International Immunology Advance Access originally published online on November 15, 2005
International Immunology 2006 18(1):89-100; doi:10.1093/intimm/dxh352
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Multiple synergizing factors contribute to the strength of the CD8+ T cell response against listeriolysin O
1 Molecular Immunology, Department of Cell Biology and Immunology, German Research Centre for Biotechnology, Mascheroder Weg 1, D-38124 Braunschweig, Germany
2 Department of Immunology, Institute for Cell Biology, University of Tübingen, Tübingen, Germany
3 Department of Immunology, Weizmann Institute for Science, Rehovot, Israel
4 Institute for Medical Microbiology, University of Giessen, Giessen, Germany
5 Institute for Immunology, University of Mainz, Mainz, Germany
Correspondence to: D. Bruder; E-mail: dbr{at}gbf.de
| Abstract |
|---|
|
|
|---|
Immunodominance in CD8+ T cell responses against Listeria monocytogenes is a well-recognized but still not fully understood phenomenon. From listeriolysin, the major virulence factor of L. monocytogenes, only a single epitope, pLLO91-99, is presented by MHC class I molecules in BALB/c mice which dominates the cytotoxic T cell response against this bacterial pathogen. To obtain more insights into the molecular and cellular mechanisms underlying immunodominance of this particular epitope, we compared the various steps involved in the presentation and recognition of pLLO91-99 derived from a wild-type toxin with an equivalent epitope from a mutated toxin. This fully functional variant contains within the pLLO91-99 epitope a conservative isoleucine to alanine replacement at the C-terminal anchor residue which results in loss of antigenicity. The binding properties of the variant peptide to soluble Kd remained unaffected and cytotoxic T cells capable of recognizing the pLLO99A/Kd complex were detectable in BALB/c mice. However, such T cells required higher concentrations of antigen in order to be optimally activated in vitro. A comparison between the TAP translocation efficiency of wild-type and mutant peptide demonstrated that the mutation at the C-terminus leads to a reduced transportation rate. Furthermore, the amino acid substitution changes the in vitro proteasomal cleavage pattern, resulting in a reduced liberation of the correct peptide from a polypeptide precursor. Thus, in all assays employed the immunodominant epitope performs optimally while the variant was found to be inferior. The synergy of all these steps most likely is the decisive factor in the immunodominance of pLLO91-99.
Keywords: antigen presentation/processing, cytotoxic T cells, epitopes, MHC class I
| Introduction |
|---|
|
|
|---|
The immune response against microbial pathogens comprises T cells that are reactive against a broad range of various antigenic peptides. Nevertheless, the strength of the T cell response towards particular epitopes of such pathogens exhibits a remarkable constant hierarchy, i.e. the majority of the T cells are directed against a few immunodominant epitopes only (14). This hierarchy can be accomplished at various levels (5, and extensively reviewed in 6). For instance, peptides with high affinity towards the MHC molecule could compete more successfully for the binding site of the MHC molecule than low-affinity peptides. Alternatively, the T cell response could be influenced by previous encounter with cross-reactive epitopes from other pathogens. This could favor reactivity against one particular determinant. On the other hand, T cells could be tolerant against potential epitopes or the T cell repertoire might lack high-affinity receptors against subdominant or unrecognized epitopes. However, the most decisive factor imparting immunodominance is most likely how the antigen-presenting cell (APC) is handling the antigen during the multiple steps of processing and presentation.
Cytolytic CD8+ T cells (CTL) play an important role in the immune defense against Listeria monocytogenes, a gram-positive bacterium that enters the cytosol of host cells (7, 8). When BALB/c mice are infected with L. monocytogenes, CD8+ T cells specific for only a limited number of pathogen-derived peptides are induced (4, 911). The most dominant of these epitopes is derived from the secreted bacterial toxin, listeriolysin O (LLO), the major virulence factor of the pathogen. Although a few additional potential epitopes are found within this protein, only one, consisting of amino acid (aa) 9199 (pLLO91-99), is activating cytotoxic T cells (12).
Interestingly, a quantitative investigation of APCs infected by L. monocytogenes revealed that pLLO91-99 is found at very low abundance when compared with two epitopes of another listerial secretory protein p60. Only 700 pLLO91-99/Kd complexes could be recovered (13). This is in accordance with the finding that listeriolysin secretion is drastically down-regulated intracellularly. In addition, the presence of a PEST motif subjects listeriolysin to rapid degradation by proteasomes (14). Nevertheless, even though the toxin is practically undetectable in infected cells, already the primary CD8+ T cell response is mainly directed towards pLLO91-99 (13).
We have shown previously that purified listeriolysin due to its pore-forming activity enters the cytosol of APCs and thereby is accessible to the MHC class I-processing and presentation pathways (15, 16). Thus, a simple experimental way exists to test physiological parameters of presentation of pLLO91-99 that might be responsible for its immunodominance. In this context, we first replaced the H-2Kd anchor residue isoleucine at position 99 in the peptide pLLO91-99 by alanine. The replacement did not change the affinity of the peptide towards isolated Kd molecules. We subsequently introduced this mutation into the listeriolysin gene. The variant toxin LLO99A maintained the pore-forming property required for targeting the cytosol of APCs. However, although binding of the epitope to the MHC class I molecule remained unaffected, the variant toxin lost its ability to stimulate listeriolysin-specific CD8+ T cells. This prompted us to dissect and analyze the molecular and cellular basis of the immunodominance of wild-type pLLO91-99.
| Methods |
|---|
|
|
|---|
Mice
Female BALB/c mice 68 week of age were obtained from Harlan Winkelman (Borchen, Germany). All experiments performed with mice have been reviewed and approved by an official review committee.
Cell lines, bacterial strains and antigens
The mastocytoma cell line P815 (H-2d) and the macrophage-like cell line J774 (H-2d) were used as target cells in cytotoxic T cell assays. To test for the TAP dependency of LLO-derived peptide presentation, T2Kd and T2KdTAP1/2 cells were used (17) (kindly provided by Frank Momburg, German Cancer Research Center, Heidelberg) as targets. T2Kd and T2KdTAP1/2 are derivatives of T2 transfected with TAP1/2 and/or H-2Kd cDNA. RMA cells originated from a Rauscher virus-induced C57BL/6 T cell lymphoma. RMA-S cells, a subline of RMA, are deficient for TAP and were used in TAP translocation assays.
LLOwt and LLO99A were hyperexpressed in the non-pathogenic bacterium Listeria innocua and purified as described before (18). Nucleoprotein (NP) from influenza virus A/Loi/4/57 was expressed in baculovirus and purified from infected Sf9 cells by chromatography over Sephacryl S-100 HR (16).
Peptide synthesis and fluorescence peptide-binding assay
Peptides were synthesized using the standard F-moc chemistry and purified by reversed-phase HPLC prior to use. Peptide affinities to soluble H-2Kd was measured based on the non-radioactive energy transfer to dansylated (DNS) peptides as described before (18). Peptide equilibrium dissociation constants were calculated as the ratio of koff to kon constants of peptide dissociation/binding from/to H-2Kd heavy-chain/ß2m heterodimer. As was described earlier, the rate constant of peptide binding to the heavy-chain/ß2m heterodimer does not depend on the particular peptide sequence (1921) and was taken to be the same as for TYQRC(Dansyl)RALV (19). Peptide dissociation kinetics from the ternary complex was initiated by the addition of 100-fold excess of the DNS peptide TYQRC(Dansyl)RALV to the heavy-chain/ß2m heterodimer pre-incubated for 2 h at room temperature with a peptide of the LLO series. Experiments were carried out in a 4 x 4-mm magnetically stirred, quartz optical cuvette. The fluorescence energy transfer from the heavy-chain tryptophans to the peptide dansyl group was monitored at 530 nm upon excitation at 290 nm.
PCR mutagenesis and plasmid construction
The introduction of the point mutation leading to the aa substitution Ile99 to Ala within the LLO-encoding gene hly and the subsequent cloning of the mutagenesis PCR products were performed as previously described (18). Point mutation was introduced by the internal mutagenesis primers 5'-285AATGAATATGCTGTTGTGGAG305-3' and 5'-305CTCCACAACAGCATATTCATT285-3'. The final Listeria expression plasmid harboring the mutated hly gene and the positive regulatory factor prfA were used to transform L. innocua to hyperexpress and purify the LLO99A as described before (18). Alternatively, a
hly strain of L. monocytogenes EGD was transformed with the plasmid. The resulting strain L. monocytogenes
hlyLLO99A was used for in vitro infection and presentation assays.
Hemolysin titer test
To assess hemolytic activity, purified LLOwt and LLO99A were incubated with 10 mM dithiothreitol prior to use. Sheep erythrocytes were washed three times in PBS adjusted to pH 5.7 and seeded in V-bottom microtiter plates. Graded amounts of LLOwt and LLO99A were added and after a 1-h incubation at 37°C supernatants were collected and OD414 was measured. Hemolytic units (HU) were determined as the protein concentration required to release 50% hemoglobin from sheep erythrocytes. Hundred percent lysis was obtained by incubation with de-ionized water.
Generation of dendritic cells
Bone marrow macrophages were isolated from BALB/c mice and incubated overnight in the presence of IL-4 and granulocyte macrophage colony-stimulating factor (GM-CSF). Non-adherent cells were removed and adherent cells were cultured for further 68 days in IL-4- and GM-CSF-containing medium to stimulate maturation into dendritic cells (DCs).
CTL induction and CTL assay
Cytotoxic T cells were generated either by immunization of BALB/c mice with protein in incomplete Freund's adjuvant as described before (18) or with peptide-loaded syngeneic splenocytes or DCs. Splenocytes or DCs were pulsed for 2 h to overnight with 10 µM peptide, washed carefully, re-suspended in PBS and injected into mice (106 DCs or 107 splenocytes per mouse, intravenously). Nine days after immunization, spleen cells were harvested and re-stimulated with the respective peptide for 56 days before being used as effector cells in a cytotoxic assay. Cytotoxicity was measured using the JAM assay as described before (18). When activated J774 cells were used as target cells stimulation with IFN-
was carried out 48 h before the assay. To analyze the TAP dependency of LLOwt presentation, T2.Kd or T2.KdTAP cells were radioactively labeled overnight with 5 µg ml1 [3H]thymidine, then cells were pulsed with LLOwt for 30 min at room temperature, washed and seeded into microtiter plates. As a positive control, pLLO91-99 peptide was added to the target cells. Cytotoxic T cells were added after 2 h to allow sufficient surface presentation to take place. The assay was harvested after an additional 4 h of incubation.
TAP translocation assay
The peptide translocation assay was performed as described (22). Briefly, RMA and RMA-s cells were permeabilized with 2 U ml1 streptolysin O (dissolved in 130 mM KCl, 10 mM NaCl, 1 mM CaCl2, 2 mM EGTA, 2 mM MgCl2, 5 mM HEPES, pH 7.3). Two hundred nanograms of radioiodinated peptide (TNKTRIDGQY) containing an N-glycosylation motif was added to the cells, including 20 mM ATP and graded amounts of competitor peptide. After incubation for 20 min, cells were lysed with 1% NP-40 in PBS containing protease inhibitors. The translocated and glycosylated peptide fraction was isolated on Con Asepharose and quantified by counting the radioactivity. Translocation efficiency was calculated as: counts per minute bound/total counts per minute.
Purification of 20S proteasomes, peptide digests and analysis
Proteasomes were purified from outdated blood as described previously (23). For the digestion of synthetic peptides, typically 1 µg of human 20S proteasomes was incubated with peptide substrates (final concentration of 3040 µM) at 37°C in a total volume of 300 µl assay buffer [20 mM HEPES/KOH (pH 7.8), 2 mM MgAc2]. Aliquots of 100 µl were removed at different time points between 0 and 30 h. The reaction was stopped by the addition of 10 µl 10% acetic acid. Aliquots were de-salted in two alternative ways: peptides were adsorbed to C18 resin [ODS Hypersil (5 µm), Hewlett-Packard] in pipette tips, washed with water and eluted with 50% methanol/1% acetic acid. Alternatively, the aliquot was adsorbed to µRP SC 2.1/10-columns (Pharmacia), washed with buffer A [0.1% trifluoroacetic acid (TFA)] for 10 min and eluted with buffer B (0.081% TFA, 80% acetonitrile). In both cases, the eluate was concentrated under vacuum, re-suspended in 1030 µl of eluent and then used for Edman sequencing or mass spectrometry (MS) analysis. HPLC separation of peptide digests was performed as follows: for the separation of degradation products, unfractionated peptide digests were subjected to µRP SC 2.1/10-columns (Pharmacia) on a Microbore HPLC system (SMART-system, Pharmacia). Gradients of B were 0% B for 5 min, in 40 min to 40% B, in 15 min to 75% B and up to 85% in another 5 min. The flow rate for all separations was 150 µl min1.
Matrix-associated laser desorption ionization analysis
Routinely, 1 µl of DHAP matrix (20 mg 2,5-dihydroxy-acetophenone, 5 mg ammonium citrate in 1 ml 80% isopropanol) was mixed with 1 µl of concentrated de-salted eluate on a gold target. Measurements were performed using a laser desorption time of flight (TOF) system (Hewlett-Packard G2025A) at a vacuum of 106 torr. For signal generation, 50 to 100 laser shots were added up in the single-shot mode. For the fragmentation of degradation products, unfractionated peptide digests, was subjected to µRP SC 2.1/10-columns (Pharmacia) on a Microbore HPLC system (SMART-system, Pharmacia). When dominant masses in matrix-associated laser desorption ionization (MALDI) spectra could not be identified by a fragment search program, MS/MS experiments were performed on a hybrid quadrupole orthogonal acceleration tandem mass spectrometer (Q-TOF, Micromass). Fragmentation of the parent ions was achieved by collision with argon atoms. Q1 was set to the mass of interest ± 0.5 Da and the collision energy was optimized for each fragment. The integration time for the TOF analyzer was 1 s with an inter-scan delay of 0.1 s.
N-terminal sequencing (Edman degradation)
For the identification of degradation products and for the relative quantitation of peptide products, 515 µl of unfractionated digests were applied to a glass fiber disc coated with 0.75 mg of polybrene and sequenced in a pulsed-liquid sequencer Procise model 494A (Applied Biosystems) following standard protocols.
| Results |
|---|
|
|
|---|
Replacement of Ile99 by Ala abolishes recognition by LLOwt-specific CD8+ T cells without affecting peptide binding to H-2Kd
To assess the influence of aa substitutions in the C-terminal anchor residue of the immunodominant listeriolysin epitope pLLO91-99 on peptide binding and T cell stimulatory potential, Ile99 was replaced by selected aa. None of the peptides shown in Table 1 was able to sensitize target cells for cytotoxicity when tested with T cells specific for pLLO91-99. However, binding of these peptides to Kd was not affected as strongly as might have been expected from the cytotoxic assays. In particular, the variant peptide pLLO99A, harboring an Ile99 to Ala99 exchange, was found to bind to H-2Kd molecules with nearly the same affinity as the wild-type peptide, although it was unable to sensitize the target cells.
|
LLO99A efficiently enters the MHC class I-processing compartment without stimulating specific cytotoxic T cells
Using site-directed mutagenesis we introduced the Ile99 to Ala99 replacement into the listeriolysin-encoding gene and purified the protein from culture supernatants of recombinant L. innocua using a previously published procedure (18). As displayed in Fig. 1(A) the specific hemolytic activity of purified LLO99A (2500 HU mg1) was comparable to that of the wild-type toxin (2632 HU mg1).
|
We have shown previously that purified LLOwt by its pore-forming activity enters the cytosol and thereby the MHC class I presentation pathway of APCs (15, 16). Immunization with LLOwt therefore induces pLLO91-99-specific CD8+ T cells. The variant LLO99A, however, was no longer able to induce CTL responses to either the wild-type peptide pLLO91-99 or the mutant peptide pLLO99A (Fig. 1B).
To ascertain that LLO99A still has the capacity to target the cytosol of APCs we made use of the capability of LLO to introduce, in addition to itself, also soluble passenger proteins into the MHC class I-processing compartment (15, 16). Therefore, BALB/c mice were immunized with mixtures of LLO99A and soluble NP from influenza virus. A CD8+ T cell response against the passenger protein NP would indicate successful access of both proteins to the cytosol of the target cells. Indeed, cytotoxic T cells specific for NP were induced under these conditions but not against the LLO99A mutant (Fig. 1B). Even re-stimulation of splenocytes from mice immunized with LLO99A with the corresponding peptide pLLO99A did not result in expansion of pLLO99A-specific cytotoxic T cells as indicated by the absence of specific cytolytic activity (data not shown). Thus, the conservative replacement of Ile by Ala completely abolished CD8+ T cell responses against LLO99A without altering its capacity to enter the cytosol of APCs. Stimulation of CD8+ T cells against subdominant determinants of LLO was not observed under these conditions as shown before using similar mutants (18, 24).
Cytotoxic T cells specific for the peptide pLLO99A can be induced in BALB/c mice but require higher antigen doses to be optimally triggered
The lack of a CD8+ T cell response against LLO99A could be a consequence of the absence of specific T cells in the repertoire of BALB/c mice (5, 6, 25). To test this hypothesis, BALB/c mice were immunized with syngeneic bone marrow-derived DCs pulsed with pLLO99A or pLLO91-99 as positive control. As shown in Fig. 2, immunization with both the pLLO91-99 (Fig. 2A) as well as pLLO99A (Fig. 2B) induced a specific cytotoxic T cell response. In contrast, when mice were immunized with LLOwt or LLO99A protein, only LLOwt induced a specific CTL response (Fig. 2C and D). Interestingly, T cells specific for the epitope pLLO91-99 showed no cross-reactivity with the epitope pLLO99A and vice versa although the peptides differ solely in the C-terminal anchor residue that is not expected to interact with the TCR. Thus, the full-length mutant protein fails to induce CTL response in vivo although cells specific for pLLO99A are present in the T cell repertoire.
|
To explain the non-responsiveness to LLO99A, we examined whether the affinity of specific CD8+ T cells might be lower and would therefore require higher concentrations to be optimally triggered. To analyze this possibility, CD8+ T cells specific for either the pLLO91-99 or the pLLO99A peptide were tested with graded amounts of the respective peptide in cytotoxicity assays. Care was taken to use identical concentrations of peptides during the priming and re-stimulation steps to avoid differential selection of T cells with particular affinities. As shown in Fig. 3, cytotoxic T cells specific for pLLO99A required
10 times more antigenic peptide to be optimally triggered compared with pLLO91-99-specific CD8 T cells. Confirmatory results were obtained when re-stimulation of T cells from mice immunized with pLLO99A was carried out with graded amounts of the particular peptide. No high-affinity T cells could be obtained when low concentrations of pLLO99A were used. In contrast, low concentrations of pLLO91-99 were able to activate specific T cells (data not shown).
|
Taken together, BALB/c mice have the capacity to initiate a cytotoxic T cell response towards pLLO99A. However, the TCR repertoire appears to be comprised of low-affinity receptors only. Moreover, when intracellular processing of the LLO99A is required for peptide presentation, no cytotoxic T cell response is induced.
Increase in antigen dose does not result in presentation of LLO99A
If the observed lack of a pLLO99A-specific CD8+ T cell recognition is exclusively due to a low TCR affinity it should be possible to compensate this by increasing the numbers of stimulatory peptideclass I complexes at the surface of APCs. An increase of the amount of purified LLO99A was not possible due to the toxic effects of the hemolysin. However, cells infected with recombinant L. monocytogenes producing elevated amounts of LLO remain viable and functional. We infected the macrophage-like cell line J774 with recombinant L. monocytogenes
hlyLLO99A. This variant lacks the production of endogenous wild-type LLO but over-produces the recombinant LLO99A because of the presence of the virulence transcriptional regulator PrfA in these bacteria. Since the antigen is continuously over-produced by these bacteria within infected APCs, the number of peptideclass I complexes at the cell surface should be sufficient for triggering even CD8+ T cells with low-affinity TCRs.
While LLOwt secreted by L. monocytogenes EGD was readily presented and recognized by specific CD8+ T cells under these conditions (Fig. 4A), J774 cells infected with L. monocytogenes
hlyLLO99A were not recognized by pLLO99A-specific CD8+ T cells (Fig. 4B). Only target cells pulsed with the peptide pLLO99A were efficiently lysed. Thus, even high intracellular concentrations of LLO99A fail to stimulate pLLO99A-specific T cells when processing of the protein and peptide transport within the APCs are required.
|
IFN-
increases the class I presentation capacity of APCs by influencing the efficiency of TAP transport and the composition of proteasomes (2633). Therefore, we treated J774 cells with this cytokine 48 h before infection with L. monocytogenes
hlyLLO99A. Infected cells were then tested for their capacity to trigger pLLO99A-specific T cell killing. Again, no activity was observed. Only activated J774 target cells pulsed with the pLLO99A were efficiently lysed by pLLO99A-specific cytotoxic T cells (Fig. 4B).
To determine that infection of the J774 cells with L. monocytogenes
hlyLLO99A was indeed efficient and that the infected cells retained their capacity to present antigen, we tested the presentation of the listerial membrane protein ActA as an internal control. Since in short-term assays ActA only becomes available for MHC class I presentation when intracellular bacteria are killed (34), ampicillin was added during these experiments. As shown in Fig. 4(C), target cells infected with L. monocytogenes
hlyLLO99A are lysed to the same extend by ActA-specific cytotoxic T cells as cells infected with wild-type L. monocytogenes EGD. This indicates that both strains infect J774 cells equally well.
In addition, viability of infected J774 cells was demonstrated by these controls since processing and presentation of the ActA protein was unaffected in cells infected with the recombinant strain hyperexpressing LLO99A. Presentation of LLO was not influenced by this treatment (data not shown). Therefore, the observed lack of activation of pLLO99A-specific CD8+ T cells is most probably due to an absence of presentation of the epitope by the APC as well as the low affinity of the specific TCR.
Reduced efficiency of TAP translocation due to the Ile to Ala replacement at the C-terminus of the epitope
Since the TAP transporter displays preferences regarding peptide length (35) and aa composition (21, 36), the aa replacement at the C-terminus of pLLO99A might influence the translocation efficiency of the peptide. In previous experiments we have shown that the presentation of passenger proteins that are introduced into the MHC class I pathway of APCs via the pore-forming activity of LLO is dependent on TAP (15). However, this has not yet been demonstrated for LLO itself. To this end, we incubated TAP-deficient T2.Kd cells with native LLOwt or pLLO91-99 and used these cells as targets in cytotoxicity assays. As indicated in Fig. 5(A) only T2.Kd cells pulsed with the pLLO91-99 were efficiently lysed by LLOwt-specific cytotoxic T cells while T2.Kd cells pulsed with the native protein LLOwt were not capable of stimulating cytotoxic T cells. On the other hand, T2.Kd cells that were reconstituted with a functional TAP presented peptide and protein equally well (Fig. 5B). Thus, the presentation of pLLO91-99 by MHC class I requires TAP-dependent transport from the cytosol to the endoplasmic reticulum (ER).
|
Murine TAP preferentially transports peptides with an aliphatic C-terminus. Hence, the Ile to Ala exchange might result in a decreased translocation rate. This indeed turned out to be the case. In a TAP translocation assay, pLLO99A displayed a 10-fold reduced competitive capacity compared with pLLO91-99 (Fig. 6). This is consistent with a 10-fold lower translocation efficiency of the mutant peptide.
|
Since TAP has been shown to transport N-terminally extended epitope precursors (37, 38), it might also differentially translocate the N-terminally extended precursor of pLLO91-99 in vivo. Therefore, we included pLLO91-99 or pLLO99A peptides N-terminally elongated by 1, 2 or 3 aa of the original sequence in our transport competition assay. In every case, we found wild-type peptides competing more efficiently than the mutant peptides (data not shown).
The Ile to Ala exchange alters the proteasomal cleavage pattern
Although the 10-fold higher concentration requirement of pLLO99A-specific T cells together with the 10-fold lower efficiency of TAP transport of pLLO99A should have a severe effect on the induction of CD8+ T cells against the epitope pLLO99A, it cannot explain the complete absence of this reaction. Since proteasomes are involved in the degradation of listeriolysin (39), it was possible that changing the Ile99 to Ala also altered the proteasomal cleavage pattern. As has been shown previously, changing aa`s either within the epitope or its flanks can strongly influence the cleavage preference of the proteasome (4044). We therefore performed in vitro proteasomal digestion of 24meric petides that contained the pLLO91-99 or pLLO99A epitopes and were extended at the N- and C-termini by aa`s that naturally flank them. The resulting proteolytic fragments were analyzed by MS and Edman degradation.
Reproducibly and as indicated by arrow sizes, the most dominant cleavage sites are located after Gly9, Tyr10, and Asp12 (corresponding to Gly91, Tyr92 and Asp94) in both the pLLO91-99 and pLLO99A peptides (Fig. 7). The only significant difference in the cleavage and fragment patterns generated from the two synthetic peptides is the cleavage after Y16 and the aa at position 17 where the two peptides differ by Ile or Ala. Both cleavage sites are used in both peptides, but to a different degree. In the extended pLLO91-99 peptide, the cleavage after Ile17 dominates over the cleavage after Tyr16. This could be shown by the detection of a strong MALDI signal for fragment 117 present already early in the digest (data not shown). For the extended pLLO99A peptide, however, the situation is exactly the opposite. In MALDI spectra, the fragment 116 dominates clearly over the fragment 117 as quantified by nanospray MS. This is indicated by the thickness of the horizontal bars in Fig. 7. MALDI spectra at 25 h revealed that the fragment 117 dominates the digestion pattern of the extended pLLO91-99 peptide, while the fragments 116 and 117 are found in equal amounts in the digest of the extended pLLO99A peptide (data not shown).
|
The most convincing indication, however, is obtained by Edman sequence analysis of unfractionated digests at 25 h. The fragment 1724 starting with Ala was detectable in large amounts in the digest of the variant peptide while in the digests of the wild-type peptide, no fragment starting with Ile17 could be detected. Only minute amounts of fragment 1724 were found in the digest of wild-type peptide by sensitive MS analysis (data not shown).
Thus, our data strongly suggest that during proteasomal processing of pLLO91-99, generation of the correct C-terminus of the T cell epitope is favored over its proteolysis. The opposite is found for the processing of pLLO99A. This was confirmed by analyzing the cleavage pattern of both peptides in silico (www.mhc-pathway.net). Scores obtained using this software can be interpreted as logarithms of the probability of cleavage site usage; thus, the difference between two scores can be directly translated into a difference of amounts. Consistent with our in vitro data, the constitutive proteasome is predicted to cleave LLOwt between Tyr16 and Ile17 less efficiently than LLO99A between Tyr16 and Ala17 (estimated score 1.4 for LLOwt compared with 1.6 for LLO99A), thus destroying the epitope to a certain extend. Importantly, the immunoproteasome as will be found in activated J774 cells is predicted to even more efficiently cleave LLO99A between Tyr16 and Ala17 (estimated score 1.95 compared with 1.5 for LLOwt), i.e. the epitope pLLO99A is predicted to be destroyed to an even larger degree by the immunoproteasome than by the constitutive proteasome. Immunoproteasomes are probably the type of proteasomes present in our J774 subline, since untreated cells already constitutively express low amounts of MHC class II, a marker for activation. In conclusion, the proteasome-dependent part of LLO processing favors the generation of the pLLO91-99 epitope, whereas the pLLO99A is destroyed to a large extent by proteasomal processing.
| Discussion |
|---|
|
|
|---|
Originally, it was postulated that the affinity between peptide and MHC class I molecule is the major factor in determining epitope immunogenicity (45, 46). However, now it is clear that many additional factors contribute to the decision as to whether or not an epitope becomes available for MHC class I presentation (4749) and especially becomes the dominant target of an immune response. In this study, we systematically analyzed the different steps of antigen recognition, processing and presentation that under normal conditions render the LLO extremely immunogenic. We followed the impact of a single aa exchange within the dominant epitope of listeriolysin on MHC class I antigen presentation and found that changing the C-terminal anchor residue of pLLO91-99 from Ile99 to Ala99 does not alter the peptide-binding affinity to isolated H-2Kd. Nevertheless, MHC class I presentation of the mutated protein was abrogated. This indicates that the selection of the dominant epitope is mainly determined by appropriate proteasomal processing and TAP transport rather than the binding capacity to MHC class I molecules.
Studies by Hahn et al. have shown that a mutation within the influenza hemagglutinin T cell epitope HA210-219 from Leu219 to Ala resulted in an epitope that only weakly bound Kd (42). In case of pLLO99A, the Ala in position 9 of the nonameric peptide obviously can substitute for the anchor aa Ile. The binding capacity of pLLO99A to Kd was comparable to that of the wild-type epitope pLLO91-99. Nevertheless, CD8+ T cells raised against the pLLO91-99 determinant did not recognize pLLO99A. Similar results were obtained with other peptides in which exchanges at aa 99 had been carried out. Since anchor residues and especially the C-terminus of a peptide should face inwardly into the binding groove of class I molecules, they should not be in contact with the TCR. Thus, even conservative replacements at this aa position of LLO91-99 must have a significant influence on the conformation of the peptide or the class I molecule in order to affect interactions of contact residues with the TCR. This issue is presently investigated in more detail. Similar observations have been made with a conservative exchange at the second anchor residue of this epitope (17, 23). Along this line, exchange of non-TCR contact residue within an epitope has been shown before to result in the antagonism of T cell recognition (50, 51).
Selective forces on the presentation of particular peptides have impressively been demonstrated by Davenport et al. previously (52). Comparing naturally presented peptides and peptides bound from mixtures with recombinant MHC class I molecules in vitro, they found similar aa distribution within the core of the epitopes. However, the C-terminus of peptides eluted from the in vitro loaded HLA-A2 and HLA-B8 molecules were clearly different from peptides eluted from the same molecules loaded under physiological conditions. Natural peptides showed a strong preference for hydrophobic C-termini which was not observed in the experimental system. In case of peptides eluted from in vitro loaded HLA-B8, the yield of Ala at the C-terminus was found to be even higher than Ile, Val and Leu that were observed normally. This is in line with our results. We demonstrate that Ala at the C-terminus of the LLO91-99 epitope results in binding to MHC class I H-2Kd with almost the same affinity as the wild-type peptide does. Thus, the observed preference for hydrophobic aa at the C-terminus of peptides binding to Kd is most likely an effect of epitope processing and transport rather than peptide binding. This hypothesis is supported by extensive studies on immunodominance and subdominance of lymphocytic choriomeningitis virus (LCMV) in a mouse model. Although the gp276 determinant exhibits a higher affinity to isolated H-2Db than the dominant epitope gp33 and was highly efficient in stimulating lysis of LCMV-infected target cells in adoptive transfer experiments (53, 54), it remains a subdominant epitope during viral infections.
The Ile to Ala substitution in pLLO99A negatively influences the TAP translocation efficiency. This was not unexpected as the correct C-terminal residue is known to play a critical role for TAP transport (55). Murine TAP preferentially translocates peptides with hydrophobic C-termini. Indeed, exchanging this residue in LLO99A led to a 10-fold decrease in translocation efficiency compared to the wild-type epitope. In line with these findings is the significant effect of the affinity of TAP for a particular epitope and its presentation as described by Fruci et al. (56).
The combined effects of (i) a TCR that needs
10 times more antigen to be optimally triggered and (ii) the inefficient TAP-dependent transport of the epitope could explain a reduction of pLLO99A presentation to a level ineffective for triggering cytotoxic T cells. However, if antigen presentation capacity would only be reduced at these steps, it should be possible to overcome this defect by using higher amounts of antigen. Studies performed by Chen (57) and Niedermann (48) on the presentation of a subdominant ovalbumin epitope indeed demonstrated that the lower binding capacity of the subdominant epitope Ova5562 and its inefficient proteolytic processing can be compensated by the use of high ovalbumin concentrations. In our case, even loading APCs with excessive amounts of intracellularly produced LLO99A did not result in T cell stimulation. This suggests that the observed absence of T cell stimulation by LLO99A is not simply a consequence of a reduced TAP transport and reduced TCR affinity but due to a severe defect in processing of the pLLO99A epitope.
In vitro proteasome digestion profiles of mutant and wild-type 24meric peptides clearly indicated that the exchange of the C-terminal anchor residue of the LLO T cell epitope changes the cleavage preference of the proteasome. This effect is caused by the aa substitution itself as under our experimental conditions positional or flanking effects on proteasomal cleavage preference could be excluded due to the fact that the mutation was introduced in the original aa sequence without alterations within the flanking region. These results are in line with proteasomal cleavage motifs described by Nussbaum et al. (58) where Tyr is a preferred C-terminal residue at the P1 position of an epitope after cleavage by the chymotryptic activity of yeast and human 20S proteasomes (59) (unpublished observations). According to these cleavage motifs a small aa is preferred at the position C-terminal of the cleavage site (P1'-position). Thus, the mutation from Ile to the smaller aa Ala at the C-terminus of the T cell epitope could explain the shifting of the dominant proteasomal cut from Ala17 to Tyr16.
Several studies have been performed by now showing that mutations within an epitope or its flanking region can influence the proteasomal cleavage pattern (4044, 5961). Some of them indicate a strong effect of Ala spacing on the processing frequency of an epitope (59, 60). Single as well as penta Ala-spacers were found to improve the antigen presentation capacity of a nonameric epitope by enhancing the proteasomal cut between the correct C-terminus Leu and the flanking Ala. This is in line with our results since we also observed a strong preference of the proteasome to cleave before Ala17 rather than before the natural flanking aa Val18. The introduction of an Ala in the C-terminal position of the LLO T cell epitope apparently functions as a cleavage signal leading to the destruction of most of the T cell epitope by the proteasome.
The hydrolysis of proteins by proteasomes obviously represents the key step in the generation of most antigenic peptides (reviewed in 62). Although proteasomes are needed for the presentation of most antigens, including LLO, they in fact destroy more epitopes than they generate (63, 64). Consistent with this, we observed during in vitro proteasomal digestion of 24meric precursors major cleavage events after the cleavage of Gly9, Tyr10, and Asp12, which all result in destruction of the pLLO91-99 and pLLO99A eptitope. The only significant difference in the proteasomal cleavage pattern of wild-type versus variant 24meric peptide, however, was the cleavage at position 16 and 17, respectively. For various epitopes it has been demonstrated that N-terminally extended precursors are the main proteasomal products generated (65, 66). In contrast, proteasomal activity is required to process the correct C-terminus needed for proper binding to MHC class I molecules. This is due to the lack of carboxypeptidases in the cytosol and the ER (67). Indeed, by cleaving the wild-type peptide precursor at position Ile17, the proteasome generates an N-terminally extended 17mer that exhibits the correct C-terminus. In case of the variant precursor, a major cleavage takes place at position Tyr16 deleting the C-terminal anchor position. Only minute amounts of the 17mer precursor with the correct C-terminus were detectable in proteasomal digests.
The proteasomal degradation of a protein is the initial step in generating an antigenic epitope, and most precursors extended N-teminally are processed by aminopeptidases in the cytosol and the ER (68). These down-stream processes may also be involved in the establishment of dominance of the pLLO91-99 epitope. Clearly, in vitro proteasomal digestion of the extended pLLO91-99 as well as pLLO99A peptide did not result in the generation of the correct nonameric peptide but only to N-terminally extended epitope precursors (Fig. 7). Therefore, it is very likely that aminopeptidases have a major impact on the processing of the correct epitope.
Little is known about the specificities of aminopeptidases residing in the cytosol and ER. Although some of them appear to destroy many antigenic peptides (69, 70), they exhibit the potential to generate epitopes that match the requirements for MHC class I binding (71, 72). Over-expression of the IFN-
inducible ER aminopeptidase 1 (ERAP1) has been shown to result in enhanced processing of the SIINFEKL epitope from an N-terminally extended precursor peptide (73) while inhibition of ERAP1 leads to down-regulation of MHC class I presentation (73, 74). Moreover, ERAP1 exhibits peptide selectivity and differential effects on antigen presentation by various MHC class I molecules (75). In addition, ERAP1 strongly prefers peptide substrates with hydrophobic C-terminal residues as described (67). Such an impact of post-proteasomal trimming on the generation of the immunodominant epitope pLLO91-99 has not been studied so far. However, the sequence preference of some of the down-stream proteases might affect the correct trimming of the epitope.
A similar discrepancy between the ability of CTLs to lyse peptide-pulsed APCs and their lack of lysing cells that express the full-length protein has been described by Valmori et al. (76). As in our study, inappropriate processing of the C-terminus of the antigenic peptide was identified as the factor limiting presentation. Interestingly, peptide presentation was restored by the addition of the proteasome inhibitor lactacystin. Inhibition of the proteasomal trypsin- and chymotrypsin-like activity prevented the destruction of the epitope in that case and allowed presentation by MHC class I. In our hands, treatment of APCs with lactacystin did not result in the restoration of processing of pLLO99A from LLO99A (data not shown).
Basler et al. have demonstrated that immunoproteasomes, but not constitutive proteasomes, lead to the preferential destruction of the gp276 epitope in LCMV-infected cells. This indicates the participation of the IFN-
-inducible proteasomal subunits on shaping the epitope hierarchy of CTL responses in vivo (47). No effect on the presentation of the wild-type or the lack of presentation of the variant listeriolysin epitope was observed by the addition of IFN-
to APCs. Thus, the composition of the proteasome is most likely excluded as a decisive factor for the dominance of pLLO91-99. This is in agreement with predictions of cleavage patterns of immunoproteasomes as revealed by the mhc-pathway software (www.mhc-pathway.net).
The fact that intracellular LLO secretion by L. monocytogenes is drastically down-regulated shortly after infection but nevertheless still suffices to accumulate enough pLLO91-99/H-2Kd complexes to stimulate a primary protective CTL response towards the pathogen suggests an extremely rapid and efficient processing and presentation of the toxin. A conservative single aa exchange at the C-terminal anchor position of the immunodominant epitope pLLO91-99 had, with the exception of peptideMHC binding, a dramatic effect on all major steps involved in the generation and presentation of an antigenic determinant. This includes interference with proteasomal digestion, TAP transport and T cell recognition, resulting in the complete loss of immunogenicity of the formerly highly immunogenic listeriolysin. Thus, our data underlines a highly optimized coordination of processing and presentation of pLLO91-99 that suggests a role if not a major role in the establishment of immunodominance towards this particular epitope. It also demonstrates the complexity of molecular mechanisms that lead to the dominance of a single MHC class I-presented epitope from an organism that in principal could provide thousands of epitopes for T cell recognition.
| Acknowledgements |
|---|
Expert technical assistance of Susanne zur Lage, Regina Lesch and Hannelore Hermann are gratefully acknowledged. This work has been supported in part by grants from the Deutsche Forschungsgemeinschaft and the Niedersächsische Ministerium für Wissenschaft und Kultur.
| Abbreviations |
|---|
| aa | amino acid |
| APC | antigen-presenting cell |
| DC | dendritic cell |
| DNS | dansylated |
| ER | endoplasmic reticulum |
| GM-CSF | granulocyte macrophage colony-stimulating factor |
| HU | hemolytic units |
| LCMV | lymphocytic choriomeningitis virus |
| LLO | listeriolysin O |
| MALDI | matrix-associated laser desorption ionization |
| MS | mass spectrometry |
| NP | nucleoprotein |
| TAP | Transporter associated with Antigen Processing |
| TFA | trifluoroacetic acid |
| TOF | time of flight |
| Notes |
|---|
Transmitting editor: A. Radbruch
Received 17 March 2005, accepted 11 October 2005.
| References |
|---|
|
|
|---|
- Sercarz, E. E., Lehmann, P. V., Ametani, A., Benichou, G., Miller, A. and K. Moudgil. 1993. Dominance and crypticity of T cell antigenic determinants. Annu. Rev. Immunol. 11:729.[CrossRef][Web of Science][Medline]
- Braciale, T. J., Sweetser, M. T., Morrison, L. A., Kittlesen, D. J. and Braciale, V. L. 1989. Class I major histocompatibility complex-restricted cytolytic T lymphocytes recognize a limited number of sites on influenza hemagglutinin. Proc. Natl Acad. Sci. USA 86:277.
[Abstract/Free Full Text] - Berzofsky, J. A. 1988. Immunodominance in T lymphocyte recognition. Immunol. Lett. 18:83.[CrossRef][Web of Science][Medline]
- Pamer, E. G., Harty, J. T. and Bevan, M. J. 1991. Precise prediction of a dominant class I MHC-restricted epitope of Listeria monocytogenes. Nature 353:852.[CrossRef][Medline]
- Chen, W., Anton, L. C., Bennink, J. R. and Yewdell, J. W. 2000. Dissecting the multifactorial causes of immunodominance in class I-restricted T cell responses to viruses. Immunity 12:83.[CrossRef][Web of Science][Medline]
- Yewdell, J. W. and Bennink, J. R. 1999. Immunodominance in major histocompatibility complex class I-restricted T lymphocyte responses. Annu. Rev. Immunol. 17:51.[CrossRef][Web of Science][Medline]
- Gellin, B. G. and Broome, C. V. 1989. Listeriosis. J. Am. Med. Assoc. 261:1313.
[Abstract/Free Full Text] - Kaufmann, S. H., Rodewald, H. R., Hug, E. and de Libero, G. 1988. Cloned Listeria monocytogenes specific non-MHC-restricted Lyt-cells with cytolytic and protective activity. J. Immunol. 140:3173.[Abstract]
- Pamer, E. G. 1994. Direct sequence identification and kinetic analysis of an MHC class I-restricted Listeria monocytogenes CTL epitope. J. Immunol. 152:686.[Abstract]
- Sijts, A. J., Neisig, A., Neefjes, J. and Pamer, E. G. 1996. Two Listeria monocytogenes CTL eitopes are processed from the same antigen with different efficiencies. J. Immunol. 156:683.[Abstract]
- Busch, D. H., Bouwer, H. G., Hinrichs, D. and Pamer, E. G. 1997. A nonamer peptide derived from Listeria monocytogenes metalloprotease is presented to cytolytic T lymphocytes. Infect. Immun. 65:5326.[Abstract]
- Wipke, B. T., Jameson, S. C., Bevan, M. J. and Pamer, E. J. 1993. Variable binding affinities of listeriolysin O peptides for H-2Kd class I molecules. Eur. J. Immunol. 23:2005.[Web of Science][Medline]
- Vijh, S. and Pamer, E. G. 1997. Immunodominant and subdominant CTL responses to Listeria monocytogenes infection. J. Immunol. 158:3366.[Abstract]
- Decatur, A. L. and Portnoy, D. A. 2000. A PEST-like sequence in listeriolysin O essential for Listeria monocytogenes pathogenicity. Science 290:992.
[Abstract/Free Full Text] - Darji, A., Chakraborty, T., Wehland, J. and Weiss, S. 1995. Listeriolysin generates a route for the presentation of exogenous antigens by major histocompatibility complex class I. Eur. J. Immunol. 25:2967.[Web of Science][Medline]
- Darji, A., Chakraborty, T., Wehland, J. and Weiss, S. 1997. TAP-dependent major histocompatibility complex class I presentation of soluble proteins using listeriolysin. Eur. J. Immunol. 27:1353.[Web of Science][Medline]
- Saledo, M., Momburg, F., Hämerling, G. J. and Ljunggren, H. G. 1994. Resistance to natural killer cell lysis conferred by TAP1/2 genes in human antigen-processing mutant cells. J. Immunol. 152:1702.[Abstract]
- Bruder, D., Darji, A., Gakamsky, D. M. et al. Efficient induction of cytotoxic CD8+ T cells against exogenous proteins: establishment and characterization of a T cell line specific for the membrane protein ActA of Listeria monocytogenes. Eur. J. Immunol. 28:2630.
- Gakamsky, D. M., Bjorkman, P. J. and Pecht, I. 1996. Peptide interaction with a class I major histocompatibility complex-encoded molecule: allosteric control of the ternary complex stability. Biochemistry 35:14841.[CrossRef][Medline]
- Gakamsky, D. M., Boyd, L. F., Margulies, D. H., Davis, D. M., Strominger, J. L. and Pecht, I. 1999. An allosteric mechanism controls antigen presentation by the H-2Kb complex. Biochemistry 38:12165.[CrossRef][Medline]
- Gakamsky, D. M., Davis, D. M., Strominger, J. L. and Pecht, I. 2000. Assembly and dissociation of human leukocyte antigen (HLA)-A2 studied by real-time fluorescence resonance energy transfer. Biochemistry 39:11163.[CrossRef][Medline]
- Neefjes, J., Gottfried, E., Roelse, J. et al. 1995. Analysis of the fine specificity of rat, mouse and human TAP peptide transporters. Eur. J. Immunol. 25:1133.[Web of Science][Medline]
- Kuehn, L., Dahlmann, B., Gauthier, F. and Neubauer, H. P. 1989. High-molecular-mass proteinases in rabbit reticulocytes: the multicatalytic proteinase is an ATP-independent enzyme and ATP-activated proteolysis is in part associated with a cysteine proteinase complexed to alpha 1-macroglobulin. Biochim. Biophys. Acta 991:263.[Medline]
- Bouwer, H. G. A., Moors, M. and Hinrichs, D. J. 1996. Elimination of the listeriolysin O-directed immune response by conservative alteration of the immunodominant listeriolysin O amino acid 91 to 99 epitope. Infect. Immun. 64:3728.[Abstract]
- Slifka, M. K., Blattmann, J. N., Sourdive, D. J. et al. 2003. Preferential escape of subdominant CD8+ T cells during negative selection results in an altered antiviral T cell hierarchy. J. Immunol. 170:1231.
[Abstract/Free Full Text] - Boes, B., Hengel, H., Ruppert, T., Multhaupt, G., Koszinowski, U. H. and Kloetzel, P. M. 1994. Interferon gamma stimulation modulates the proteolytic activity and cleavage site preference of 20S mouse proteasomes. J. Exp. Med. 179:901.
[Abstract/Free Full Text] - Dick, T. P., Ruppert, T., Groettrupp, M. et al. 1996. Coordinated dual cleavages induced by the proteasome regulator PA28 lead to dominant MHC ligands. Cell 88:253.
- Driscoll, J., Brown, M. G., Finley, D. and Monaco, J. J. 1993. MHC-linked LMP gene products specifically alter peptidase activities of the proteasome. Nature 365:262.[CrossRef][Medline]
- Gaczynska, M., Rock, K. L. and Goldberg, A. L. 1993.
-interferon and expression of MHC genes regulate peptide hydrolysis by proteasomes. Nature 365:264.[CrossRef][Medline] - Groettrup, M., Soza, A., Eggers, M. et al. 1996. A role for the proteasome regulator P28a in antigen presentation. Nature 381:166.[CrossRef][Medline]
- Gileadi, U., MoinsTeisserenc, H. T., Correa, I. et al. 1999. Generation of an immunodominant CTL epitope is affected by proteasome subunit composition and stability of the antigenic protein. J. Immunol. 163:6045.
[Abstract/Free Full Text] - Schwarz, K., van den Broek, M., Kostka, S. et al. 2000. Overexpression of the proteasome subunits LMP2, LMP7, and MECL-1 but not PA28
/ß enhances the presentation of an immunodominant lymphocytic choreomeningitis virus T cell epitope. J. Immunol. 165:768.[Abstract/Free Full Text] - Sijts, A. J. A. M., Standera, S., Toes, R. E. M. et al. 2000. MHC class I antigen processing of an adenovirus CTL epitope is linked to the levels of immunoproteasomes in infected cells. J. Immunol. 164:4500.
[Abstract/Free Full Text] - Darji, A., Bruder, D., zur Lage, S. et al. 1998. The role of the bacterial membrane protein ActA in immunity and protection against Listeria monocytogenes. J. Immunol. 161:2414.
[Abstract/Free Full Text] - Momburg, F., Roelse, J., Hämmerling, G. J. and Neefjes, J. J. 1994. Peptide size selection by the major histocompatibility complex-encoded peptide transporter. J. Exp. Med. 179:1613.
[Abstract/Free Full Text] - Momburg, F., Neefjes, J. J. and Hämmerling, G. J. 1994. Peptide selection by MHC encoded TAP transporters. Curr. Opin. Immunol. 6:32.[CrossRef][Web of Science][Medline]
- Lauveau, G., Kakimi, K., Niedermann, G. et al. 1999. Human transporters associated with antigen processing (TAP) select epitope precursor peptides for processing in the endoplasmic reticulum and presentation to T cells. J. Exp. Med. 190:1227.
[Abstract/Free Full Text] - Knuehl, C., Spee, P., Ruppert, T. et al. 2001. The murine cytomegalovirus pp89 immunodominant H-2Ld epitope is generated and translocated into the endoplasmic reticulum as an 11-mer peptide precursor. J. Immunol. 167:1515.
[Abstract/Free Full Text] - Villanueva, M. S., Sijts, A. J. A. M. and Pamer, E. G. 1995. Listeriolysin is processed efficiently into an MHC class I-associated epitope in Listeria monocytogenes-infected cells. J. Immunol. 155:5227.[Abstract]
- Yellen-Shaw, A. and Eisenlohr, L. C. 1997. Regulation of class I-restricted epitope processing by local or distal flanking sequence. J. Immunol. 158:1727.[Abstract]
- Yellen-Shaw, A. J., Wherry, E. J., Dubois, G. C. and Eisenlohr, L. C. 1997. Point mutation flanking a CTL epitope ablates in vitro and in vivo recognition of a full-length viral protein. J. Immunol. 158:3227.[Abstract]
- Hahn, Y. S., Hahn, C. S., Braciale, V. L., Braciale, T. J. and Rice, C. M. 1992. CD8+ T cell recognition of an endogenously processed epitope is regulated primarily by residues within the epitope. J. Exp. Med. 176:1335.
[Abstract/Free Full Text] - Eisenlohr, L. C., Yewdell, J. W. and Bennink, J. R. 1992. Flanking sequences influence the presentation of an endogenously synthesized peptide to cytotoxic T lymphocytes. J. Exp. Med. 175:481.
[Abstract/Free Full Text] - Seifert, U., Liermann, H., Racanelli, V. et al. 2004. Hepatitis C virus mutation affects proteasomal epitope processing. J. Clin. Invest. 114:250.[CrossRef][Web of Science][Medline]
- Sette, A., Vitiello, A., Reherman, B. et al. 1994. The relationship between class I binding affinity and immunogenicity of potential cytotoxic T cell epitopes. J. Immunol. 153:5586.[Abstract]
- Ossendorp, F., Eggers, M., Neisig, A. et al. 1994. A nonimmunodominant nucleoprotein-derived peptide is presented by influenza A virus-infected H-2b cells. J. Immunol. 152:4843.[Abstract]
- Basler, M., Youhnovski, N., van den Broek, M., Przybylski, M. and Groettrup, M. 2004. Immunoproteasomes down-regulate presentation of a subdominant T cell epitope from lymphocytic choriomeningitis virus. J. Immunol. 173:3925.
[Abstract/Free Full Text] - Niedermann, G., Butz, S., Ihlenfeldt, H. G. et al. 1995. Contribution of proteasome-mediated proteolysis to the hierarchy of epitopes presented by major histocompatibility complex class I molecules. Immunity 2:289.[CrossRef][Web of Science][Medline]
- Deng, Y., Yewdell, J. W., Eisenlohr, L. C. and Bennink, J. R. 1997. MHC affinity, peptide liberation, T cell repertoire, and immunodominance all contribute to the paucity of MHC class I-restricted peptides recognized by antiviral CTL. J. Immunol. 158:1507.[Abstract]
- Meier, U. C., Kleneman, P., Griffin, P. et al. 1995. Cytotoxic T lymphocyte lysis inhibited by viable HIV mutants. Science 270:1360.
[Abstract/Free Full Text] - Probst-Kepper, M., Hecht, H. J., Herrmann, H. et al. 2004. Conformational restraints and flexibility of 14-meric peptides in complex with HLA-B*3501. J. Immunol. 173:5610.
[Abstract/Free Full Text] - Davenport, M. P., Smith, K. J., Barouch, D. et al. 1997. HLA class I binding motifs derived from random peptide libraries differ at the COOH terminus from those of eluted peptides. J. Exp. Med. 185:367.
[Abstract/Free Full Text] - Van der Most, R. G., Murali-Krishna, K., Whitton, J. L. et al. 1998. Identification of D-b and K-b restricted subdominant cytotoxic T cell responses in lymphocytic choriomeningitis virus infected mice. Virology 240:158.[CrossRef][Web of Science][Medline]
- Gallimore, A., Dumrese, T., Hengartner, H., Zinkernagel, R. M. and Rammensee, H.-G. 1998. Protective immunity does not correlate with the hierarchy of virus specific cytotoxic T cell responses to naturally processed peptides. J. Exp. Med. 187:1647.[CrossRef][Web of Science][Medline]
- Momburg, F., Roelse, J., Howard, J. C., Butcher, G. W., Hämmerling, G. and Neefjes, J. J. 1994. Selectivity of MHC-encoded peptide transporters from human, mouse and rat. Nature 367:648.[CrossRef][Medline]
- Fruci, D., Lauvau, G., Saveanu, L. et al. 2003. Quantifying recruitment of cytosolic peptides for HLA class I presentation: impact of TAP transport. J. Immunol. 170:2977.
[Abstract/Free Full Text] - Chen, W., Khilko, S., Fecondo, J., Margulies, D. H. and McCluskey, J. 1994. Determinant selection of major histocompatibility complex class I-restricted antigenic peptides is explained by class I-peptide affinity and is strongly influenced by nondominant anchor residues. J. Exp. Med. 180:1471.
[Abstract/Free Full Text] - Nussbaum, A. K., Dick, T. P., Keilholz, W. et al. 1998. Cleavage motifs of the yeast 20S proteasome beta subunits deduced from digests of enolase 1. Proc. Natl Acad. Sci. USA 95:12504.
[Abstract/Free Full Text] - Del Val, M., Schlicht, H.-J., Ruppert, T., Reddehase, M. J. and Koszinowsky, U. H. 1991. Efficient processing of an antigenic sequence for presentation by MHC class I molecules depends on its neighboring residues in the protein. Cell 66:1145.[CrossRef][Web of Science][Medline]
- Eggers, M., Boes-Fabian, B., Ruppert, T., Kloetzel, P. M. and Koszinowski, U. H. 1995. The cleavage preference of the proteasome governs the yield of antigenic peptides. J. Exp. Med. 182:1865.
[Abstract/Free Full Text] - Shastri, N., Serwold, T. and Gonzalez, F. 1995. Presentation of endogenous peptide/MHC class I complexes is profoundly influenced by specific C-terminal flanking sequences. J. Immunol. 155:4339.[Abstract]
- Kloetzel, P.-M. 2004. Generation of major histocompatibility complex class I antigens: functional interplay between proteasomes and TPPII. Nat. Immunol. 5:661.[CrossRef][Web of Science][Medline]
- Kessler, J. H., Beekman, N. J. Bres-Vloemans, S. A. et al. 2001. Efficient identification of novel HLA-A*0201-presented cytotoxic T lymphocyte epitopes in the widely expressed tumor antigen PRAME by proteasome mediated digestion analysis. J. Exp. Med. 193:73.
[Abstract/Free Full Text] - Morel, S., Levy, F., Burlet-Schulz, O. et al. 2000. Processing of some antigens by the standard proteasome but not by the immunoproteasome results in poor presentation by dendritic cells. Immunity 12:107.[CrossRef][Web of Science][Medline]
- Cascio, P., Hilton, C., Kisselev, A. F., Rock, K. L. and Goldberg, A. L. 2001. 26S proteasomes and immunoproteasomes produce mainly N-extended versions of an antigenic peptide. EMBO J. 20:2357.[CrossRef][Web of Science][Medline]
- Kisselev, A. F., Akopian, T. N., Woo, K. M. and Goldberg, A. L. 1998. The size of peptides generated from protein by mammalian 26 and 20 S proteasomes. Implications for understanding the degradative mechanism and antigen presentation. J. Biol. Chem. 274:3363.
- Rock, K. L., York, I. A. and Goldberg, A. L. 2004. Post-proteasomal antigen processing for major histocompatibility complex class I presentation. Nat. Immunol. 5:670.[CrossRef][Web of Science][Medline]
- Kloetzel, P.-M. and Ossendorp, F. 2004. Proteasome and peptidase function in MHC-class-I-mediated antigen presentation. Curr. Opin. Immunol. 16:76.[CrossRef][Web of Science][Medline]
- Saric, T., Beninga, J., Graef, C. I., Akopian, T. N., Rock, K. L. and Goldberg, A. L. 2001. Major histocompatibility complex class I-presented antigenic peptides are degraded in cytosolic extracts primarily by thimet oligopeptidase. J. Biol. Chem. 276:36474.
[Abstract/Free Full Text] - York, I. A., Mo, A. X., Lemerise, K. et al. 2003. The cytosolic endopeptidase, thimet oligopeptidase, destroys antigenic peptides and limits the extent of MHC class I antigen presentation. Immunity 18:429.[CrossRef][Web of Science][Medline]
- Stoltze, L., Schirle, M., Schwarz, G. et al. 2000. Two new proteases in the MHC class I processing pathway. Nat. Immunol. 1:413.[CrossRef][Web of Science][Medline]
- Serwold, T., Gaw, S. and Shastri, N. 2001. ER aminopeptidases generate a unique pool of peptides for MHC class I molecules. Nat. Immunol. 2:644.[CrossRef][Web of Science][Medline]
- Saric, T., Chang, S. C., Hattori, A. et al. 2002. An IFN-gamma induced aminopeptidase in the ER, ERAP1, trims precursors to MHC class I-presented peptides. Nat. Immunol. 3:1169.[CrossRef][Web of Science][Medline]
- Serwold, T., Gonzalez, F., Kim, J., Jacob, R. and Shastri, N. 2002. ERAAP customizes peptides for MHC class I molecules in the endoplasmic reticulum. Nature 419:480.[CrossRef][Medline]
- York, I. A., Chang, S. C., Saric, T. et al. 2002. The ER aminopeptidase ERAP1 enhances or limits antigen presentation by trimming epitopes to 8-9 residues. Nat. Immunol. 3:1177.[CrossRef][Web of Science][Medline]
- Valmori, D., Gileadi, U., Servis, C. et al. 1999. Modulation of proteasomal activity required for the generation of a cytotoxic T lymphocyte-defined peptide derived from tumor antigen MAGE-3. J. Exp. Med. 189:895.
[Abstract/Free Full Text]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






