Skip Navigation


International Immunology Advance Access originally published online on February 14, 2005
International Immunology 2005 17(3):245-255; doi:10.1093/intimm/dxh205
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
17/3/245    most recent
dxh205v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Bergmann-Leitner, E. S.
Right arrow Articles by Tsokos, G. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bergmann-Leitner, E. S.
Right arrow Articles by Tsokos, G. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Japanese Society for Immunology. 2005. All rights reserved. For permissions, please e-mail: journals.permissions@oupjournals.org

C3d binding to the circumsporozoite protein carboxy-terminus deviates immunity against malaria

Elke S. Bergmann-Leitner1,*, Sandra Scheiblhofer2,*, Richard Weiss2, Elizabeth H. Duncan1, Wolfgang W. Leitner3, Defeng Chen1, Evelina Angov1, Farhat Khan1, Jackie L. Williams4, David B. Winter5, Josef Thalhamer2, Jeffrey A. Lyon1 and George C. Tsokos5

1 Department of Immunology, Walter Reed Army Institute of Research, Silver Spring, MD 20910, USA
2 Immunology Group, Institute of Chemistry and Biochemistry, University of Salzburg, Salzburg, Austria
3 Dermatology Branch, NCI/NIH, Bethesda, MD 20892, USA
4 Department of Entomology and 5 Cellular Injury, Walter Reed Army Institute of Research, Silver Spring, MD, 20910 USA

Correspondence to: G. C. Tsokos; E-mail: gtsokos{at}usuhs.mil


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The immunogenicity of recombinant protein or anti-viral DNA vaccines can be significantly improved by the addition of tandem copies of the complement fragment C3d. We sought to determine if the efficacy of a circumsporozoite protein (CSP)-based DNA vaccine delivered to mouse skin by gene gun was improved by using this strategy. Instead, we found that C3d suppressed the protective immunity against Plasmodium berghei malaria infection and deviated immunity, most notably by suppressing the induction of antibodies specific for the CSP C-terminal flanking sequence and by suppressing the induction of CSP-specific IL-4-producing spleen cells. We further showed that C3d bound to the C-terminal flanking sequence of the CSP, which may explain the immune deviation observed in CS/C3d chimeric antigen. We have thus identified C3d-mediated epitope masking and shifting of both the humoral and cellular immune responses as a potential novel escape mechanism, which plasmodia may use to divert the induction of protective immunity.

Keywords: complement, host defense, malaria, T lymphocytes


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
DNA vaccination based on the circumsporozoite protein (CSP) gene is sufficient to protect at least 90% of BALB/c (13) and C57BL/6 mice (E. S. Bergmann-Leitner, unpublished results) against Plasmodium berghei sporozoite infection. This protection depends on epidermal injection of plasmid DNA with a gene gun (1, 2), immunization intervals that optimize the induction of Th2-type immunity (1, 2) and removal of the glycosyl-phosphatidylinositol (GPI) signal sequence to allow protein secretion (3). By applying these principles, we have been able to protect at least 90% of vaccinated mice against sporozoite challenge following two or three immunizations with the DNA vaccine CSP(-A). Of greater value would be a regimen that induces protective immunity after a single immunization. For a malaria vaccine to be useful in the field, protection against infection needs to be provided after a minimum number of immunizations, optimally a single delivery.

The need to enhance the efficacy of DNA vaccination has led to the development of a variety of strategies, most notably the addition of molecular adjuvants designed to enhance the function and activation of antigen-presenting cells (APC). B cells are powerful APC because they can capture and accumulate antigen by using their antigen-specific surface Ig. A variety of factors and signals initiate and enhance B cell APC function and thus represent potential adjuvants. Among these is C3d, which is generated from C3 during complement activation, and binds to complement receptor 2 (CR2, CD21), on mature B cells. C3d-mediated B cell activation occurs as a consequence of simultaneous engagement of the antigen-specific surface-bound Ig and CD21 by antigen/C3d complexes (47). The crucial role of this signaling process is reflected by impaired B cell responses in mice lacking either C3 (8) or CR2 (9, 10). Recently, it has been demonstrated, however, that as an adjuvant, C3d can also function independently of CD21/CD35 (11).

Fusion of two or three tandem copies of C3d to recombinant hen egg lysozyme (HEL) has been shown to enhance dramatically the immune response to HEL (12). This approach was subsequently used successfully to enhance the efficacy of DNA vaccines. Indeed, constructs encoding genes for pathogen-derived antigens linked in tandem to sequences encoding for C3d delivered more protective immune response than constructs without the C3d (1316).

In the present study, we investigated the potential adjuvant effect of C3d in a DNA vaccine against P. berghei malaria. Using a previously established CSP-based DNA vaccine known as CSP(-A) (3) we asked whether the use of C3d as molecular adjuvant would accelerate the onset of the immune response and induce protective immunity after a single immunization. However, in contrast to previous reports for other infection models (1316), we observed a significant reduction of protection against a challenge with sporozoites when two copies of C3d were attached to the CSP(-A) gene, even after three immunizations. Our experiments show that C3d associates with the C-terminus of CSP, shifts the immune response to a Th1-type response, limits the humoral response against C-terminal epitopes and significantly reduces protection against P. berghei infection. In summary, this study (i) demonstrates that the fusion of antigens to C3d is not a generally applicable adjuvant strategy, (ii) clearly shows that CSP-based protective immunity against P. berghei is Th2 and not Th1 mediated and (iii) provides compelling evidence for a novel escape mechanism of the malaria parasite, involving components of the complement system.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Vaccine constructs
In all constructs used for this study, the natural endoplasmic reticulum-targeting signal of P. berghei CSP was replaced with that from human tissue plasminogen activator (TPA). Furthermore, the putative GPI signal sequence of the CSP was removed to ensure secretion of the encoded proteins. Construction of the CSP plasmid [CSP(-A)] and the empty vector plasmid pcDNA was described previously (3).

The murine C3d DNA fragment was amplified by PCR from a plasmid containing the C3 gene, which was a gift from John Lambris (University of Pennsylvania). The forward primer (gggagatctacccccgcaggctctggg) added a unique BglII site at the 5' end and inactivated the thioesterification site by replacing the TGT (Cys) with TCT (Ser). The reverse primer (ggggatccggggaggtggaaggacacatcc) added a unique BamHI site at the 3' end. A precursor plasmid WR65/00/C3d was prepared, ligating the C3d PCR product that was digested with BglII and BamHI, into the WRG6518 vector (1), and the insert was sequenced. A precursor plasmid [pCI-TPA/1C3d(pre)] containing a single copy of C3d was prepared by excising the C3d fragment from WR65/00/1C3d with BamHI and BglII and inserting it into pCI-TPA(-EEF motif) digested with BglII. Adding a second copy of C3d required first inserting a (G4S)2 linker (12) into WR65/00/1C3d digested with HindIII and BamHI, generating WR65/00/1C3d+(G4S)2. The two complementary oligonucleotides used to make the linker were gatctggaggaggaggctccggaggaggaggctccggatccgaattca and agcttgaattcggatccggagcctcctcctccggagcctcctcctcca; they added unique 5' BglII and 3' HindIII sites. The pCI-TPA/3C3d(pre) plasmid, which contains three copies of C3d, was prepared by excising the C3d+(G4S)2 fragment from WR65/00/1C3d+(G4S)2 by digesting with BamHI and BglII and inserting it into pCI-TPA/C3d(pre) digested with BglII, making pCI-TPA/2C3d(pre). This process was repeated from pCI-TPA/2C3d(pre), making pCI-TPA/3C3d(pre). The CS/3C3d chimeric plasmid was created by excising the CSP fragment from the CSP(-A) plasmid with BamHI and inserting it into pCI-TPA/3C3d(pre) digested with BglII. The plasmid used for expressing three tandem copies of C3d (p3C3d) was prepared by cutting pCI-TPA/3C3d(pre) with BamHI and BglII and re-ligating. Plasmids for immunization studies were prepared by Genoquest Inc. (Gaithersburg, MD, USA) using Endo Free Plasmid Giga Kits (Qiagen, Valencia, CA, USA). Purified plasmid DNA was stored in TE(Tris-EDTA[Ethynelo-Diamine-Tetraacetate]) buffer at –20°C.

Expression of recombinant CSP in Escherichia coli and protein purification
The glutathione (GSH)-S-transferase (GST)-fusion expression vector, pGEX-6P, was obtained from Pharmacia. A 48-mer oligonucleotide that codes for six consecutive histidines for nickel chelate affinity chromatography was synthesized containing BamHI and HindIII termini. The pGEX-6P vector was digested with BamHI and HindIII, the oligonucleotide linker was ligated into the expression vector and the reconstructed His-tag-modified pGEX vector was sequenced. The P. berghei CSP gene was sub-cloned from the expression vector pCI-TPA/PbCSP using BamHI into the pGEX-His6 vector (3). The PbCSP expression vector was identified as pGST/PbCSP-His. Escherichia coli BL21 (DE3) cells were transformed and expression was tested.

Protein was purified using a two-step affinity chromatography method based on GSH–Sepharose 4 Fast Flow (Amersham Pharmacia Biotech AB, Uppsala, Sweden) and Ni+2-nitrilo-tri-acetic acid Superflow (Qiagen). Frozen bacterial cell paste was re-suspended in ice-cold PBS/10 mM dithiothreitol (DTT)/1 mM phenylmethylsulfonylfluoride/0.2 mg/ml lysozyme. The bacterial homogenate was lysed by microfluidization. Following lysis, Triton X-100 was added to 1.0% (v/v final). The lysate was incubated on ice with gentle stirring for 30 min. The Triton X-100-soluble supernatant was collected by centrifugation for 1 h at 15 000 rpm. The GSH–Sepharose resin was prepared by pre-equilibration with PBS/10 mM DTT/1% Triton X-100. Following the application of the soluble supernatant to the column by gravity flow method, the column was washed extensively with equilibration buffer. Protein was eluted with 10 mM GSH, reduced form (Aldrich Chemical, St Louis, MO, USA), in 50 mM Tris, pH 8.0. The elution peak was dialyzed against PBS/10% glycerol/10 mM imidazole/0.3% Empigen BB (v/v final) (Albright and Wilson, Calbiochem, La Jolla, CA, USA) at 4°C overnight. For metal chelate chromatography, Ni+2-NTA resin was pre-equilibrated with PBS/10 mM imidazole/0.3% Empigen BB and the sample was loaded under gravity flow conditions. Following the application of the sample, the column was first washed with PBS/10 mM imidazole/0.3% Empigen followed by a second wash with PBS/0.1% Empigen BB/30 mM imidazole. The recombinant protein was eluted with PBS/500 mM imidazole. The peak fractions were collected and dialyzed against PBS/10% glycerol and stored frozen at –80°C in aliquots.

Expression of recombinant CSP N-terminal and C-terminal flanking regions in E. coli
The N-terminal and C-terminal flanking sequences were obtained by PCR amplification from the expression vector, pCI-TPA/PbCSP (2). The amplification primers for the N-terminal fragment were 5'CSP N-T 1131 (5'gtcagcggatccgatggac) and 3'CSP N-T 1370 (5'tggtggtggggatccttgtttcaatttattattacgctc) and for the C-terminal 5'CSP C-T 1809 5'caaccaggatccggtggtaataacaataacaaaaataataataatgacgattc) and 3'CSP C-T 2072 ( 5'tcttcaggatccacttgaac). Internal BamHI sites are underlined. After amplification, fragments were gel purified, digested with BamHI and ligated to the linearized/dephosphorylated pGex-6P1 vector. The bacterial strain BL21de3 was transformed with each of the vectors, inserts were sequenced and plasmids screened for expression. The clones NT-pGex-6P1 and CT-pGex-6P1 expressed the N-terminal and C-terminal of products of PbCSP, respectively. Recombinant proteins were purified over GSH–Sepharose as described for the full-length recombinant CSP.

Detection of CSP in transfected cells
BHK cells American Type Tissue Collection (Rockville, MD, USA) were transfected with 2 µg of an equal mixture of expression plasmid [CSP(-A), CS/2C3d, CS/3C3d, 2C3d or 3C3d] and pcDNA, by using lipofectamine plus (Invitrogen/Life Technologies, Carlsbad, CA, USA) according to manufacturer's instructions. For flow cytometric assays, secretion was blocked by adding 2 µM brefeldin A (Pharmingen, San Diego, CA, USA) to the culture for 8 h beginning 18 h after transfection. For western blotting, cells were not treated with brefeldin A and instead, culture supernates containing secreted protein were analyzed. For flow cytometric analysis of protein expression, cells were trypsinized and prepared for intracellular staining by using the Cytofix/cytoperm kit following the manufacturer's instructions (Pharmingen). CSP expression was detected with pooled hyperimmune serum from animals immunized with CSP(-A) by gene gun [isotype control is pooled serum from mice immunized with pcDNA using the same regimen as with CSP(-A)]. C3d expression was determined using a commercially available polyclonal rabbit anti-human C3d antibody (DAKO, Fort Collins, CO, USA), and normal rabbit IgG was used as isotype control. Affinity-purified, PE-conjugated goat anti-mouse IgG (Southern Biotechnology, Birmingham, AL, USA) and Spectrared-conjugated goat anti-rabbit IgG were used as second-step reagents. Data were expressed as percent specific positive cells and mean fluorescence intensity of the gated positive cells. For analysis of protein expression by western blot, culture supernatants containing secreted antigen were harvested 24 h after transfection and centrifuged at 100 000g for 1 h to pellet membrane vesicles. Samples equivalent to 2 x 105 cells per lane were applied to 4–20% polyacrylamide gel (Invitrogen) and size fractionated by SDS gel electrophoresis (120 V, 90 min). Subsequently, proteins were transferred onto nitrocellulose membranes (25 V, 1 h). The membranes were blocked in PBS + 0.3% Tween-20 for 30 min at room temperature (RT), then incubated with 1 : 20 000 diluted mAb 4B10 (directly conjugated to HRP, gift from Robert Wirtz, CDC, Atlanta, GA, USA) for 1 h at RT. After three washes with PBS + 0.05% Tween, reactive bands were visualized using enhanced chemiluminescence (ECL) plus and exposing the membranes to photographic film.

Detection of C3d binding to CSP
BHK cells were transfected with various plasmids (pcDNA, 2C3d or 3C3d) as described above. Secretion was blocked by adding 2 µM brefeldin A to the culture for 8 h beginning 24 h after transfection. Cells were harvested by trypsinization and washed and cell lysates prepared by freeze thawing and brief sonication. To assay for CSP and C3d binding, microtiter wells were treated overnight with 50 ng per well of (i) the C-terminal flanking sequence of CSP (CSP-CT), (ii) the N-terminal flanking sequence of CSP (CSP-NT), (iii) 24-mer peptide representing the repeat region of CSP (repeat region, 50 ng/ml), (iv) recombinant GST/CSP or (v) GST protein (GST, 50 ng/ml) as negative control. Plates were then blocked with PBS + 1% BSA for 1 h at RT, then cell lysates from transfected cells were added and incubated overnight at 4°C. Binding of C3d was detected by the anti-C3d antibody (1 µg/ml), followed by goat anti-rabbit antiserum conjugated with alkaline phosphatase (dilution 1 : 500). After adding the substrate BluePhos (Kirkegaard Perry, Gaithersburg, MD, USA), plates were read at 570 nm.

Immunization
Mice used for immunizations were 6- to 8-week old BALB/c females from the Jackson Laboratory (Bar Harbor, ME, USA). Sera were collected 1 day prior to each immunization and 2 weeks after the last immunization, which was prior to challenge with live P. berghei sporozoites. Sera were preserved by adding sodium azide (final concentration, 0.2%) and stored at 4°C. Mice were vaccinated three times at 4-week intervals epidermally with a Helios gene gun (Bio-Rad, Hercules, CA, USA). Vaccine was prepared by precipitating plasmid DNA onto gold beads (1.6-µm diameter) with CaCl2 in the presence of spermidine at a loading rate of 2 µg DNA mg–1 of gold (1). Mice received a dose of 3 µg of DNA divided between three non-overlapping areas on the shaved abdomen at a helium pressure of 400 psi.

Determination of antibody titers by immunofluorescence assay
End point antibody titers were determined as described previously by indirect immunofluorescence assay (IFA) on air-dried, methanol-fixed P. berghei ANKA strain sporozoites (1).

ELISA
Ninety-six-well plates (Immunolon 2 HB, Thermo Labsystems, Franklin, MA, USA) were coated by overnight incubation with recombinant GST/CSP, the N-terminal part of CSP (CSP-NT), the C-terminal part of CSP (CSP-CT) or a 24-mer peptide (DPPPPNPN)3 representing a CSP repeat epitope at a concentration of 1 µg/ml in PBS at 4°C. Plates were washed with PBS/0.1% Tween-20 using the 96-well plate automatic ELISA-plate washer (Skatron, Sterling, VA, USA) and blocked with blocking buffer (PBS, 1% BSA, pH 7.5) for 1 h at 37°C. Sera were serially diluted in blocking buffer, incubated for 2 h at 37°C and then washed. Alkaline phosphatase-conjugated goat anti-mouse IgG, IgG1 and IgG2a (all from Southern Biotechnology) detection antibodies were added in blocking buffer (1 : 1000) and incubated for 1 h at 37°C. The assay was developed with BluePhos substrate (Kirkegaard Perry) for 30 min at RT, then stopped with stopping solution (Kirkegaard Perry) and read at 570 nm. Antibody concentration was determined by establishing a standard curve (run in parallel with each assay) with purified mouse IgG, IgG1 and IgG2a. For each serum, we determined a concentration that was within the linear portion of the reaction curve and used this dilution to extrapolate the actual antibody concentration in the assay wells.

Antibody avidity determination by thiocyanate elution
Based on their respective antibody titers, serum samples were diluted in blocking buffer to obtain comparable concentrations of IgG, incubated for 2 h at 37°C and then washed. Antigen–antibody interactions were disrupted by the addition of increasing concentrations of the chaotropic agent sodium thiocyanate (NaSCN) in PBS (0, 0.5, 1, 1.5, 2, 2.5, 3, 4 and 5 M NaSCN) for 15 min (17). Plates were then washed to remove the NaSCN and processed following the standard ELISA protocol. The effective concentration of NaSCN required to release 50% of antiserum (ED50) was determined and used to compare the affinity of the antibody response induced by the vaccines.

ELISA-SPOT analysis
ELISA-SPOT plates (Millipore, Bedford, MA, USA) were coated with capturing mAb (Pharmingen, clone R4-6A2 for IFN-{gamma}, clone 11B11 for IL-4, 4 µg/ml) overnight at 4°C in sterile PBS. Plates were then blocked with PBS + 1% BSA and later cells were seeded at 105 lymphocytes per well in HL-1 medium (GIBCO/Invitrogen, Carlsbad, CA, USA). Lymphocytes were obtained by lysing RBCs by osmotic shock (ACK Ammonium Chlorid Potassium (K) lysis buffer, GIBCO/Invitrogen). Cells were stimulated with 20 µg/ml recombinant CSP, peptides CS57–70 (18), CS58–65 (19), CS252–260 (20) and CS252–260 (21) or a mix of these peptides. Plates were incubated for 24 h (IFN-{gamma}) or 48 h (IL-4) before cells were washed out and the biotinylated, detecting mAb was added (Pharmingen, clone XMG1.2 for IFN-{gamma}, clone BVD6-24G2 for IL-4, 2 µg/ml). Detecting mAb was incubated overnight at 4°C. Finally, wells were treated with streptavidin–alkaline phosphatase (Southern Biotechnology; 1 : 1000 diluted) for 2 h and the assay was developed using nitro-blue tetrazolium chloride/5-ßromo-4-chloro-3'-indoly-phosphate-p-toluidine salt substrate (Pierce). Analysis of the ELISA-SPOT assay plates was done using the C.T.L. imaging system (ImmunoSpot Analyzer, Cellular Technology Ltd, Cleveland, OH, USA). The number of spots in wells containing only unstimulated lymphocytes was used as background control. Spots reported from cultures with stimulated lymphocytes were corrected using their corresponding media control.

Magnetic bead separation
Single-cell suspensions were prepared and erythrocytes were lysed by using ACK lysis buffer. CD4+ or CD8+ splenocytes were purified using magnetic bead-labeled antibodies (Miltenyi Biotec, Auburn, CA, USA) according to the manufacturer's instructions. Separation was performed by using the Miltenyi OctoMACS system, which produces a >95% pure population. Cells were then washed with HL-1 medium (Invitrogen), suspended at 1 x 106 cells/ml and plated at 1 x 105 cells per well along with 2 x 105 irradiated APC per well (splenocytes from naive mice, irradiated with 3000 rad). ELISA-SPOT analysis was performed as described above. Wells containing only irradiated APC and antigen were set up to ensure that the APC did not produce any cytokines.

Parasite challenge
Fourteen days after the final immunization, mice were challenged by subcutaneous inoculation of 3000–5000 P. berghei sporozoites dissected from infected mosquito glands. Infection was determined by the presence of blood-stage parasites in Giemsa-stained thin blood smears 1 week after challenge. Animals that were not infected at that time were tested again 1 week later. We used this analysis schedule because animals that are infected with P. berghei ANKA strain malaria parasites do not self-cure.

Statistical analysis
A group size of 10 mice was chosen because, in efficacy studies, this number gives a 75% probability of observing a difference between the control group and the vaccinated group at the 95% confidence level (one tail) if 90% of the control animals were infected and 50% of the vaccinated animals were not infected. Chi-square analysis (two tails) was used to determine if a vaccine had a protective effect by comparing the proportion of infected animals observed in a vaccinated group with the proportion in pcDNA control group. Chi-square analysis (two tails) was also used to compare the protective effect of the CSP(-A) and CS/C3d chimeric vaccines. Comparisons of IFA results from vaccine groups were made by Kruskal–Wallis followed by Mann–Whitney tests, and comparison of ELISA results were made by ANOVA on log-transformed data followed by Dunnet's tests with the CSP(-A) vaccine group as the control comparator. The binding of 2C3d and 3C3d to GST/CS or GST/CS C-terminal flanking sequence, GST/CS N-terminal flanking sequence or CS repeat peptide was compared by using ANOVA with binding to a GST control serving as the comparator for Dunnet's test (22).


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Expression of CSP/C3d chimeras and C3d
We used flow cytometry and western blot analysis to show that the protein was expressed from the CSP(-A), CS/2C3d and CS/3C3d vectors in transiently transfected BHK cells. In cultures treated with brefeldin A to block protein secretion (Fig. 1A–C), flow cytometry shows that 40–50% of cells expressed either CSP or CS/C3d chimeric protein. These results are supported by western blots prepared with secreted proteins in the supernates from cultures that were not treated with brefeldin A (Fig. 1D); the antigens migrated at their predicted size on SDSP gels, CSP(-A), at 50 kDa (1), CS/2C3d and CS/3C3d, at 106 and 140 kDa, respectively, indicating that they are expressed and secreted as full-length molecules.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 1. Intracellular staining for CSP expression of cells transfected with (A) CSP(-A), (B) CS/2C3d or (C) CS/3C3d; protein secretion was blocked with brefeldin A. Overlay histograms show fluorescence intensity of cells stained with either polyclonal anti-CSP antisera (thick line) or non-immune mouse serum (thin line). (D) Immunoblot of secreted proteins from transfected BHK cells. Supernatant proteins from 2 x 105 cells were size fractionated on a 4–20% polyacrylamide gel, and transferred onto nitrocellulose. Lanes are shown on the left. Molecular weight marker; lane a, CSP(-A); lane b, CS/2C3d and lane c, CS/3C3d.

 
C3d limits CSP(-A) vaccine efficacy against P. berghei
We have previously shown that a regimen of three epidermal immunizations with the CSP(-A) DNA vaccine given at 4-week intervals is >90% efficacious against P. berghei infection in mice challenged 10 weeks after priming, but a single immunization was only 60% efficacious (Table 1). We sought to improve the protective effect of a single immunization by vaccinating with chimeric CS/2C3d or CS/3C3d vaccines, but no improvement was observed (Table 1). A single immunization with the CS/2C3d or CS/3C3d plasmid was 50 or 70% efficacious, respectively. Although three immunizations with the CSP(-A) construct increased efficacy to 90%, three immunizations did not improve the efficacy of either of the C3d chimeric constructs (Table 1). After three immunizations, CS/2C3d was less protective than CSP(-A) (P = 0.044); however, the protective effects of CSP(-A) and CS/3C3d were not significantly different.


View this table:
[in this window]
[in a new window]
 
Table 1. C3d limits the protective efficacy of CSP(-A) against Plasmodium berghei

 
C3d limits antibody induction and shifts the IFA-reactive anti-sporozoite antibody response from IgG1 to IgG2a
We showed previously that the protective effect of the CSP(-A) vaccine is associated with the production of high ratios of IgG1/IgG2a anti-sporozoite antibodies (3). We considered that the decrease in protective efficacy that resulted from the fusion of CS and C3d may be due to (i) a reduction in anti-sporozoite antibody levels or (ii) a shift in the isotype of sporozoite-specific antibody response. Accordingly, we compared day-of-challenge (DOC) sera by IFA on air-dried and fixed sporozoites (Fig. 2). Kruskal–Wallis tests showed that median sporozoite-specific IgG and IgG1 titers differed significantly among the vaccine groups receiving one immunization (P = 0.050 and P < 0.000, respectively). Further analysis by Mann–Whitney tests showed that the IgG response induced by CSP(-A) was significantly greater than that induced by CS/3C3d chimera (P = 0.0068) but was not different from the response induced by CS/2C3d. The IgG1 response induced by CSP(-A) was significantly greater than that induced by either the CS/2C3d or the CS/3C3d chimera (P = 0.0004 and P = 0.0019, respectively). None of the vaccines induced significant sporozoite-specific IgG2a antibodies after a single immunization. However, when the vaccines were given three times, median sporozoite-specific IgG, IgG1 and IgG2a differed significantly among the vaccine groups (P = 0.027, P = 0.028 and P = 0.005, respectively). The IgG response induced by CSP(-A) was significantly greater than that induced by the CS/2C3d chimera (P = 0.0051), but it was not different from the response induced by the CS/3C3d chimera. The IgG1 response induced by CSP(-A) was significantly greater than that induced by either the CS/2C3d or CS/3C3d chimera (P = 0.0077 and P = 0.0463, respectively). The IgG2a response induced by CS/3C3d was significantly greater than that induced by CSP(-A) (P = 0.004), but the IgG2a responses induced by CSP(-A) and CS/2C3d were not different. Although all animals immunized three times with these vaccines produced measurable quantities of IFA-reactive IgG and IgG1, only 4 of 10 animals vaccinated with CSP(-A), 6 of 10 animals vaccinated with CS2/C3d and 10 of 10 animals vaccinated with CS/3C3d produced IgG2a (Fig. 2). Taken altogether, these results show that compared with CSP(-A), CS/2C3d limits CSP-specific antibody induction and CS/3C3d favors the induction of CSP-specific IgG2a



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. C3d alters the antibody isotype against sporozoite antigens in response to immunization with CSP. Data show median IFA titers (95% confidence interval) of DOC sera after a single immunization (A) or three immunizations (B). The numbers above the plots indicate the number of responders per number of animals in the experimental group.

 
C3d limits the production of anti-C-terminus antibodies in the anti-CSP repertoire
In order to map the fine specificities and types of CSP-specific humoral responses induced by vaccinating three times with the CSP(-A) or CS/C3d chimeras, we performed ELISA analysis on DOC sera using a 24-mer peptide representing the repeat CSP region, and recombinant proteins representing the C-terminal and N-terminal flanking sequences of P. berghei CSP as capture antigens (Fig. 3). Sera collected after three immunizations with any of the DNA vaccines contained only background levels of IgG1 or IgG2a isotype N-terminal flanking sequence-specific antibody (Fig. 3). Repeat-specific IgG1 antibody levels in sera from mice vaccinated with CS/2C3d were 7-fold less than the levels in mice vaccinated with CSP(-A) (P = 0.002), but the antibody levels in sera from mice vaccinated with the CS/3C3d and CSP(-A) were not different. Repeat-specific IgG2a antibody levels in sera from mice vaccinated with either of the CS/C3d chimeric vaccines were not significantly different from mice vaccinated with CSP(-A). C-terminal flanking sequence-specific IgG1 and IgG2a antibody levels in DOC sera from mice vaccinated with either of the CS/C3d chimeric vaccines were 20-fold and 7-fold lower, respectively, than levels in sera from mice vaccinated with the CSP(-A) vaccine (P < 0.0005). These data show that C3d limits the response against the C-terminus of CSP, especially with respect to the induction of IgG1 isotype antibody.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. C3d suppresses the induction of antibody specific to the C-terminus of CS and favors the production of IgG2a. DOC sera were analyzed for fine specificity and isotype profile by ELISA using various plate antigens: panel A = IgG1, panel B = IgG2a. DOC sera (i.e. week 10) were analyzed regarding their specificity for the respective plate antigens: C-terminus, N-terminus or a 24-mer peptide representing the repeat region of Plasmodium berghei CSP. Data are expressed as geometric mean (95% confidence interval) of antibody concentrations of each immunization group (n = 10).

 
C3d results in the generation of low-affinity antibodies
Finally, we sought to determine if CS-specific antibody avidity was affected by vaccinating with CS/3C3d as opposed to CSP(-A). We used ELISA in conjunction with dissociation of immune complexes by the chaotropic agent NaSCN to make this determination. When given three times, CSP(-A) induced significantly higher affinity antibodies (ED50 = 1.75 M NaSCN) than did CSP/3C3d (ED50 = 1.04 M NaSCN) (Table 2, P = 0.004).


View this table:
[in this window]
[in a new window]
 
Table 2. C3d results in the generation of low-affinity antibodies

 
C3d favors the production of IFN-{gamma} over IL-4 by splenic T cells
Having established a distinct effect of C3d on the repertoire, magnitude and isotype representation of the anti-CSP antibody response in the presence of C3d, we sought to determine whether T cell responses against CSP-defined epitopes also differed after three immunizations with CSP(-A) or the C3d chimeric vaccines (Fig. 4). Among the six antigens used to recall T cell responses ex vivo, median vaccine-induced IFN-{gamma} responses differed for splenocytes stimulated with GST/CSP, peptide CS57–70, peptide CS58–67 and peptide CS265–79 (Kruskal–Wallis P = 0.027, P = 0.028, P = 0.046 and P = 0.007, respectively). Stimulation with recombinant CSP or with the MHC class I peptide CS58–67 recalled significantly more IFN-{gamma}-producing splenocytes from mice vaccinated with CS/3C3d than from mice vaccinated with CSP(-A) (P = 0.027 and P = 0.046, respectively). Stimulation with the nested MHC class II/MHC class I peptide 57–70 and with the MHC class I peptide 265–79 recalled significantly more IFN-{gamma}-producing splenocytes from mice vaccinated with either the CS/3C3d chimera (P = 0.0433 and P = 0.0085, respectively) or the CS/2C3d chimera (P = 0.0448 and P = 0.0262, respectively) than from mice vaccinated with CSP(-A). Vaccine-induced IL-4 responses differed for splenocytes from mice vaccinated with CSP(-A) and CS/3C3d or CSP(-A) and CS/2C3d at only two points. Stimulation with recombinant CSP recalled significantly more IL-4-producing splenocytes from mice vaccinated with CS/3C3d than from mice vaccinated with CSP(-A) (P = 0.0196), and stimulation with the peptide mixture recalled significantly more IL-4-producing splenocytes from mice vaccinated with CSP(-A) than from mice vaccinated with CS/2C3d (P = 0.0343). When performing further ELISA-SPOT analysis with purified CD4+ and CD8+ T cells as responders, we detected a strong bias in the CSP-specific T cells toward CD8+ T cells in both immunization groups, CS/2C3d and CS/3C3d, compared with CSP(-A) (Fig. 5). Interestingly, immunization with CS/3C3d resulted in a higher percentage of CSP-reactive T cells within the T cell pool.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4. C3d both favors the induction of CSP epitope-specific IFN-{gamma}-producing and limits the induction of IL-4-producing CSP epitopes-specific lymphocytes. Cells from thrice vaccinated unchallenged mice were harvested from spleens at the same time as identically vaccinated littermates were challenged by subcutaneous injection of live Plasmodium berghei sporozoites. The bars represent the median response and the error bars define the 90% confidence interval for the antigen-specific IFN-{gamma} (panel A) or IL-4 (panel B) responses.

 


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5. C3d favors the activation of CD8+ T cells over CD4+ T cells dependent on the number of C3d copies in the chimeric immunogens. Splenocytes from three animals immunized with the various plasmids were separated using magnetic bead-conjugated anti-CD4 or anti-CD8 antibodies. The positively selected cells were then seeded at 100 000 cells per well and stimulated with peptide mix. Data shown are mean number (and standard deviation) of IFN-{gamma} (A) or IL-4-producing (B) CSP-specific CD4+ or CD8+ T cells per well. Data are representative of two experiments.

 
C3d binds to the C-terminus of CSP
In data that are not shown in this paper, we found that in control experiments, immunization with equal molar mixtures of the CSP(-A) vaccine and a plasmid expressing either 2C3d or 3C3d effected the induction of CS-specific immunity in the same way as the chimeric vaccines, including suppression of the protective effect of the CSP gene and deviation of immune response toward IgG2a and suppression of the C-terminal flanking sequence antibody response. This was surprising, since we had expected that only the chimeric plasmids would display immunomodulatory properties and the immune response generated by co-immunization with the two plasmids would be similar to CSP(-A) alone. Because of the presence of several adhesion motifs within the CSP C-terminal flanking sequence, we tested the possibility that CSP may bind C3d. To this end, we coated plates with recombinant P. berghei CSP (GST/CSP), recombinant protein fragments defined as the N-terminal and C-terminal flanking sequence expressed as GST fusions, a 24-mer synthetic peptide representing the repeat domain of CSP or GST as a control protein. These capture molecules were reacted with lysates prepared from cells transfected with plasmids encoding pcDNA, which was used as a negative control, or 2C3d or 3C3d. Binding of protein in the lysate to the plate capture molecule was detected with anti-C3d polyclonal antibody (Table 3). The difference in the mean binding of either 2C3d or 3C3d to GST/CS was significantly greater than the binding to GST alone (P = 0.011 and P = 0.009, respectively), as was the binding to GST C-terminal CS fusion (Table 3). There was no difference in binding of either 2C3d or 3C3d to the GST/N-terminal CS-flanking fusion or the repetitive CS epitope when compared with GST. These data demonstrate a physical interaction between C3d and the C-terminus of CSP, which may lead to ‘masking’ epitopes associated with the C-terminus CS and to masking functional elements of C3d that are associated with adjuvanticity.


View this table:
[in this window]
[in a new window]
 
Table 3. The C-terminus of CSP binds C3da

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Immunization with chimeric proteins expressing several copies of C3d (23) or DNA vaccines encoding repeat sequences of C3d in tandem to the gene of interest, such as influenza virus hemagglutinin (13, 16) and HIV type 1 envelope protein (24), increases vaccine efficacy. Therefore, we sought to determine if C3d could improve the efficacy of a malaria DNA vaccine. Given the deficiencies of the experimental vaccines against malaria, efforts to either decrease the required repeat vaccinations or prolong and enhance protection are of considerable importance. In this study, two or three tandem copies of C3d were attached to the CSP(-A) gene to generate the CS/2C3d and CS/3C3d chimeric DNA vaccines. The plasmids were delivered by particle-mediated bombardment of the skin (gene gun immunization), which we have demonstrated to be the optimal route for delivering the CSP gene as a malaria vaccine (13).

This study has revealed a number of novel and unexpected findings. First, C3d limits the efficacy of a CSP-based DNA vaccine against P. berghei (Table 1); second, the number of copies of C3d affects the magnitude and the balance of CSP-specific Ig isotypes (Figs 2 and 3) induced as well as the IL-4 response to CSP-derived CD4 and CD8 T cell epitopes measured ex vivo (Fig. 4); third, it limits the anti-CSP C-terminal flanking sequence-specific antibody response by masking the epitopes in this region of the molecule (Table 3) and fourth, it decreases the production of IgG1 anti-sporozoite and anti-CSP antibody response (Figs 2 and 3). The C3d binding to the CSP C-terminus may be a mechanism for exploitation of the innate immune response by the parasite to suppress the development of an acquired immune response.

The presence of C3d limits the induction of protection against malaria infection. Whether given one or three times, both CS/2C3d and CS3C3d were more protective than pcDNA (challenge control). The proportion of animals that were not infected after three immunizations with CSP(-A) was significantly greater than that observed for either CS/2C3d or CS/3C3d.

Cognizance of the importance of antigen-specific IL-4-producing CD4+ T cells in protection against malaria infection is increasing. Protection induced after immunization either with radiation-attenuated sporozoites or with the CSP-specific CD8+ T cell epitope SYVPSAEQI depends on the induction of IL-4-producing CD4+ T cells that are specific for liver-stage antigens (25). Immunity in humans vaccinated with radiation-attenuated sporozoites also correlates with the induction of IL-4-producing CD4+ CD45RO+ T cells, but not IFN-{gamma}-producing T cells specific for erythrocytic-stage malaria parasites (26). Gene gun-mediated vaccination with the CSP gene induces strong type 2 humoral immune responses (13). Typically, this type of immunity is difficult to deviate toward type 1 (27). Our results demonstrate that the presence of C3d either as a gene chimera with CSP or co-injected with CSP(-A) indeed diverted the induction of the expected type 2 humoral immune response. This diversion can be attributed to C3d, which is pro-inflammatory and immunoregulatory (28, 29) and activates murine CD4+ T cells bearing the CR1/2 complement receptor (30, 31), causing them to express a Th1 phenotype (30). Despite inducing a strong CD8+ IFN-{gamma} response, the CS/2C3d vaccine failed to protect mice against malaria infection, which can be explained by its failure to induce a strong IL-4 response. Although both CSP(-A) and CS/3C3d induced a significant protective effect, the protection induced by the CSP(-A) vaccine was the stronger of the two. Both vaccines induced large quantities of repeat-specific antibodies (Fig. 3), high-titer IFA-reactive antibodies (Fig. 2) and large numbers of CSP-specific IL-4- and IFN-{gamma}-producing splenocytes (Fig. 4). The stronger protective effect of the CSP(-A) vaccine is most readily explained by its ability to induce antibodies specific for the C-terminal flanking sequence (Fig. 3), which has been shown to be protective in other studies (32, 36).

The observation that C3d interacts with the C-terminus of CSP (Table 3) and may mask epitopes that are important for protection has interesting implications for host–parasite interactions. This region of the CSP is known to contain several adhesion motifs including those for properdin and thrombospondin. This properdin motif, found in Plasmodia spp. and other micro-organisms, may modulate susceptibility to infection or disease (3436). The adhesion motifs in the C-terminus of CSP have been implicated with the initial entry of the sporozoites into the liver cells (37) and protection (32, 33). Our experiments suggest that these motifs might also play an effective role in immune deviation. Hepatocytes, the target cells of sporozoites, are the major producers of C3 (30). Thus, binding of the C-terminus of CSP to C3d could represent an elegant immune escape mechanism of the parasite. We can only speculate as to how this mechanism might work in vivo. Although sporozoites can fix heterologous complement, they do not appear to fix homologous complement (38). The CSP-based properdin motifs on sporozoites might inhibit complement fixing by binding C3b such that it is oriented in the wrong direction. This type of C3b binding without fixation could then induce the CSP reaction and shedding of multimeric immunoregulatory complexes. Protection in the irradiated sporozoite vaccine model does not argue against this mechanism because this approach induces immunity that is strongly T cell dependent (39). It involves CS as well as non-CSPs (40, 41) and it is characterized by minimal induction of sporozoite-specific antibodies (40).

In this study, we have shown that C3d decreased the protective effect and deviated immunity induced by what has proven to be a highly effective CSP-based DNA vaccine against malaria infection. Therefore, the vaccine-enhancing effects of C3d reported previously against some viral pathogens cannot be extended readily to parasite and probably other pathogens. The potential for C3d-mediated non-responsiveness or immunosuppression has been shown previously (12, 42). One of the studies report the failure to induce HEL-specific antibodies when mice were immunized with one copy, but not two or three copies of C3d (12). Another study using bovine rotavirus and bovine herpesvirus showed inhibition of humoral and cellular immune responses after intradermal injection of chimeric plasmids containing either one or two copies of C3d (42). Differences in the nature of the immunogen (chimeric HEL-C3d protein) or in the modality (needle immunization rather than gene gun injection of a DNA vaccine) and route (intradermal instead of epidermal injection of a DNA vaccine) do not allow a direct comparison with our results. Other potential vaccines contrived similarly to the ones presented in this communication will probably also require detailed characterization. Finally, the possibility that plasmodia may bind elements of the innate immune system in order to evade a protective adaptive host immune response presents additional strategic considerations for the development of malaria vaccines.


    Acknowledgements
 
This work was supported by the United States Agency for International Development, Project Number 936-6001, Award Number AAG-P-00-98-00006, Award Number AAG-P-00-98-00005, Hertha Firnberg grant T133 of the Austrian Science Fund, NIH Grant PHS RO3 AI053463 and the United States Army Medical Research and Materiel Command. The authors would like to thank Sooyeng Moore for providing P. berghei sporozoites.


    Abbreviations
 
APC   antigen-presenting cell
CR2   complement receptor 2
CSP   circumsporozoite protein
DOC   day-of-challenge
DTT   dithiothreitol
GPI   glycosyl-phosphatidylinositol
GSH   glutathione
GST   glutathione-S-transferase
HEL   hen egg lysozyme
IFA   immunofluorescence assay
RT   room temperature
TPA   tissue plasminogen activator

    Notes
 
* These authors contributed equally to this study Back

Transmitting editor: T. F. Tedder

Disclaimer

The authors' views are personal and are not to be construed as official policy of the Department of Defense or the U.S. Army. Research was conducted in compliance with the Animal Welfare Act and other Federal statutes and regulations relating to animals and experiments involving animals and adheres to principles stated in the Guide for the Care and Use of Laboratory Animals, NRC Publication, 1996 edition. All procedures were reviewed and approved by the Institute's Animal Care and Use Committee, and performed in a facility accredited by the Association for Assessment and Accreditation of Laboratory Animal Care, International.

Received 18 May 2004, accepted 6 December 2004.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Leitner, W. W., Seguin, M. C., Ballou, W. R. et al. 1997. Immune responses induced by intramuscular or gene gun injection of protective deoxyribonucleic acid vaccines that express the circumsporozoite protein from Plasmodium berghei malaria parasites. J. Immunol. 159:6112.[Abstract]
  2. Weiss, R., Leitner, W. W., Scheiblhofer, S. et al. 2000. Genetic vaccination against malaria infection by intradermal and epidermal injections of a plasmid containing the gene encoding the Plasmodium berghei circumsporozoite protein. Infect. Immun. 68:5914.[Abstract/Free Full Text]
  3. Scheiblhofer, S., Chen, D., Weiss, R. et al. 2001. Removal of the circumsporozoite protein (CSP) glycosylphosphatidylinositol signal sequence from a CSP DNA vaccine enhances induction of CSP-specific Th2 type immune responses and improves protection against malaria infection. Eur. J. Immunol. 31:692.[CrossRef][ISI][Medline]
  4. Tsokos, G. C., Lambris, J. D., Finkelman, F. D., Anastassiou, E. D. and June, C. H. 1990. Monovalent ligands of complement receptor 2 inhibit whereas polyvalent ligands enhance anti-Ig-induced human B cell intracytoplasmic free calcium concentration. J. Immunol. 144:1640.[Abstract]
  5. Goeckeritz, B. E., Lees, A., Vos, O., Tsokos, G. C., Kuhlbusch, K. and Mond, J. J. 2000. Enhanced and sustained activation of human B cells by anti-immunoglobulin conjugated to the EBV glycoprotein gp350. Eur. J. Immunol. 30:969.[CrossRef][ISI][Medline]
  6. Thornton, B. P., Vetvicka, V. and Ross, G. D. 1996. Function of C3 in a humoral response: iC3b/C3dg bound to an immune complex generated with natural antibody and a primary antigen promotes antigen uptake and the expression of co-stimulatory molecules by all B cells, but only stimulates immunoglobulin synthesis by antigen-specific B cells. Clin. Exp. Immunol. 104:531.[CrossRef][ISI][Medline]
  7. Kozono, Y., Abe, R., Kozono, H., Kelly, R. G., Azuma, T. and Holers, V. M. 1998. Cross-linking CD21/CD35 or CD19 increases both B7-1 and B7-2 expression on murine splenic B cells. J. Immunol. 160:1565.[Abstract/Free Full Text]
  8. Fischer, M. B., Ma, M., Goerg, S. et al. 1996. Regulation of the B cell response to T-dependent antigens by classical pathway complement. J. Immunol. 157:549.[Abstract]
  9. Ahearn, J. M., Fischer, M. B., Croix, D. et al. 1996. Disruption of the Cr2 locus results in a reduction in B-1a cells and in an impaired B cell response to T-dependent antigen. Immunity 4:251.[CrossRef][ISI][Medline]
  10. Molina, H., Holers, V. M., Li, B. et al. 1996. Markedly impaired humoral immune response in mice deficient in complement receptors 1 and 2. Proc. Natl Acad. Sci. USA 93:3357.[Abstract/Free Full Text]
  11. Haas, K. M., Toapanta, F. R., Oliver, J. A. et al. 2004. C3d functions as a molecular adjuvant in the absence of CD21/35 expression. J. Immunol. 172:5833.[Abstract/Free Full Text]
  12. Dempsey, P. W., Allison, M. E., Akkaraju, S., Goodnow, C. C. and Fearon, D. T. 1996. C3d of complement as a molecular adjuvant: bridging innate and acquired immunity. Science 271:348.[Abstract]
  13. Ross, T. M., Xu, Y., Bright, R. A. and Robinson, H. L. 2000. C3d enhancement of antibodies to hemagglutinin accelerates protection against influenza virus challenge. Nat. Immunol. 1:127.[CrossRef][ISI][Medline]
  14. Ross, T. M., Xu, Y., Green, T. D., Montefiori, D. C. and Robinson, H. L. 2001. Enhanced avidity maturation of antibody to human immunodeficiency virus envelope: DNA vaccination with gp120–C3d fusion proteins. AIDS Res. Hum. Retroviruses 17:829.[CrossRef][ISI][Medline]
  15. Green, T. D., Newton, B. R., Rota, P. A., Xu, Y., Robinson, H. L. and Ross, T. M. 2002. C3d enhancement of neutralizing antibodies to measles hemagglutinin. Vaccine 20:242.
  16. Mitchell, J. A., Green, T. D., Bright, R. A. and Ross, T. M. 2003. Induction of heterosubtypic immunity to influenza A virus using a DNA vaccine expressing hemagglutinin-C3d fusion proteins. Vaccine 21:902.[CrossRef][ISI][Medline]
  17. Pullen, G. R., Fitzgerald, M. G. and Hosking, C. S. 1986. Antibody avidity determination by ELISA using thiocyanate elution. J. Immunol. Methods 86:83.[CrossRef][ISI][Medline]
  18. Migliorini, P., Betschart, B. and Corradin, G. 1993. Malaria vaccine: immunization of mice with a synthetic T cell helper epitope alone leads to protective immunity. Eur. J. Immunol. 23:582.[ISI][Medline]
  19. Leitner, W. W., Ying, H. and Restifo, N. P. 2000. DNA and RNA-based vaccines: principles, progress and prospects. Vaccine 18:765.
  20. Romero, P. J., Tam, J. P., Scnesinger, D. et al. 1988. Multiple T helper epitopes of the circumsporozoite protein of Plasmodium berghei. Eur. J. Immunol. 18:1951.[ISI][Medline]
  21. Romero, P., Corradin, G., Luescher, I. F. and Maryanski, J. L. 1991. H-2Kd-restricted antigenic peptides share a simple binding motif. J. Exp. Med. 174:603.[Abstract/Free Full Text]
  22. Fischer, R. A. 1932. Statistical Methods for the Research Worker, 4th edn. Oliver & Boyd, Edinburgh, Scotland.
  23. Watanabe, I., Ross, T. M., Tamura, S. et al. 2003. Protection against influenza virus infection by intranasal administration of C3d-fused hemagglutinin. Vaccine 21:4532.[CrossRef][ISI][Medline]
  24. Green, T. D., Montefiori, D. C. and Ross, T. M. 2003. Enhancement of antibodies to the human immunodeficiency virus type 1 envelope by using the molecular adjuvant C3d. J. Virol. 77:2046.[Abstract/Free Full Text]
  25. Carvalho, L. H., Sano, G.-I., Hafalla, J. C. R., Morrot, A., Curotto De Lafaille, M. A. and Zavala, F. 2002. IL-4 secreting CD4+ T cells are crucial to the development of CD8+ T-cell responses against malaria liver stages. Nat. Med. 8:166.[CrossRef][ISI][Medline]
  26. Bergmann, E. S., Ballou, W. R. and Krzych, U. 1997. Detection of CD4+CD45RO+ T lymphocytes producing IL-4 in response to antigens on Plasmodium falciparum erythrocytes: an in vitro correlate of protective immunity induced with attenuated Plasmodium falciparum sporozoites. Cell. Immunol. 180:143.[CrossRef][ISI][Medline]
  27. Weiss, R., Scheiblhofer, S., Freund, J., Ferreira, F., Livey, I. and Thalhamer, J. 2002. Gene gun bombardment with gold particles displays a particular Th2-promoting signal that over-rules the Th1-inducing effect of immunostimulatory CpG motifs in DNA vaccines. Vaccine 20:3148.[CrossRef][ISI][Medline]
  28. Kinoshita, T. 1991. Biology of complement: the overture. Immunol. Today 12:291.[CrossRef][ISI][Medline]
  29. Passwell, J., Schreiner, G. F., Nonaka, M., Beuscher, H. U. and Colten, H. R. 1988. Local extrahepatic expression of complement genes C3, factor B, C2 and C4 is increased in murine lupus nephritis. J. Clin. Invest. 82:1676.[ISI][Medline]
  30. Pratt, J. R., Basheer, S. A. and Sacks, S. H. 2003. Local synthesis of complement component C3 regulates acute renal transplant rejection. Nat. Med. 8:582.
  31. Kaya, Z., Afanasyeva, M., Wang, Y. et al. 2001. Contribution of the innate immune system to autoimmune myocarditis: a role for complement. Nat. Immunol. 2:739.[CrossRef][ISI][Medline]
  32. Roggero, M. A., Meraldi, V., Lopez, J. A. et al. 2000. The synthetic, oxidized C-terminal fragment of the Plasmodium berghei circumsporozoite protein elicits a high protective response. Eur. J. Immunol. 30:2679.[CrossRef][ISI][Medline]
  33. Meraldi, V., Audran, R., Romero, J. F. et al. 2003. OM-174, a new adjuvant with a potential for human use, induces a protective response when administered with the synthetic C-terminal fragment 242-310 from the circumsporozoite protein of Plasmodium berghei. Vaccine 21:2485.[CrossRef][ISI][Medline]
  34. Schofield, L. and Uadia, P. 1990. Lack of Ir gene control in the immune response to malaria. J. Immunol. 144:2781.[Abstract]
  35. Ramasamy, R. 1998. Molecular basis for evasion of host immunity and pathogenesis in malaria. Biochim. Biophys. Acta 1406:10.[Medline]
  36. Goundis, D. and Reid, K. B. M. 1988. Properdin, the terminal complement components, thrombospondin and the circumsporozoite protein of malaria parasites contain similar sequence motifs. Nature 335:82.[CrossRef][Medline]
  37. Cerami, C., Kwakye-Berko, F. and Nussenzweig, V. 1992. Binding of malarial circumsporozoite protein to sulfatides [Gal(3-SO4)ß1-Cer] and cholesterol-3-sulfate and its dependence on disulfide bond formation between cysteines in region II. Mol. Biochem. Parasitol. 54:1.[CrossRef][ISI][Medline]
  38. Kawamoto, Y., Winger, L. A., Hong, K. et al. 1992. Plasmodium berghei: sporozoites are sensitive to human serum but not susceptible host serum. Exp. Parasitol. 75:361.[CrossRef][ISI][Medline]
  39. Egan, J. E., Weber, J. L., Ballou, W. R. et al. 1987. Efficacy of murine malaria sporozoite vaccines: implications for human vaccine development. Science 236:453.[Abstract/Free Full Text]
  40. Chatterjee, S., Druilhe, P. and Wery, M. 1999. Irradiated sporozoites prime mice to produce high antibody titres upon viable Plasmodium berghei sporozoite challenge, which act upon liver-stage development. Parasitology 118:219.
  41. Rogers, W. O., Malik, A., Mellouk, S. et al. 1992. Characterization of Plasmodium falciparum sporozoite surface protein 2. Proc. Natl Acad. Sci. USA 89:9176.[Abstract/Free Full Text]
  42. Suradhat, S., Braun, R. P., Lewis, J. et al. 2001. Fusion of C3d molecule with bovine rotavirus VP7 or bovine herpesvirus type 1 glycoprotein D inhibits immune responses following DNA immunization. Vet. Immunol. Immunopathol. 83:79.[CrossRef][ISI][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
F. E. Lovegrove, S. A. Gharib, S. N. Patel, C. A. Hawkes, K. C. Kain, and W. C. Liles
Expression Microarray Analysis Implicates Apoptosis and Interferon-Responsive Mechanisms in Susceptibility to Experimental Cerebral Malaria
Am. J. Pathol., December 1, 2007; 171(6): 1894 - 1903.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Lee, K. M. Haas, D. O. Gor, X. Ding, D. R. Karp, N. S. Greenspan, J. C. Poe, and T. F. Tedder
Complement Component C3d-Antigen Complexes Can Either Augment or Inhibit B Lymphocyte Activation and Humoral Immunity in Mice Depending on the Degree of CD21/CD19 Complex Engagement
J. Immunol., December 15, 2005; 175(12): 8011 - 8023.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
17/3/245    most recent
dxh205v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrow