jurkat cells expressing the CMV promoter-driven recombinant PKD2 proteins were stimulated with anti-CD3 mAb, it is apparently hard to distinguish whether the T cell responses observed were induced by the up-regulated PKD2 activity alone or by both PKD2 activity and activation of other downstream molecules of TCR stimulation. Besides this problem, the cells expressing CMV promoter-driven recombinant PKD2 kinases provide us a good tool to investigate functions of over-expressed PKD2 and were used in the following experiments.


Figure 6
View larger version (43K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 6 Expression of KD mutant of PKD2 and treatment with PKD2 inhibitor suppressed TCR-stimulated IL-2 promoter activation. Lentiviruses harboring EF-1{alpha} promoter-driven KD-PKD2-GFP expression vector were infected three times to Jurkat cells transfected with IL-2 promoter-driven GFP gene to obtain relatively higher expression levels of the mutant PKD2. (A) EF-1{alpha} promoter-driven KD-PKD2-GFP (KD)-expressing cells, cells expressing high [WT(Hi)) and low (WT(Lo)] amount of CMV promoter-driven WT-PKD2-GFP and empty vector-infected (none) cells were stimulated with anti-CD3 mAb or left unstimulated for 24 h. The whole cell lysate was subjected to the western blot analyses using anti-PKD2 antibody (upper) or anti-GFP antibody (lower). The amount of endogenous PKD2 shows equal loading of the cell lysate (top). (B) Relative amount of IL-2 promoter-driven GFP produced in (A) was quantified using NIH image software. The amount of GFP produced by the empty vector-infected cells (none) stimulated with anti-CD3 antibody was assigned to be 1.0. The statistical significance of the difference in the IL-2 promoter activity between none and KD was done by the Student's t-test and the value (P < 0.001) is shown. (C) Jurkat cells with IL-2 promoter-driven GFP gene were stimulated with anti-CD3 mAb for 24 h in the presence of indicated concentration of Gö6976 or Gö6983. Although both PKC inhibitors have similar IC50 values for conventional PKCs (2–7 nM, 20), Gö6976 suppressed the GFP production more effectively, indicating that the strong inhibitory effect was mainly due to the suppression of PKD2 activity. The amount of endogenous PKD2 shows equal loading of the cell lysate.

 
WT-PKD2 up-regulated IL-2 promoter activity upon TCR stimulation
Since PKD activity was shown to be involved in the proliferative response of TCR-stimulated T cells (11), we investigated the relationship between the activities of PKD2 and IL-2 promoter. Because we failed to detect secreted IL-2 in Jurkat cell stimulated with anti-CD3 or anti-CD3 plus anti-CD28, we constructed a Jurkat cells stably transfected IL-2 promoter-driven GFP reporter gene. Using lentiviral vectors, both WT-PKD2-GFP and CA-PKD2-GFP were stably expressed in the Jurkat transfectants. Both recombinant PKD2 proteins were detectable in unstimulated cells using a fluorescent microscope (Fig. 7D and E) but they were rarely detectable by the western blot analyses. However, the amount of both proteins increased after 24 h of TCR stimulation (Fig. 4C, top panel), and the amount of IL-2 promoter-driven GFP was increased in cells expressing WT-PKD2-GFP in a viral dose-dependent manner. On the other hand, although CA-PKD2-GFP-expressing cells had higher PKD2 activity after 1 h of TCR stimulation in comparison to those expressing WT-PKD2-GFP (Fig. 4A), the production of reporter GFP was hardly detectable (Fig. 4C, middle panel). Instead, we noticed that many CA-PKD2-GFP-expressing cells died after 24 h of TCR stimulation. The mock cells infected with 10-µl suspension of lentiviruses without PKD2 gene had similar reporter GFP production after TCR stimulation to that of the Jurkat transfectants (data not shown). Therefore, the IL-2 promoter activity was up-regulated by WT-PKD2-GFP expression in a dose-dependent manner upon TCR stimulation.


Figure 7
View larger version (84K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 7 PKD2-GFP translocates from cytoplasm to the nucleus by TCR stimulation. WT Jurkat cells were stained with anti-PKCµ antibody as indicated in Methods and were observed with a confocal microscope. (A) Jurkat cells stained with control rabbit IgG (rIgG) or (B) those stained with anti-PKCµ antibody D-20. The localization of GFP-tagged recombinant proteins was observed with a confocal microscope. (C) CMV promoter-driven GFP expression by lentiviral infectin. WT-PKD2-GFP (D and F) and CA-PKD2-GFP (E and G) were expressed in Jurkat cells. Cells were stimulated with anti-CD3 mAb for 1 h (F and G) or left unstimulated (D and E).

 
CA-PKD2 induced cell death upon TCR stimulation
We then quantified the amount of cell death in the Jurkat cells expressing the recombinant PKD2 proteins. As shown in Fig. 5(A), TCR stimulation induced cell death in a relatively small number of uninfected and WT-PKD2-GFP-expressing Jurkat cells. On the other hand, >70% of the CA-PKD2-GFP-expressing Jurkat cells died within 2 days.


Figure 5
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5 CA-PKD2 expression induced cell death after TCR stimulation. Jurkat cells expressing WT-PKD2-GFP and CA-PKD2-GFP together with uninfected Jurkat cells were stimulated with anti-CD3 mAb. (A) After stimulation at the indicated time, cells were recovered, stained with propidium iodide and subjected to FACS analyses to estimate the proportion of the dead cells. Open and closed symbols represent the percentages of dead cells in the unstimulated or anti-CD3 mAb-stimulated cells, respectively. (B and C) The cells stimulated with anti-CD3 mAb for 24 h (light gray and black columns) or left unstimulated (white and dark gray columns) were treated with the inhibitors (dark gray and black columns) or untreated (white and light gray columns); pan-caspase inhibitor FMK (25 µM) (B), PKD inhibitor Gö6976 (3 µM) (C). (D) CA-PKD2-GFP-expressing and empty vector-infected (none) Jurkat cells transfected with IL-2 promoter-driven GFP gene were stimulated and treated with FMK (25 µM) as in (B). The proteins in the cell lysate were subjected to western blot analyses using anti-GFP antibody. Anti-ß-actin mAb was used to confirm equal protein loading.

 
The cell death induced by CA-PKD2-GFP expression and TCR stimulation was markedly suppressed by the pre-treatment and continuous presence of the pan-caspase inhibitor FMK (Fig. 5B) and the PKD2 inhibitor Gö6976 (Fig. 5C). These observations suggested that the high expression of PKD2 activity in T cells induced caspase-dependent cell death. We then examined the IL-2 promoter-driven GFP production in CA-PKD2-expressing cells in the presence of FMK (Fig. 5D). The GFP production was slightly recovered by the FMK treatment in cells expressing CA-PKD2 compared with that of the untreated cells upon TCR stimulation. However, in spite of the presence of high PKD2 activity, the amount of GFP produced in FMK-treated cells expressing CA-PKD2 was still lower than that of the mock-infected cells (Fig. 5D), suggesting that CA-PKD2 may suppress IL-2 promoter activation through so far unknown mechanisms.

Expression of KD mutant of PKD2 and treatment with PKD2 inhibitor suppressed TCR-stimulated IL-2 promoter activation
We introduced KD mutant of PKD2-GFP into cells transfected with IL-2 promoter-driven GFP gene intending to suppress the endogenous PKD2 activity. For this purpose, the lentiviral vector harboring EF-1{alpha} promoter-driven KD-PKD2-GFP gene was used since a detectable amount of KD-PKD2-GFP by western blot analyses was expressed in the resting cells. This seemed to be advantageous to suppress initiation of endogenous PKD2 activation induced by the TCR stimulation. However, since the expression level of EF-1{alpha} promoter-driven KD-PKD2-GFP was relatively low compared with that of the endogenous PKD2, we infected the viruses three times to increase the expression of the KD mutant. While the IL-2 promoter-driven GFP production was up-regulated in cells expressing CMV promoter-driven WT-PKD2-GFP after TCR stimulation, the amount of produced GFP was slightly decreased (P < 0.001) in KD-PKD2-GFP-expressing cells compared with that of the empty EF-1{alpha} vector-infected mock cells (Fig. 6A and B). Furthermore, the PKD2-effective inhibitor Gö6976 more efficiently inhibited the GFP production after TCR stimulation than Gö6983 did, which has no inhibitory effect on PKD (20, Fig. 6C). Collectively, the data supported the involvement of PKD2 in TCR-stimulated activation of the IL-2 promoter.

WT-PKD2 translocated from cytoplasm into the nucleus after TCR stimulation
To investigate the cellular localization of PKD2 in resting state and upon TCR stimulation, we observed the GFP fluorescence in the WT-PKD2-GFP- and CA-PKD2-GFP-infected Jurkat cells using a confocal microscope. The endogenous PKD2 localized mainly in cytoplasm as evidenced by the observation using Jurkat cells fixed with 2% PFA and stained with anti-PKCµ antibody D-20 followed by FITC-labeled anti-rabbit IgG antibody (Fig. 7B). As shown in Fig. 7(D), WT-PKD2-GFP was mainly present in cytoplasm and were excluded from nuclei, similar to the localization of the endogenous PKD2. Upon TCR stimulation, a fraction of WT-PKD2-GFP translocated into the nuclei (Fig. 7F). On the other hand, CA-PKD2-GFP was homogeneously present in the unstimulated cells and the staining pattern did not change much upon TCR stimulation (Fig. 7E and G). Free GFP did not show specific localization and was uniformly present in the cell (Fig. 7C).

Phosphorylated SET was increased in CA-PKD2-expressing cells after TCR stimulation
To search for the possible substrates for PKD2, we compared 2D-gel profiles of phosphoproteins between TCR-stimulated Jurkat cells expressing CA-PKD2-GFP and TCR-stimulated parental Jurkat cells. As shown in Fig. 8(A), there were some protein spots observed in CA-PKD2-GFP-expressing cells which were hardly detectable in the preparation from parental Jurkat cells. The spots were excised, in-gel digested and analyzed using a mass spectrometer and one of the major spots was identified as SET protein. This protein is a nuclear phosphoprotein and is known to be an inhibitor for histone acetyltransferases (21) and protein phosphatase 2A (PP2A) (22).


Figure 8
View larger version (67K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 8 Nuclear phosphoprotein SET is an in vitro substrate for PKD2. (A) Phosphoprotein profiles of CA-PKD2-GFP expressing or parental Jurkat cells stimulated with anti-CD3 antibodies were analyzed by 2D-PAGE. The phosphoproteins up-regulated by the expression of CA-PKD2-GFP and TCR stimulation were identified to be SET using mass spectrometry. Data are representative of two independent and reproducible experiments. (B) To confirm that SET was a direct substrate of PKD2, CA-PKD2-GFP or {Delta}PH-KD-PKD2-GFP were immunoprecipitated and were subjected to the in vitro kinase assay using recombinant SET proteins as substrates. Both {alpha} and ß forms of 6x His-tagged recombinant SET were phosphorylated only by CA-PKD2 and the phosphorylation was inhibited in the presence of 3 µM of Gö6976 (76) but not Gö6983 (83) (B). The data showed that SET was directly phosphorylated by PKD2 in vitro.

 
Recombinant SET was prepared and subjected to in vitro kinase assay using immunoprecipitated CA-PKD2-GFP and its KD mutant ({Delta}PH-KD-PKD2-GFP) as a control. This KD mutant had no PH domain like CA-PKD2-GFP and had three mutations (Lys580 to Asn, Ser706 and Ser710 to Ala) to inactivate kinase activity. {Delta}PH-KD-PKD2-GFP did not have the kinase activity as evidenced by the lack of the autophosphorylation activity (Fig. 8B). Both alternatively spliced {alpha} and ß forms of recombinant SET were phosphorylated only with CA-PKD2 and this phosphorylation was inhibited with Gö6976 but not with Gö6983 (Fig. 8B). The 6x His tag portion was confirmed not to be the phosphorylation site since a control protein that had no Ser and Thr residues fused to the 6x His tag was not phosphorylated by CA-PKD2 (data not shown). The data suggested that SET was the substrate of PKD2 at least in vitro.


   Discussion
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
References
 
The present study demonstrates that the major molecular species of PKD family protein kinases expressed in human peripheral T cells, mouse thymocytes and spleen cells is PKD2 but not PKCµ/PKD1. Introduction of WT-PKD2 up-regulated IL-2 promoter activity upon TCR stimulation, while CA-PKD2 expression induced cell death. Upon TCR stimulation, a fraction of PKD2 translocated from cytosol to nucleus and phospho-nuclear protein SET was increased in Jurkat cells expressing CA-PKD2 after TCR stimulation. Finally, in accordance with our previous report, PKD2 was activated by TCR stimulation in a ZAP-70-independent manner.

PKD1, also known as PKCµ, was first cloned in 1994 from both mouse and human cells (1, 23). Although many researchers investigated the role of PKCµ/PKD1 in T cells and thymocytes, we failed to amplify PKD1/PKCµ cDNA from human leukemic T cell line Jurkat, human T cell clone T5-32, human peripheral T cells from healthy donors or mouse thymocytes and spleen cells by RT–PCR methods. Instead, the PCR primer sets for PKD2 amplified the expected size of cDNA bands by RT–PCR using total RNAs prepared from the above cells and the sequencing of amplified cDNA confirmed that they were all expected part of PKD2 sequence. Mass-spectrometric analyses also confirmed that the tryptic peptides recovered from a major protein band corresponding to the molecular weight of PKD1 (~100 kDa) present in the anti-PKCµ antibody immunoprecipitates from Jurkat cell lysate were derived from PKD2, except for contaminating myosin light-chain 1C and porcine trypsin. The other PKD family member, PKD3 (PKC{nu}), was not detected by the first round of RT–PCR using total RNA from Jurkat cells, the human T cell clone T5-32, mouse thymocytes and spleen cells. Therefore, we concluded that the major PKD family kinase member expressed in both human and mouse T cells is PKD2.

One reason for the confusion of the presence of PKD1 or PKCµ in T cells might be due to the cross-reactivity of the anti-PKCµ D-20 antibody to PKD2 as revealed by the western blot analysis using recombinant PKD1/PKCµ and PKD2. We failed to express enough amount of recombinant PKD3 and, therefore, could not examine the cross-reactivity of the D-20 antibody to PKD3 so far. Re-examination of the presence or absence of PKD1/PKCµ in a certain cell might be necessary if the reactivity of anti-PKCµ antibodies is the only basis for the identification of PKD1 in the cell in previous reports.

The human T cell clone T5-32 recognizes a streptococcal peptide (NRDLEQAYNELSGEA) in the context of HLA–DR4 to secrete IFN-{gamma}, IL-4 and IL-2 and to proliferate (11, 12, 14). We found that an over-expressed analogue peptide Q59G (NRDLEGAYNELSGEA)/HLA–DR4 complex also induced strong proliferation and the cytokine secretion in the T5-32 cells without activating ZAP-70 (11, 12). Since a PKD inhibitor Gö6976 efficiently suppressed those T cell responses described above, we expected that PKD2 was involved in this T cell activation pathway which might be independent of ZAP-70 activation. The data shown in Fig. 3 clearly demonstrate that PKD2 is activated by TCR stimulation not only in WT Jurkat cells but also in ZAP-70-deficient P116 cells, indicating that at least a fraction of PKD2 was activated by TCR stimulation in a ZAP-70-independent manner.

Almost 100% of the Jurkat cells infected with the lentiviruses expressed each recombinant PKD2 as evidenced by the observation using a fluorescent microscope and by FACS analyses (data not shown). The GFP-tagged recombinant PKD2s incorporated radioactive phosphate by autophosphorylation and phosphorylated exogenously added surrogate substrate MBP (data not shown), showing that the kinase activities of those GFP-tagged fusion PKD2s were intact. Moreover, deletion of the PH domain made the kinase constitutively active as reported (15, 16). Thus, the expressed recombinant PKD2 worked well as expected. However, those recombinant kinases were up-regulated when CMV promoter was used for expression after TCR stimulation. Therefore, we could not distinguish the following possibilities. (i) Both TCR stimulation and PKD2 activity were necessary for the induction of the observed T cell responses such as the IL-2 promoter activation and the cell death or (ii) the TCR stimulation was necessary only for the induction of a large amount of PKD2 expression. Thus, careful attention must be required to interpret the results. Being aware of the fact, this CMV promoter-driven lentiviral expression system provides us a convenient tool to investigate effects of an over-expressed molecule. The observed up-regulation of the promoter activity seemed to be in part due to the presence of the binding sites for the transcription factors such as NF-{kappa}B and AP-1 in CMV promoter, which are activated by the TCR stimulation. Accordingly, the lack of the binding sites for those transcription factors in EF-1{alpha} promoter may explain the fact that EF-1{alpha} promoter-driven recombinant PKD2 proteins were not up-regulated upon TCR stimulation.

As far as the WT-PKD2 was expressed, IL-2 promoter activity was enhanced after TCR stimulation in WT-PKD2 dose-dependent manner indicating the involvement of PKD2 in TCR-stimulated IL-2 promoter activation. In accordance with this, over-expression of KD-PKD2-GFP in Jurkat cells introduced with IL-2 promoter-driven GFP gene cells slightly suppressed the activation of the IL-2 promoter. On the other hand, TCR stimulation increased cell death in CA-PKD2-GFP-expressing cells and did not enhance IL-2 promoter-driven GFP production. FMK treatment slightly recovered the GFP production compared with that of the untreated CA-PKD2-GFP-expressing cells, and this was most likely due to the increased recovery of GFP-producing live cells. However, the amount of GFP produced in FMK-treated cells expressing CA-PKD2-GFP was lower than that of the mock-infected cells, suggesting that the high PKD2 activity may actively suppress IL-2 promoter activation.

In many cell types, including lymphocyte, mast cells, fibroblasts and epithelial cells, PKD1 and PKD2 were present predominantly in the cytosol and were excluded from the nuclei. However, after cell-specific stimulation, the behavior of the PKD molecules has been complicated: In bombesin-stimulated Swiss3T3 cells and Madin-Darby canine kidney (MDCK) cells, PKD1 transiently moved to the plasma membrane, returned to the cytosol and accumulated in the nucleus (24). H2O2 treatment of Swiss3T3 cells also induced nuclear accumulation of PKD1 (25), while in antigen receptor-stimulated A20 B cells and Fc{epsilon}R-stimulated RBL 2H3 mast cells, PKD1 translocated to the plasma membrane (26). As for PKD2, it seems to be contradictory: In pnac-1 pancreatic carcinoma cells, the neurotensin stimulation induced translocation of PKD2 to the plasma membrane but not the accumulation in the nucleus (27). On the other hand, in gastrin-stimulated AGS-B epithelial tumor cells, PKD2 accumulated in the nucleus (16), which was a similar observation to our TCR-stimulated Jurkat cells. However, contrary to our Jurkat system, deletion of the PH domain itself did not cause nuclear accumulation in AGS-B cells. The authors concluded that the PH domain of PKD2 does not contain nuclear export signal and identified functional nuclear export signal in the C1a domain of PKD2 (16, 28). One explanation for the discrepancy might be that the nuclear export signal in the C1a domain is masked by the PH domain in Jurkat cells. PKD3 was reported to distribute in both cytosol and nucleus in panc-1, MDCK and COS cells (29). Altogether, the cellular distribution of the PKD family kinases seemed to be differential depending on the types of cells and stimulation.

Recently, it has been shown that histone deacetylases (HDACs) are the target molecules of PKDs (30–33). Recruitment of HDACs by a transcription factor closes the chromatin structure and down-regulate the promoter activity (34). MEF2D is a transcription factor that regulates expression of pro-apoptotic protein Nur77 and association of HDAC7 with MEF2D suppresses Nur77 expression. Phosphorylation of HDAC7 by PKD excludes HDAC7 from the nuclei, resulting in the Nur77 expression and induces apoptosis (31, 32). According to those findings, active PKD should be present in the nucleus (31) and our data coincided with the scenario since WT-PKD2-GFP translocated into nucleus upon TCR stimulation and CA-PKD2-GFP was already present in the nucleus in the unstimulated cells. The data may explain the enhanced cell death by the expression of CA-PKD2 in the nucleus after TCR stimulation. Actually, RT–PCR analysis revealed that the expression level of Nur77 mRNA in CA-PKD2-expressing Jurkat cells was higher than that of the mock-infected Jurkat cells after TCR stimulation (data not shown).

SET has been reported to inhibit histone acetyltransferases (21) and might be involved in chromatin condensation and transcription like HDACs (35). SET is also known as a potent inhibitor of PP2A (22), the activity of which suppresses cell growth and enhances apoptosis (36). In T cells, PP2A associates with CD28 and CTLA-4 and inhibition of PP2A resulted in IL-2 production (34). PP2A also dephosphorylates cAMP response element-binding protein to suppress IL-2 production (37). In the present study, we showed that SET is a candidate substrate for PKD2 and phosphorylated SET was up-regulated in TCR-stimulated CA-PKD2-GFP-expressing Jurkat cells. The biological significance of SET phosphorylation is so far unclear; however, depending on the PKD2 activity, the level of SET phosphorylation might vary and result in different outcomes such as IL-2 promoter activation or suppression and induction of cell death.

In conclusion, our study provides a renewing insight into the subset of PKD family kinase activated in the TCR-stimulated T cells. Depending on doses of PKD2 kinase activity, PKD2 may contribute regulation of IL-2 promoter activity and cell death upon TCR stimulation.


   Acknowledgements
 
We are grateful to H. Miyoshi and V. Boussiotis for donating us the vectors for lentiviral gene expression and IL-2-luc plasmid, respectively. This work was supported in part by Grants-in-Aid 12051203, 14370115 and 15510165 from the Ministry of Education, Science, Technology, Sports, and Culture, Japan.


   Abbreviations
 
CA, constitutively active
DHB, 2,5-dihydroxybenzoic acid
DTT, dithiothreitol
EF-1{alpha}, elongation factor-1{alpha}
GFP, green fluorescent protein
GST, glutathione S-transferase
HDAC, histone deacetylase
IPG, immobilized pH gradient
KD, kinase dead
MALDI, matrix-assisted laser desorption ionization
MDCK, Madin-Darby canine kidney
PH, pleckstrin homology
PKD, protein kinase D
PP2A, protein phosphatase 2A
Q, quadrupole
RT, reverse transcription
TFA, trifluoroacetic acid
TOF, time of flight
WT, wild type
ZAP-70, zeta-associated protein-70

   Notes
 
Transmitting editor: T. Saito

Received 8 May 2006, accepted 19 September 2006.


   References
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Johannes FJ, Prestle J, Eis S, Oberhagemann P, Pfizenmaier K. (1994) PKCµ is a novel, atypical member of the protein kinase C family. J. Biol. Chem. 269:6140.[Abstract/Free Full Text]
  2. Hayashi A, Seki N, Hattori A, Kozuma S, Saito T. (1999) PKC{nu}, a new member of the protein kinase C family, composes a fourth subfamily with PKCµ. Biochim. Biophys. Acta. 1450:99.[Medline]
  3. Sturany S, Van Lint J, Muller F, et al. (2001) Molecular cloning and characterization of the human protein kinase D2. A novel member of the protein kinase D family of serine threonine kinases. J. Biol. Chem. 276:3310.[Abstract/Free Full Text]
  4. Rozengurt E, Rey O, Waldron RT. (2005) Protein kinase D signaling. J. Biol. Chem. 280:13205.[Free Full Text]
  5. Sidorenko SP, Law CL, Klaus SJ, et al. (1996) Protein kinase Cµ (PKCµ) associates with the B cell antigen receptor complex and regulates lymphocyte signaling. Immunity 5:353.[CrossRef][Web of Science][Medline]
  6. Matthews S, Iglesias T, Cantrell D, Rozengurt E. (1999) Dynamic re-distribution of protein kinase D (PKD) as revealed by a GFP-PKD fusion protein: dissociation from PKD activation. FEBS Lett. 457:515.[CrossRef][Web of Science][Medline]
  7. Matthews SA, Rozengurt E, Cantrell D. (2000) Protein kinase D. A selective target for antigen receptors and a downstream target for protein kinase C in lymphocytes. J. Exp. Med. 191:2075.[Abstract/Free Full Text]
  8. Marklund U, Lightfoot K, Cantrell D. (2003) Intracellular location and cell context-dependent function of protein kinase D. Immunity 19:491.[CrossRef][Web of Science][Medline]
  9. Haxhinasto SA and Bishop GA. (2003) A novel interaction between protein kinase D and TNF receptor-associated factor molecules regulates B cell receptor-CD40 synergy. J. Immunol. 171:4655.[Abstract/Free Full Text]
  10. Haxhinasto SA and Bishop GA. (2004) Synergistic B cell activation by CD40 and the B cell antigen receptor: role of B lymphocyte antigen receptor-mediated kinase activation and tumor necrosis factor receptor-associated factor regulation. J. Biol. Chem. 279:2575.[Abstract/Free Full Text]
  11. Irie A, Chen YZ, Tsukamoto H, Jotsuka T, Masuda M, Nishimura Y. (2003) Unique T cell proliferation associated with PKCµ activation and impaired ZAP-70 phosphorylation in recognition of overexpressed HLA/partially agonistic peptide complexes. Eur. J. Immunol. 33:1497.[CrossRef][Web of Science][Medline]
  12. Kim JR, Irie A, Tsukamoto H, Nishimura Y. (2006) A role of kinase inactive ZAP-70 in altered peptide ligand stimulated T cell activation. Biochem. Biophys. Res. Commun. 341:19.[CrossRef][Web of Science][Medline]
  13. Tsukamoto H, Irie A, Chen YZ, Takeshita K, Kim JR, Nishimura Y. (2006) TCR ligand avidity determines the mode of B-Raf/Raf-1/ERK activation leading to the activation of human CD4(+) T cell clone. Eur. J. Immunol. 36:1926.[CrossRef][Web of Science][Medline]
  14. Chen YZ, Matsushita S, Nishimura Y. (1996) Response of a human T cell clone to a large panel of altered peptide ligands carrying single residue substitutions in an antigenic peptide: characterization and frequencies of TCR agonism and TCR antagonism with or without partial activation. J. Immunol. 157:3783.[Abstract]
  15. Iglesias T and Rozengurt E. (1998) Protein kinase D activation by mutations within its pleckstrin homology domain. J. Biol. Chem. 273:410.[Abstract/Free Full Text]
  16. Auer A, von Blume J, Sturany S, et al. (2005) Role of the regulatory domain of protein kinase D2 in phorbol ester binding, catalytic activity, and nucleocytoplasmic shuttling. Mol. Biol. Cell. 16:4375.[Abstract/Free Full Text]
  17. Miyoshi H, Blomer U, Takahashi M, Gage FH, Verma IM. (1998) Development of a self-inactivating lentivirus vector. J. Virol. 72:8150.[Abstract/Free Full Text]
  18. Tzachanis D, Freeman GJ, Hirano N, et al. (2001) Tob is a negative regulator of activation that is expressed in anergic and quiescent T cells. Nat. Immunol. 2:1174.[CrossRef][Web of Science][Medline]
  19. Tahara-Hanaoka S, Sudo K, Ema H, Miyoshi H, Nakauchi H. (2002) Lentiviral vector-mediated transduction of murine CD34(-) hematopoietic stem cells. Exp. Hematol. 30:11.[CrossRef][Web of Science][Medline]
  20. Gschwendt M, Dieterich S, Rennecke J, Kittstein W, Mueller HJ, Johannes FJ. (1996) Inhibition of protein kinase Cµ by various inhibitors. Differentiation from protein kinase C isoenzymes. FEBS Lett. 392:77.[CrossRef][Web of Science][Medline]
  21. Seo SB, McNamara P, Heo S, Turner A, Lane WS, Chakravarti D. (2001) Regulation of histone acetylation and transcription by INHAT, a human cellular complex containing the set oncoprotein. Cell 104:119.[CrossRef][Web of Science][Medline]
  22. Li M, Makkinje A, Damuni Z. (1996) The myeloid leukemia-associated protein SET is a potent inhibitor of protein phosphatase 2A. J. Biol. Chem. 271:11059.[Abstract/Free Full Text]
  23. Valverde AM, Sinnett-Smith J, Van Lint J, Rozengurt E. (1994) Molecular cloning and characterization of protein kinase D: a target for diacylglycerol and phorbol esters with a distinctive catalytic domain. Proc. Natl Acad. Sci. USA 91:8572.[Abstract/Free Full Text]
  24. Rey O, Young SH, Cantrell D, Rozengurt E. (2001) Rapid protein kinase D translocation in response to G protein-coupled receptor activation. Dependence on protein kinase C. J. Biol. Chem. 276:32616.[Abstract/Free Full Text]
  25. Waldron RT, Rey O, Zhukova E, Rozengurt E. (2004) Oxidative stress induces protein kinase C-mediated activation loop phosphorylation and nuclear redistribution of protein kinase D. J. Biol. Chem. 279:27482.[Abstract/Free Full Text]
  26. Matthews SA, Iglesias T, Rozengurt E, Cantrell D. (2000) Spatial and temporal regulation of protein kinase D (PKD). EMBO J. 19:2935.[CrossRef][Web of Science][Medline]
  27. Rey O, Yuan J, Rozengurt E. (2003) Intracellular redistribution of protein kinase D2 in response to G-protein-coupled receptor agonists. Biochem. Biophys. Res. Commun. 302:817.[CrossRef][Web of Science][Medline]
  28. Rey O, Sinnett-Smith J, Zhukova E, Rozengurt E. (2001) Regulated nucleocytoplasmic transport of protein kinase D in response to G protein-coupled receptor activation. J. Biol. Chem. 276:49228.[Abstract/Free Full Text]
  29. Rey O, Yuan J, Young SH, Rozengurt E. (2003) Protein kinase C {nu}/protein kinase D3 nuclear localization, catalytic activation, and intracellular redistribution in response to G protein-coupled receptor agonists. J. Biol. Chem. 278:23773.[Abstract/Free Full Text]
  30. Vega RB, Harrison BC, Meadows E, et al. (2004) Protein kinases C and D mediate agonist-dependent cardiac hypertrophy through nuclear export of histone deacetylase 5. Mol. Cell. Biol. 24:8374.[Abstract/Free Full Text]
  31. Parra M, Kasler H, McKinsey TA, Olson EN, Verdin E. (2005) Protein kinase D1 phosphorylates HDAC7 and induces its nuclear export after T-cell receptor activation. J. Biol. Chem. 280:13762.[Abstract/Free Full Text]
  32. Dequiedt F, Van Lint J, Lecomte E, et al. (2005) Phosphorylation of histone deacetylase 7 by protein kinase D mediates T cell receptor-induced Nur77 expression and apoptosis. J. Exp. Med. 201:793.[Abstract/Free Full Text]
  33. Matthews SA, Liu P, Spitaler M, et al. (2006) Essential role for protein kinase D family kinases in the regulation of class II histone deacetylases in B lymphocytes. Mol. Cell. Biol. 26:1569.[Abstract/Free Full Text]
  34. Chuang E, Fisher TS, Morgan RW, et al. (2000) The CD28 and CTLA-4 receptors associate with the serine/threonine phosphatase PP2A. Immunity 13:313.[CrossRef][Web of Science][Medline]
  35. Kuo MH and Allis CD. (1998) Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays 20:615.[CrossRef][Web of Science][Medline]
  36. Neviani P, Santhanam R, Trotta R, et al. (2005) The tumor suppressor PP2A is functionally inactivated in blast crisis CML through the inhibitory activity of the BCR/ABL-regulated SET protein. Cancer Cells 8:355.
  37. Katsiari CG, Kyttaris VC, Juang YT, Tsokos GC. (2005) Protein phosphatase 2A is a negative regulator of IL-2 production in patients with systemic lupus erythematosus. J. Clin. Invest. 115:3193.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
18/12/1737    most recent
dxl108v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Irie, A.
Right arrow Articles by Nishimura, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Irie, A.
Right arrow Articles by Nishimura, Y.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?