Skip Navigation


International Immunology Advance Access originally published online on January 10, 2005
International Immunology 2005 17(2):193-205; doi:10.1093/intimm/dxh200
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
17/2/193    most recent
dxh200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Peng, J.-K.
Right arrow Articles by Wu-Hsieh, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peng, J.-K.
Right arrow Articles by Wu-Hsieh, B. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© 2005 The Japanese Society for Immunology

The combined effect of IL-4 and IL-10 suppresses the generation of, but does not change the polarity of, type-1 T cells in Histoplasma infection

Jung-Kuei Peng1, Jr-Shiuan Lin1, John T. Kung2, Fred D. Finkelman3,4 and Betty A. Wu-Hsieh1

1 Graduate Institute of Immunology, College of Medicine, National Taiwan University, No. 1 Jen-Ai Road, Section 1, Taipei 100, Taiwan, Republic of China
2 Institute of Molecular Biology, Academia Sinica, Taipei 115, Taiwan, Republic of China
3 Division of Immunology, University of Cincinnati College of Medicine, Cincinnati, OH 45267, USA
4 Cincinnati Veterans Administration Medical Center, Cincinnati, OH 45220, USA

Correspondence to: B. A. Wu-Hsieh; E-mail: wuhsiehb{at}ha.mc.ntu.edu.tw


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Dominant type-1 cytokine production is induced in a murine model of systemic histoplasmosis. We used this model to investigate whether the presence of antagonistic cytokines during T cell priming changes the polarity of T cells in response to Histoplasma infection. Before infection with Histoplasma capsulatum, mice were injected twice with goat anti-mouse IgD antiserum (G{alpha}M{delta}), which induced expression of dominant type-2 cytokines. At days 7 and 14 after infection, the G{alpha}M{delta}-treated mice had suppressed IFN-{gamma} response and a significantly greater fungal burden in their spleens and lungs. The number of IFN-{gamma}-producing cells as well as the level of IFN-{gamma} produced per cell was greatly reduced. Not only CD4+ T cells but also CD8+ T cells were affected. The number of Histoplasma-induced IFN-{gamma}-producing cells was partially restored in G{alpha}M{delta}-treated IL-4–/– and IL-10–/– mice and completely restored in IL-4–/–IL-10–/– mice. Thus, the combined effect of IL-4 and IL-10 suppressed the generation of IFN-{gamma}-producing cells. A longitudinal study demonstrated that as IL-4 and IL-10 decreased, the number of Histoplasma-induced IFN-{gamma}-producing cells rapidly increased, and fungal clearance improved, demonstrating that the presence of IL-4 and IL-10 did not permanently change the polarity of T cells.

Keywords: histoplasmosis, IFN-{gamma}-producing cells, T cell polarity, type-1 and type-2 cytokines


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Upon antigen stimulation, naive CD4+ T lymphocytes are induced to differentiate into two distinct subsets (13). The Th1 subset produces IFN-{gamma}, IL-2 and lymphotoxin (4, 5). The Th2 subset produces IL-4, IL-5, IL-9, IL-10 and IL-13 (4, 5). Similar to CD4+ T cells, the CD8+ T cells are also divided into two different subsets that secrete distinct patterns of cytokines (6, 7). Type-1 cytokines promote macrophage activation and contribute to the pathogenesis of autoimmune disorders and the elimination of intracellular pathogens (1, 2), while type-2 cytokines contribute to the pathogenesis of allergic diseases and host protection against helminthic infections (1, 2). Type-1 and type-2 cytokines are mutually antagonistic (8). The biological importance of the mutual antagonism between type-1 and type-2 cytokines for humans was suggested by an epidemiological survey in Japanese children (9). The study demonstrated an inverse association between tuberculin response and atopic disorder (9). Subsequent to this observation, successful attempts were made in animals to reduce allergic response to ovalbumin peptide (OVA) by injecting live or killed intracellular organisms, shifting Th2-dominant response to a Th1-dominant one (1012). Conversely, when mice with established Th2-dominant OVA-induced airway hypersensitivity response were infected with Listeria, the non-lethal infection became lethal (13). Pre-established Schistosoma infection in mice also delays Leishmania lesion development (14). Results of these studies show that exposure to agents that induce a type-1 response can reduce the allergic response to an allergen. Likewise, induction of a type-2 response interferes with host resistance to an intracellular pathogen. However, these studies did not clarify how these manipulations affect the generation of effector T cells or reveal the duration of cytokine-associated immune deviation.

Studies herein were designed to address these issues. Mice were treated with G{alpha}M{delta} to induce the production of multiple cytokines, including small quantities of IL-2 and IFN-{gamma} and larger amounts of IL-4, IL-6, IL-9 and IL-10, creating a predominantly type-2 cytokine milieu (15). Since Histoplasma capsulatum is an intracellular pathogen of the macrophage, macrophages stimulated by IFN-{gamma} are activated to inhibit the replication of the yeast (16). The ability of animals to mount a type-1 cytokine response is vital to the clearance of this fungus (17, 18). Employing G{alpha}M{delta} to establish a predominantly type-2 cytokine environment prior to infection, we examined how type-2 cytokines regulate a host defense mechanism that is type-1 cytokine dependent.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice
C57BL/6 wild-type (WT), IL-4–/– C57BL/6J-Il4tm1Cgn (19) and IL-10–/– C57BL/6-Il10tm1Cgn mice (20) were purchased from The Jackson Laboratory (Bar Harbor, ME, USA) and bred in the Laboratory Animal Center of National Taiwan University College of Medicine. The animals were housed in sterilized cages fitted with filter cage tops and fed with sterilized food and water. IL-4–/–IL-10–/– mice were generated by intercrossing F1 offspring of IL-4–/– and IL-10–/– parents. IL-4 and IL-10 gene deficiencies were confirmed by amplifying genomic tail DNA. The tail DNA obtained from 4-week-old mice was purified with a DNeasyTM tissue kit (Qiagen, Basel, Switzerland). Sequences for PCR primers were: Il-4, TGCATTGTTAGCATCTCTTGA (sense) and CCCTTCTCCTGTGACCTCGTT (antisense); Il-10, ATGCCTGGCTCAGCACTGCTA (sense) and TACAAAGAAAGTCTTCACCTG (antisense). Confirmed IL-4–/–IL-10–/– mice were then intercrossed and their progeny were used in the experiments. All mice were bred and sera were tested for anti-mycoplasma and anti-mouse hepatitis virus antibodies. Serological results were all negative for these antibodies.

Fungus infection
Yeast cells of H. capsulatum strain 505 were cultured in brain–heart infusion agar supplemented with cysteine (1 mg ml–1) and glucose (20 mg ml–1) at 37°C for 3 days. Yeast cells were prepared from fresh cultures. Mice were inoculated intravenously with 2.5 x 104 Histoplasma yeast cells.

Media and antibodies
RPMI 1640 (HyClone, Logan, UT, USA) was supplemented with 10% heat-inactivated FCS (HyClone), 1 mM sodium pyruvate (GIBCO-BRL, Grand Island, NY, USA), 2 mM L-glutamine, 0.1 mM non-essential amino acids, 100 U ml–1 penicillin, 100 µg ml–1 streptomycin, 25 mM HEPES buffer and 5 x 10–5 mM 2-mercaptoethanol (Sigma–Aldrich, St Louis, MO, USA). Purified anti-mouse CD16/32 mAb (clone 93), FITC-conjugated mAbs to CD4 (RM4-5), CD8 (53-6.7), CD3 (145.2C11) and CD25 (PC61.5), PE-conjugated mAbs to IFN-{gamma} (XMG1.2), IL-4 (11B11) and IL-10 (JES5-16E3) and allophycocyanin-conjugated mAbs to CD4 (GK1.5) were purchased from eBioscience (San Diego, CA, USA). PE-conjugated rat IgG1 and rat IgG2b (eBioscience) were used as isotype controls.

Experimental design
To detect G{alpha}M{delta}-induced cytokine production, mice were given two intraperitoneal injections of G{alpha}M{delta}, 0.3 ml each, on days 0 and 6. Before the second injection, mice were bled and the sera were collected for the determination of IgE levels. Expression of IL-4, IL-10 and IFN-{gamma} mRNA in the spleen was determined by competitive reverse transcription (RT)–PCR. At day 12, G{alpha}M{delta}-induced IL-4- , IL-10- and IFN-{gamma}-producing cells were analyzed by flow cytometry. Normal goat serum (Biological Industries, Israel) was used as control. To determine the effect of G{alpha}M{delta} on Histoplasma infection, mice were given two intraperitoneal injections of G{alpha}M{delta} on days –6 and –1 and infected intravenously with Histoplasma on day 0. At different time points after infection, spleens were harvested and homogenized for fungous counts and single-cell suspensions were prepared for immunostaining.

RT–PCR
Briefly, total RNA was extracted from spleens with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instruction. Five micrograms of total RNA was reverse-transcribed with SuperscriptTM II RNase H reverse transcriptase (Invitrogen) and oligo-dT primer. Serial 2-fold dilutions of a known concentration of competitor cDNA pMUS-3 (21) and an appropriate dilution of the sample cDNA were simultaneously amplified in the same PCR. The relative amount of the two PCR products is used to determine the concentration of input WT cDNA relative to the known concentration of the competitor. WT and pMUS-3 template DNA for a housekeeping gene, ß2-microglobulin (ß2-m), provided an internal control. Sequences of the primers used were: IL-4: sense primer, TCGGCATTTTGAACGAGGTC; antisense primer, GAAAAGCCCGAAAGAGTCTC (PCR product 216 bp); IL-10: sense primer, ATGCAGGACTTTAAGGGTTACTTG; antisense primer, TAGACACCTTGGTCTTGGAGCTTA (PCR product 254 bp); IFN-{gamma}: sense primer, GCTCTGAGACAATGAACGCT; antisense primer, AAAGAGATAATCTGGCTCTGC (PCR product 227 bp); ß2-m: sense primer, TGACCGGCTTGTATGCTATC; antisense primer, CAGTGTGAGCCAGGATATAG (PCR product 222 bp). Cycling conditions were: 94°C for 5 min, one cycle, and 94°C for 50 s, 60°C for 45 s, 72°C for 45 s, 40 cycles, followed by final extension at 72°C for 10 min. Cytokine mRNA was then normalized against ß2-m mRNA. Fold increase of cytokine mRNA in G{alpha}M{delta}-treated mice was determined against cytokine mRNA in control serum-treated mice.

To determine inducible nitric oxide synthase (iNOS) and arginase mRNA expression, peritoneal macrophages were harvested from Histoplasma-infected mice with G{alpha}M{delta} or control serum treatment. Total RNA was extracted and reverse-transcribed as described above. cDNA was amplified in the presence of iNOS (22) and arginase I (23) primer sets. hypoxanthine-guanine phosphoribosyl transferase (HPRT) was used as control. Sequences of primers were: iNOS: sense primer, 5'-TGGGAATGGAGACTGTCCCAG-3'; antisense primer, 5'-GGGATCTGAATGTGATGTTTG-3' (PCR product 306 bp); arginase I: sense primer, 5'-CAGAAGAATGGAAGAGTCAG-3'; antisense primer, 5'-CAGATATGCAGGGAGTCACC-3' (PCR product 250 bp); HPRT: sense primer, 5'-GTTGGATACAGGCCAGACTTTGTTG-3'; antisense primer, 5'-TCGGTATCCGGTCGGATGGGAG-3' (PCR product 352 bp). Cycling conditions for iNOS were: 94°C for 3 min, one cycle, and 94°C for 30 s, 56°C for 45 s, 72°C for 20 s, 35 cycles; for arginase I the conditions were: 94°C for 5 min, one cycle, and 94°C for 20 s, 56°C for 20 s, 72°C for 30 s, 35 cycles; for HPRT the conditions were: 94°C for 3 min, one cycle, and 94°C for 30 s, 58°C for 45 s, 72°C for 20 s, 33 cycles. All three conditions were followed by a final extension at 72°C for 10 min. The PCR products were run on a 2% agarose gel, stained with ethidium bromide and analyzed by Bio-Rad Quality One® Software. The relative ratio of iNOS or arginase I to HPRT was calculated as iNOS/HPRT or arginase I/HPRT.

Measurement of polyclonal serum IgE levels
Polyclonal serum IgE concentrations were determined by ELISA. In brief, 96-well ELISA plates (Corning, Corning, NY, USA) were coated with 50 µl of rat anti-mouse IgE antibody (Igh-Ca and Igh-Cb haplotypes, BD PharMingen, San Diego, CA, USA) (5 µg ml–1). After blocking, diluted serum samples (50 µl per well) from untreated or G{alpha}M{delta}-treated mice were added. After overnight incubation at 4°C, biotinylated anti-mouse IgE detection antibody at 2 µg ml–1 (BD PharMingen) was added. Streptavidin–alkaline phosphatase (BD PharMingen) was added to the wells and p-nitrophenyl phosphate (pNPP) substrate was added for color development. Light absorbance was read at 405 nm. The IgE concentrations in the serum samples were calculated from the standard curve established by using known concentrations of purified mouse IgE (BD PharMingen).

Fungous counts
Spleens and lungs were homogenized in RPMI 1640 medium, and 10-fold serially diluted. One hundred microliters of diluted homogenates were plated onto Sabouraud's agar plates containing 0.1% (w/v) bactopeptone, 0.2% (w/v) dextrose and 0.2% (w/v) agar. The plates were incubated at 30°C and the colony-forming units were enumerated 7–10 days later.

IFN-{gamma} ELISA
Spleen cells were collected from normal or infected mice that had been treated with G{alpha}M{delta} or control goat serum, and single-cell suspensions were prepared. Heat-killed (60°C, 2 h) Histoplasma yeast cells were added to the spleen cell cultures (1 x 107 ml–1) at a 1 : 40 yeast to spleen cell ratio. Culture supernatants were collected at 24 h of culture and stored at –80°C. The IFN-{gamma} concentration in the culture supernatants was determined by an ELISA kit (eBioscience).

Intracytoplasmic cytokine staining for IL-4- , IL-10- and IFN-{gamma}-producing cells and flow cytometric analysis
To detect Histoplasma-specific cytokine-producing cells, spleen cells were collected from normal and infected mice with G{alpha}M{delta} or control serum treatment and cultured in medium alone or in medium containing heat-killed Histoplasma yeast cells for 24 h. During the last 6 h of culture, 3 µM monensin (Sigma) was added. Cells were then harvested, blocked with purified anti-CD16/CD32 and stained with 1 µg ml–1 FITC-conjugated anti-CD4 or anti-CD8 and 1 µg ml–1 of PE-conjugated anti-IFN-{gamma}, anti-IL-4 or anti-IL-10 mAbs. The percentage of CD4+ or CD8+ cells or non-CD4, -CD8 cells expressing cytoplasmic IFN-{gamma} was determined by flow cytometry (FACSCalibur, BD Biosciences, Mountain View, CA) and analyzed with the CellQuest software program. The number of IFN-{gamma}- or IL-4-producing cells was calculated by multiplying the total number of spleen cells by the percentage of IFN-{gamma}-positive or IL-4-positive cells.

To detect G{alpha}M{delta}-induced intracytoplasmic IL-4-, IL-10- and IFN-{gamma}-producing cells, spleen cells were collected from mice 6 days after the second G{alpha}M{delta} injection or at different time points after infection. Spleen cells were cultured in complete RPMI medium containing 0.4 ng ml–1 recombinant human IL-2 for 24 h without antigenic stimulants. Monensin was added during the last 6 h of culture. Intracytoplasmic staining was performed as described above. To determine the percentage of IL-10-producing cells, spleen cells were harvested from G{alpha}M{delta}-treated or -untreated mice, and stained with FITC-conjugated anti-F4/80, or allophycocyanin-conjugated anti-CD4 and FITC-conjugated anti-CD25, and PE-conjugated anti-IL-10 mAbs.

Statistical analysis
Student's t-test was used for statistical analysis. P values <0.01 were considered significant. All data were expressed as mean ± standard deviation.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Histoplasma infection induces a dominant type-1 response
Mice were given an intravenous inoculation of Histoplasma yeast cells. Flow cytometric analysis showed that Histoplasma-specific IFN-{gamma}-producing cells developed in the spleen at as early as day 3 of infection (Fig. 1A). The peak of IFN-{gamma} response was at day 14 and remained high until day 21 (Fig. 1A). On the contrary, only low numbers of Histoplasma-specific IL-4-producing cells were detectable during the course of infection (Fig. 1A). Therefore, infection by Histoplasma induced a dominant type-1 cytokine response. In addition, IFN-{gamma}-deficient mice, in contrast to WT mice, were unable to reduce the fungal load (Fig. 1B), confirming the importance of IFN-{gamma}. IL-4 or IL-10 deficiency, on the other hand, did not affect the clearance of the fungus (Fig. 1C). These data show that a polarized type-1 response is induced in mice infected with Histoplasma. By using this model, we investigated whether the presence of antagonistic cytokines would change the polarity of T cells.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. IFN-{gamma} response is induced in Histoplasma-infected mice. (A) Spleen cells were harvested from WT mice at different time points after Histoplasma infection and cultured in medium containing heat-killed Histoplasma yeast cells for 24 h. Intracytoplasmic IFN-{gamma} and IL-4 were detected by cytokine staining as described in Methods. n = 3–10 for each time point were pooled from three independent experiments. (B) Fungous counts in the spleens of Histoplasma-infected WT and IFN-{gamma}–/– mice were enumerated at days 7 and 14 after infection. n = 6–10 for each time point were pooled from three independent experiments (*P < 0.0001 as compared with infected WT mice). (C) Fungous counts in the spleens of Histoplasma-infected WT, IL-4–/– and IL-10–/– mice were enumerated at day 14 after infection. n = 9–16 for each time point were pooled from three independent experiments.

 
G{alpha}M{delta} treatment induces a dominant type-2 cytokine response
It has been reported that immunization with G{alpha}M{delta} induces the expression of multiple cytokines with type-2 dominance (15). To study the effects of antagonistic cytokines on type-1 cytokine response to Histoplasma infection, we used G{alpha}M{delta} to create a strong type-2 cytokine milieu in mice. Since G{alpha}M{delta}-induced cytokine expression is transient (15), and clearance of Histoplasma takes a few weeks (24), we sought to prolong the expression of Th2 cytokines in mice by injecting mice a second time with G{alpha}M{delta}, 6 days after the initial injection. Competitive RT–PCR assay revealed that G{alpha}M{delta} treatment up-regulated the expression of type-2 cytokines in the spleen. IL-4 and IL-10 mRNAs increased 26.9- and 7.0-fold, respectively. In contrast, the expression of IFN-{gamma} mRNA increased by only 2.7-fold (Fig. 2A and B). These results are consistent with published data showing IL-4 and IL-10 mRNAs increased as early as day 3 after G{alpha}M{delta} treatment with peaks at days 5 and 6 (15). Consistent with the IL-4 response, serum IgE levels were high (13.36 ± 2.04 µg ml–1) in immunized mice as compared with untreated controls (0.11 ± 0.02 µg ml–1). Flow cytometric analysis of intracytoplasmic cytokine staining revealed that 6 days after the second G{alpha}M{delta} injection, spleen cells in cultures containing IL-2, without further stimulation, constitutively produced IL-4, IL-10 and IFN-{gamma} (Fig. 2C). These results confirmed that G{alpha}M{delta} treatment created a dominant type-2 cytokine environment in the spleen. By using G{alpha}M{delta}, we then studied how these cytokines affect the differentiation of IFN-{gamma}-producing T cells in response to Histoplasma infection.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 2. G{alpha}M{delta} treatment induces a dominant type-2 cytokine response. Mice were given two intraperitoneal injections of G{alpha}M{delta} or control serum at days 0 and 6. At day 6 after the second injection, spleens were removed. (A and B) Total RNAs were extracted from spleen cells and 5 µg RNA was reversely transcribed for competitive PCR using pMUS-3 as competitor. The experiment was repeated four times. (A) Competitive RT–PCR. The Arabic numerals denote the order of 2-fold dilutions. Asterisk marks the dilution where the concentration of WT PCR product is equal to that of competitor PCR products. Results of one representative are shown. (B) The bar graph shows fold increase of cytokine mRNA expression in G{alpha}M{delta}-treated mice against control serum-treated mice. Results of three (control serum-treated) to nine (G{alpha}M{delta}-treated) mice were pooled from three independent experiments (*P < 0.01 as compared with control serum-treated mice). (C) IL-4, IL-10 and IFN-{gamma}-producing cells are found in the spleens of G{alpha}M{delta}-treated mice. Results of one representative mouse are shown. The experiment was repeated at least four times.

 
G{alpha}M{delta} treatment profoundly suppresses Histoplasma-induced IFN-{gamma} response
Mice were infected with Histoplasma 1 day after the second G{alpha}M{delta} injection when the antagonistic cytokine levels were high. Intracytoplasmic cytokine staining demonstrated that G{alpha}M{delta} treatment significantly reduced the number of both CD4+ and CD8+ IFN-{gamma}-producing cells (Fig. 3A) as well as CD4CD8 IFN-{gamma}-producing cells in Histoplasma-infected mice. The total number of IFN-{gamma}-producing cells in mice receiving control serum was (18.4 ± 6.9) x 105 and that in G{alpha}M{delta}-treated mice was (5.9 ± 2.9) x 105, of which CD4CD8 IFN-{gamma}-producing cells constituted one-tenth of the former and one-twentieth of the latter (data not shown). ELISA measurement of splenocyte IFN-{gamma} secretion supported the intracytoplasmic staining results (Fig. 3B). In addition, analysis of the mean fluorescence intensity of intracellular IFN-{gamma} staining, an indicator of IFN-{gamma} production at the single-cell level, demonstrated that G{alpha}M{delta} treatment decreased the quantity of IFN-{gamma} produced by individual, Histoplasma-stimulated IFN-{gamma}-producing T cells (WT in Fig. 5B and C). These results demonstrate that G{alpha}M{delta} treatment prior to infection creates a cytokine environment that inhibits the generation of Histoplasma-specific IFN-{gamma}-producing T cells and their production of IFN-{gamma}. Since Histoplasma infection requires a type-1 response for clearance, we then examined how the presence of antagonistic cytokines affects fungal clearance.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3. G{alpha}M{delta} treatment reduces the number of Histoplasma-specific IFN-{gamma}-producing cells in the spleen. (A) Mice were infected by Histoplasma after two intraperitoneal injections of G{alpha}M{delta}. On days 7 and 14 after infection, spleens were cultured in medium containing heat-killed Histoplasma yeast cells for 24 h. The CD4+ and CD8+ IFN-{gamma}-producing cells were detected by intracytoplasmic and cell surface staining. The horizontal lines indicate the mean (*P < 0.01, **P < 0.001, ***P < 0.0001 comparing mice receiving G{alpha}M{delta} treatment with those receiving control serum treatment). (B) IFN-{gamma} production in 24-h spleen cell culture supernatants from infected mice treated with G{alpha}M{delta} or control serum. The data presented are the net IFN-{gamma} concentrations obtained by subtracting the IFN-{gamma} concentrations in cultures with medium alone from that in cultures containing heat-killed yeasts. The background IFN-{gamma} concentration was in the range of 0.01–1.06 ng ml–1 in control serum-treated group and 0.35–1.73 ng ml–1 in G{alpha}M{delta}-treated group. Ten to 17 mice were included in each group. The experiment was repeated three times (**P < 0.001, ***P < 0.0001 comparing G{alpha}M{delta}-treated mice with those treated with control serum).

 


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5. The suppressive effect of G{alpha}M{delta} treatment on the generation of IFN-{gamma} response is partially reversed in IL-4–/– mice. (A) Spleen cells were harvested from WT and IL-4–/– mice treated with G{alpha}M{delta} or control serum at day 14 after infection. Filled symbols represent spleen cells from either Histoplasma-infected WT mice (circle) or IL-4–/– mice (diamond) treated with G{alpha}M{delta}, and open symbols represent cells from infected WT mice (circle) or IL-4 mice (diamond) treated with control serum. The horizontal lines indicate the mean (#P < 0.05, *P < 0.01, **P < 0.001 comparing IFN-{gamma}-producing cells in the spleen of IL-4–/– mice with that in WT mice). (B) Dot plots show the intensity of IFN-{gamma} staining of spleen cells from infected WT or IL-4–/– mice treated with either G{alpha}M{delta} or control serum at day 14 after infection. The numbers above the dot plots are the mean fluorescence intensity (MFI) of IFN-{gamma} staining in CD4+ and CD8+ T cells. Results of three (control serum-treated) to four (G{alpha}M{delta}-treated) mice were pooled from three independent experiments. One representative experiment is shown. (C) The bar graph shows MFI of IFN-{gamma} staining in CD4+ or CD8+ T cells. Results presented are from one of three experiments. Three to six mice were included in each experiment (*P < 0.01, **P < 0.001 comparing values obtained from G{alpha}M{delta}-treated WT mice with those from IL-4–/– mice, or values from IL-4–/– G{alpha}M{delta}-treated mice with those from IL-4–/– control serum-treated mice). (D) IFN-{gamma} production by spleen cells from Histoplasma-infected IL-4–/– mice treated with either G{alpha}M{delta} or control serum. Spleen cells were harvested from mice at day 7 after infection. Culture supernatant was collected at 24 h and the IFN-{gamma} production was determined by ELISA. Eight to nine mice were included in each group (*P < 0.01 comparing G{alpha}M{delta}-treated mice with those treated with control serum).

 
G{alpha}M{delta} treatment retards fungal clearance
The fungal burdens in G{alpha}M{delta}-treated mice were compared with those in the control mice at different time points. Figure 4(A) and Table 1 show that fungal burdens in the spleens of mice given G{alpha}M{delta} treatment were significantly higher than in the control mice from the first time point on. The fungal burdens in control mice peaked at day 7 of infection and then decreased by a factor >10 by day 14, showing that these mice acquired the ability to clear the fungus after day 7. In contrast, fungal burdens in G{alpha}M{delta}-treated mice rose from day 3 through day 14, demonstrating that the mice were unable to control the infection. Moreover, G{alpha}M{delta} treatment not only increased fungal burdens in the spleen but also that in the lungs (Fig. 4B and Table 1). Thus, reduction of IFN-{gamma}-producing cells by G{alpha}M{delta} treatment results in retarded fungal clearance.



View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4. G{alpha}M{delta} treatment retards fungal clearance. After two intraperitoneal injections of G{alpha}M{delta}, mice were infected by Histoplasma. Fungous counts in the spleens (A) and lungs (B) were enumerated at days 3, 5, 7 and 14 after infection. Four to 10 mice from three independent experiments were included in each group (#P < 0.05,*P < 0.01, ***P < 0.0001 comparing G{alpha}M{delta}-treated mice with those treated with control serum).

 

View this table:
[in this window]
[in a new window]
 
Table 1. Fungal counts in mice with or without G{alpha}M{delta} treatment

 
IL-4 is partially responsible for G{alpha}M{delta}-induced suppression
We then employed mice with cytokine gene defects to identify the cytokines that suppress the generation of IFN-{gamma}-producing cells. While the number of Histoplasma-specific IFN-{gamma}-producing T cells was not much different between Histoplasma-infected WT and IL-4–/– mice that had received control goat serum (P = 0.04, Fig. 5A), the number of Histoplasma-specific IFN-{gamma}-producing T cells was significantly higher in G{alpha}M{delta}-treated IL-4–/– mice than in G{alpha}M{delta}-treated WT mice (P < 0.001 for CD4+ T cells and P = 0.01 for CD8+ T cells, Fig. 5A). Thus, IL-4 contributes to G{alpha}M{delta}-induced inhibition of the generation of IFN-{gamma}-producing T cells in Histoplasma-infected mice. However, additional factor(s) must be involved in G{alpha}M{delta} inhibition of the Histoplasma-induced IFN-{gamma} response because G{alpha}M{delta} still partially suppressed Histoplasma-induced IFN-{gamma} production in the absence of IL-4. Analysis of the intracytoplasmic levels of IFN-{gamma} in individual cells by flow cytometry demonstrated that G{alpha}M{delta} treatment reduced the quantity of IFN-{gamma} made by IFN-{gamma}-producing CD4+ and CD8+ T cells from WT mice infected with Histoplasma (Fig. 5B and C). The suppressive effect of G{alpha}M{delta} on the generation of IFN{gamma}-producing cells as well as that on the quantity of IFN{gamma} produced by individual cells were partially reversed in IL-4–/– mice (Fig. 5A–C). Results of ELISA measurement of IFN-{gamma} secreted also supported this conclusion as IFN-{gamma} production by Histoplasma-infected IL-4–/– mice treated with G{alpha}M{delta} was 11.9 ± 7.9 ng ml–1 and that by those without G{alpha}M{delta} treatment was 30.6 ± 11.5 ng ml–1 (Fig. 5D).

IL-4 and IL-10 together mediate G{alpha}M{delta}-induced suppression of IFN-{gamma} response
Because IL-10 can inhibit CD4+ T cell cytokine production and proliferation (25) and IL-10 expression is induced by G{alpha}M{delta} (Fig. 2), we then determined whether IL-10 was the additional factor that mediates G{alpha}M{delta}-induced suppression of IFN-{gamma} production. As shown in Fig. 2, G{alpha}M{delta} induced IL-10 production. The source of IL-10 was mainly F4/80+ macrophages, while CD4+CD25+ T cells also contributed to IL-10 production (Fig. 6). We then generated mice defective in both the IL-4 and IL-10 genes and compared the numbers of Histoplasma-specific IFN-{gamma}-producing T cells in IL-4–/–IL-10–/– mice with that in WT, IL-4 and IL-10 single-gene knockout mice (Fig. 7A). While G{alpha}M{delta}-induced reduction of IFN-{gamma}-producing T cell number was partially reversed by selective deficiency of IL-4 or IL-10, it was totally absent in IL-4–/–IL-10–/– mice. Moreover, the effect of IL-4 and IL-10 on G{alpha}M{delta}-induced inhibition was also observed in CD4CD8 IFN-{gamma}-producing cells (Fig. 7A). In addition, deficiency of both IL-4 and IL-10 completely reversed G{alpha}M{delta}-induced suppression of the quantity of IFN-{gamma} made by individual IFN-{gamma}-producing CD8+ T cells and partially reversed the suppression of the quantity of IFN-{gamma} made by individual IFN-{gamma}-producing CD4+ T cells in Histoplasma-infected mice (Fig. 7B and C). ELISA measurement demonstrated that IFN-{gamma} secretion by Histoplasma-infected IL-4–/–IL-10–/– mice treated with G{alpha}M{delta} was 43.6 ± 3.2 ng ml–1, while that by those without treatment was 43.2 ± 19.6 ng ml–1 (Fig. 7D). Thus, both IL-4 and IL-10 mediate the suppressive effect of G{alpha}M{delta} on the generation of IFN-{gamma}-producing cells. However, although depletion of IL-4 and IL-10 reconstituted the IFN-{gamma} response, it only partially restored fungal clearance in the spleen and the lungs (Table 1).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 6. F4/80+ macrophages are major IL-10-producing cells in G{alpha}M{delta}-treated mice. Spleen cells were harvested from G{alpha}M{delta}-treated or untreated mice. The percentage of IL-10-producing cells was determined by staining with FITC-conjugated anti-F4/80 (A), or allophycocyanin-conjugated anti-CD4 and FITC-conjugated anti-CD25 (B) and PE-conjugated anti-IL-10 mAbs (A and B). Live cells (A) or IL-10+ cells (B) were gated for analysis.

 


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 7. G{alpha}M{delta}-induced suppression is reversed in IL-4–/–IL-10–/– mice. (A) Spleen cells were harvested from Histoplasma-infected WT (circle), IL-4–/– (diamond), IL-10–/– (triangle) and IL-4–/–IL-10–/– (square) mice treated with G{alpha}M{delta} (filled symbol) or control serum (open symbol) at day 14 after infection. Spleen cells were cultured in medium containing heat-killed Histoplasma yeast cells for 24 h. The horizontal lines indicate the means (#P < 0.05, *P < 0.01, **P < 0.001, ***P < 0.0001 comparing values obtained from G{alpha}M{delta}-treated mice with control serum-treated mice). (B) Dot plots show IFN-{gamma} staining of spleen cells from IL-4–/–IL-10–/– mice treated with G{alpha}M{delta} or control serum. Spleen cells were from Histoplasma-infected mice at day 14 after infection. The numbers above the dot plots are the mean fluorescence intensities (MFIs) of IFN-{gamma} staining in CD4+ or CD8+ T cells. (C) Bar graphs show MFI of IFN-{gamma} staining in CD4+ or CD8+ T cells. Three mice were included in each experiment. The experiment was repeated two times. Results of one representative experiment are shown (*P < 0.01 as compared with values obtained from mice treated with control serum). (D) IFN-{gamma} production by Histoplasma-infected IL-4–/–IL-10–/– mice treated with G{alpha}M{delta} or control serum. Three mice from three independent experiments were included in each group.

 
To evaluate whether the lower number of IFN-{gamma}-producing T cells in the spleens of G{alpha}M{delta}-treated, Histoplasma-infected mice was the result of poor T cell recruitment, we compared the numbers of splenic CD4+ and CD8+ T cells in uninfected and Histoplasma-infected mice that had been treated with G{alpha}M{delta} or control goat serum. There was no difference in the total numbers of CD4+ and CD8+ T cells in infected WT and cytokine gene-deficient mice with or without G{alpha}M{delta} treatment (data not shown). Thus, G{alpha}M{delta} suppression of the generation of IFN-{gamma}-producing T cells in Histoplasma-infected mice is not a result of poor T cell recruitment.

The presence of IL-4 and IL-10 during T cell priming does not change the ultimate polarity of type-1 T cells
Since cytokines present at the stage of TCR ligation are considered most critical in affecting the differentiation of naive T cells to become type-1 or type-2 T cells (2, 3), we investigated whether the presence of IL-4 and IL-10 during T cell priming for Histoplasma-specific response would change the polarity of T cells. We followed the temporal relationship between G{alpha}M{delta} induction of IL-4- and IL-10-producing cells and Histoplasma induction of IFN-{gamma}-producing cells. An inverse relationship between type-1 and type-2 T cell populations was observed (Fig. 8A). Although G{alpha}M{delta}-induced IFN-{gamma} was present in early phase of infection (between days 3 and 5), the numbers of Histoplasma-specific IFN-{gamma}-producing T cells rose after G{alpha}M{delta}-induced IL-4 and IL-10 waned (Fig. 8A). By day 21, the numbers of IFN-{gamma}-producing CD4+ and CD8+ T cells in G{alpha}M{delta}-treated, Histoplasma-infected mice were (7.0 ± 1.3) x 105 and (4.6 ± 2.1) x 105, respectively, approaching the numbers of CD4+ and CD8+ T cells in control serum-treated WT mice at day 14 of infection [(10.7 ± 3.9) x 105 CD4+ T cells and (5.0 ± 2.3) x 105 CD8+ T cells]. By this time, the fungal burden was reduced to a level close to that of control serum-treated mice (Fig. 8B). These results demonstrate that the presence of IL-4 and IL-10 during T cell priming suppresses the generation but does not change the ultimate polarity of type-1 T cells.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 8. The suppressive effect of G{alpha}M{delta} on the generation of IFN-{gamma}-producing type-1 T cells in Histoplasma-infected mice is transient. (A) The inverse relationship between IL-4- (closed circle) and IL-10- (closed triangle) producing cells to IFN-{gamma}- (open symbol) producing cells in G{alpha}M{delta}-treated Histoplasma-infected mice. Spleen cells were harvested from infected mice treated with G{alpha}M{delta} at days 3, 5, 7, 14 and 21 after infection. To stain for IL-4- and IL-10-producing cells, spleen cells were cultured in medium alone without addition of heat-killed yeasts. To stain for Histoplasma-specific IFN-{gamma}-producing cells, the cells were cultured in medium containing heat-killed yeasts. Data from three to seven mice of three experiments were pooled. (B) Fungous counts in the spleen or the lungs of WT mice treated with G{alpha}M{delta} (filled bar) or control serum (open bar) were enumerated at days 14 and 21 after infection. Data are expressed as means ± standard deviation. Results from six to seven mice of three experiments were pooled (*P < 0.01, ***P < 0.0001 comparing G{alpha}M{delta}-treated mice with control serum-treated mice).

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Investigators have used different approaches to study the effects of IL-4 and IL-10 on IFN-{gamma} responses to infection, but the conclusions drawn from different studies are not consistent. Mizuki et al. induced an OVA-specific Th2 response that converted a non-lethal Listeria monocytogenes infection to a lethal one (13). Anti-IL-10 but not anti-IL-4 antibody treatment of these mice increased resistance to the infection. Rakasz et al. studied IFN-{gamma}-producing cells in granuloma induced by Schistosoma infection (26). Treatment of these mice with anti-IL-10 or anti-transforming growth factor (TGF)-ß antibody plus recombinant IL-12 further increased the frequency of IFN-{gamma}-producing cells. Thus, IFN-{gamma}-producing cells are down-regulated by IL-10 and TGF-ß in this system (26). La Flamme et al. co-infected mice with Schistosoma and Leishmania and found that the resolution of Leishmania cutaneous lesions and parasitemia was delayed. Concurrent with delayed resolution was production of IL-4 and reduced amounts of IFN-{gamma}, tumor necrosis factor (TNF)-{alpha} and nitric oxide (14).

By pre-treating mice with G{alpha}M{delta}, we have shown that the presence of IL-4 and IL-10 during T cell priming suppresses the generation of IFN-{gamma}-producing cells in Histoplasma-infected mice. This suppression affected both the number of IFN-{gamma}-producing cells and the level of IFN-{gamma} made by each IFN-{gamma}-producing cell and retarded fungal clearance. However, as the effect of G{alpha}M{delta} wore off, the numbers of IL-4- and IL-10-producing cells declined, the number of IFN-{gamma}-producing cells rose and the fungus was cleared. By ruling out the possibility of poor T cell recruitment, our data suggest that the presence of IL-4 and IL-10 delays T cell priming toward type-1 T cells but does not ultimately suppress the generation of polarized type-1 T cells.

G{alpha}M{delta} treatment induces production of predominant type-2 cytokines (15). IL-4-producing cells were identified to be mostly CD4 T cells and basophils (27, 28). In this study, we identified the major source of G{alpha}M{delta}-induced IL-10 to be the macrophages, while CD4+CD25+, the putative regulatory T cells (29), constituted only a fraction of IL-10+ cells (Fig. 6A and B). Therefore, G{alpha}M{delta}-induced suppressive effect on type-1 cell development is mainly through the macrophages. Regardless of the source of IL-4 and IL-10, the suppressive effect of G{alpha}M{delta} is reversed in IL-4–/–IL-10–/– mice.

The clearance of Histoplasma is IFN-{gamma} (Fig. 1B) as well as TNF-{alpha} dependent (30). While the source of IFN-{gamma} is mainly CD4+ T cells and CD8+ T cells (Fig. 7A), TNF-{alpha} is produced by the macrophages (30) but not T cells (data not shown). Both IFN-{gamma} and TNF-{alpha} are crucial to macrophage iNOS expression and fungal clearance (31, 32). Interestingly, G{alpha}M{delta} treatment increases the expression of arginase mRNA (arginase/HPRT increased from 0.383 to 0.677) and reduces that of iNOS mRNA (iNOS/HPRT decreased from 0.297 to 0.134) in mice before infection. The suppressive effect of G{alpha}M{delta} on iNOS mRNA expression remains until day 7 after infection (iNOS/HPRT = 0.365 in G{alpha}M{delta}-treated versus 0.726 in untreated). By that time, the effect of G{alpha}M{delta} on arginase mRNA expression no longer exists (iNOS/HPRT = 0.643 in G{alpha}M{delta}-treated versus 0.765 in untreated). It appears that in the presence of IL-4 and IL-10, macrophage activation by alternative and/or deactivation pathway(s) occurs (33). When the effect of G{alpha}M{delta} wanes, the alternative pathway of macrophage activation also subsides. Concurrent with delayed T cell priming toward type-1 cells in G{alpha}M{delta}-treated mice, iNOS mRNA up-regulation is also delayed after Histoplasma infection. As a consequence, fungal clearance is retarded.

Although the cytokines present at the stage of TCR ligation are most critical in affecting the differentiation of naive T cells to become type-1 or type-2 T cells, the nature of the invading pathogen, the route and dose of the antigen given and the genetic background of the host are all important factors that affect T cell differentiation (2, 3). In our study, it appears that the presence of IL-4 and IL-10 during T cell priming in response to infection by Histoplasma suppressed the initial generation of IFN-{gamma}-producing cells but did not change the ultimate polarity of Histoplasma-specific T cells. Alternatively, the presence of IL-4 and IL-10 in early phase of infection delayed but did not affect the induction of IFN-{gamma}-producing cells. Interestingly, G{alpha}M{delta} administered during the course of infection did not change type-1 response or the outcome of infection (data not shown). Mocci and Coffman reported that polarized Leishmania-specific Th1 population was changed to Th2 by in vitro culture with a high concentration of IL-4 (34). While change of T cell polarity was possible in vitro, our results showed that the nature of the invading pathogen dictates the ultimate polarity of the responding T cells even when antagonistic cytokines are present.

Pathogens differ from soluble antigens in that the pathogens continue to replicate until effector T cells are induced and activated. As the pathogen replicates, the antigen dose increases. Although it is not clear what mechanism underlies the effects of antigen dose on T cell subset development, the possibility exists that high dose of Histoplasma antigen continues to stimulate IL-12 production by antigen-presenting cells. When antagonistic cytokines wane, the development of IFN-{gamma}-producing cells rapidly resumes.

The understanding of the effect of cytokines on T cell differentiation is mostly at the level of CD4+ T cells. In response to Histoplasma infection, not only CD4+ but also CD8+ T cells were activated to produce IFN-{gamma} (Fig. 4). It has been shown in T-bet knockout mice that IFN-{gamma} transcription is impaired in CD4+ T and NK cells but not in CD8+ T cells (35). It is eomesodermin, a member of the T-box gene family, that plays a major role in regulation of CD8 T cell IFN-{gamma} production (36). These data indicate that the regulation of IFN-{gamma} gene transcription in CD4+ and CD8+ T cells is controlled by distinct transcriptional mechanisms. Results in Fig. 7(B and C) showed that deficiency in both IL-4 and IL-10 completely reversed G{alpha}M{delta} suppression of the quantity of IFN-{gamma} made by individual IFN-{gamma}-producing CD8+ T cells and partially reversed G{alpha}M{delta} suppression of the quantity of IFN-{gamma} made by individual IFN-{gamma}-producing CD4+ T cells in Histoplasma-infected mice. It appears that G{alpha}M{delta} induces factor(s) other than IL-4 and IL-10 to suppress IFN-{gamma} production in individual CD4+ T cells. However, this factor(s) does not influence CD8+ T cell IFN-{gamma} production. These data showed that distinct yet overlapping sets of cytokines control CD4+ and CD8+ T cell IFN-{gamma} production.

It is interesting to note that the numbers of CD4+ and CD8+ IFN-{gamma}-producing cells in Histoplasma-infected IL-4–/–IL-10–/– mice treated with control serum are higher than in WT mice receiving the same treatment. This is consistent with what was observed in Schistosoma cercaria vaccine-induced immunity in IL-4–/–IL-10–/– mice (37), indicating that endogenous IL-4 and IL-10 negatively regulate the generation of IFN-{gamma}-producing cells. It remains to be determined why G{alpha}M{delta}-treated IL-4–/–IL-10–/– mice do not clear the infection as rapidly as those treated with control serum (Table 1). It is possible that clearance is not dependent on IFN-{gamma} production alone. Other factors like TNF-{alpha} have been shown to be important (38, 39). Another possible explanation is that lots of low IFN-{gamma}-producing cells may not produce enough IFN-{gamma} to ensure rapid clearance (Fig. 7).

A major conclusion of the present study is that IL-4 and IL-10 can be powerfully suppressive of the generation of antigen-specific IFN-{gamma}-producing cells in vivo. The type-2 cytokines present where and when T cells are primed delay the development but do not change the ultimate polarity of type-1 cells. One implication of these findings is that hosts that mount a dominant type-2 cytokine response as a result of helminth infection or exposure to an allergen may make inadequate type-1 cytokine responses to control infectious agents that require a type-1 cytokine response. However, should the type-2 immune response wane, the type-1 cytokine-dependent host defense mechanism can be restored.


    Acknowledgements
 
This work was supported by National Science Council Grants NSC 89-2320-B-002-060, -205, NSC 90-2320-B-002-014, NSC 91-2320-B-002-096 and NSC 92-2320-B-002-178, Republic of China. We thank Dr. Shi-Chuen Miaw for helpful discussion on this manuscript.


    Abbreviations
 
G{alpha}M{delta}   goat anti-mouse IgD
iNOS   inducible nitric oxide synthase
ß2-m   ß2-microglobulin
OVA   ovalbumin peptide
TGF   transforming growth factor
TNF   tumor necrosis factor
WT   wild type

    Notes
 
Transmitting editor: A. Cooke

Received 31 March 2004, accepted 25 November 2004.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Abbas, A. K., Murphy, K. M. and Sher, A. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[CrossRef][Medline]
  2. Glimcher, L. H. and Murphy, K. M. 2000. Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev. 14:1693.[Free Full Text]
  3. O'Garra, A. 1998. Cytokines induce the development of functionally heterogeneous T helper cell subsets. Immunity 8:275.[CrossRef][Web of Science][Medline]
  4. Mosmann, T. R. and Coffman, R. L. 1989. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties. Annu. Rev. Immunol. 7:145.[CrossRef][Web of Science][Medline]
  5. Mosmann, T. R., Cherwinski, H., Bond, M. W., Giedlin, M. A. and Coffman, R. L. 1986. Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. Immunol. 136:2348.[Abstract]
  6. Croft, M., Carter, L., Swain, S. L. and Dutton, R. W. 1994. Generation of polarized antigen-specific CD8 effector populations: reciprocal action of interleukin (IL)-4 and IL-12 in promoting type 2 versus type 1 cytokine profiles. J. Exp. Med. 180:1715.[Abstract/Free Full Text]
  7. Sad, S., Marcotte, R. and Mosmann, T. R. 1995. Cytokine-induced differentiation of precursor mouse CD8+ T cells into cytotoxic CD8+ T cells secreting Th1 or Th2 cytokines. Immunity 2:271.[CrossRef][Web of Science][Medline]
  8. Paludan, S. R. 1998. Interleukin-4 and interferon-gamma: the quintessence of a mutual antagonistic relationship. Scand. J. Immunol. 48:459.[CrossRef][Web of Science][Medline]
  9. Shirakawa, T., Enomoto, T., Shimazu, S. and Hopkin, J. M. 1997. The inverse association between tuberculin responses and atopic disorder. Science 275:77.[Abstract/Free Full Text]
  10. Erb, K. J., Holloway, J. W., Sobeck, A., Moll, H. and Le Gros, G. 1998. Infection of mice with Mycobacterium bovis-Bacillus Calmette-Guerin (BCG) suppresses allergen-induced airway eosinophilia. J. Exp. Med. 187:561.[Abstract/Free Full Text]
  11. Wang, C. C. and Rook, G. A. 1998. Inhibition of an established allergic response to ovalbumin in BALB/c mice by killed Mycobacterium vaccae. Immunology 93:307.[CrossRef][Web of Science][Medline]
  12. Hansen, G., Yeung, V. P., Berry, G., Umetsu, D. T. and DeKruyff, R. H. 2000. Vaccination with heat-killed Listeria as adjuvant reverses established allergen-induced airway hyperreactivity and inflammation: role of CD8+ T cells and IL-18. J. Immunol. 164:223.[Abstract/Free Full Text]
  13. Mizuki, D., Miura, T., Sasaki, S., Mizuki, M., Madarame, H. and Nakane, A. 2001. Interference between host resistance to Listeria monocytogenes infection and ovalbumin-induced allergic responses in mice. Infect. Immun. 69:1883.[Abstract/Free Full Text]
  14. La Flamme, A. C., Scott, P. and Pearce, E. J. 2002. Schistosomiasis delays lesion resolution during Leishmania major infection by impairing parasite killing by macrophages. Parasite Immunol. 24:339.[CrossRef][Web of Science][Medline]
  15. Svetic, A., Finkelman, F. D., Jian, Y. C. et al. 1991. Cytokine gene expression after in vivo primary immunization with goat antibody to mouse IgD antibody. J. Immunol. 147:2391.[Abstract]
  16. Wu-Hsieh, B. A. and Howard, D. H. 1987. Inhibition of the intracellular growth of Histoplasma capsulatum by recombinant murine gamma interferon. Infect. Immun. 55:1014.[Abstract/Free Full Text]
  17. Allendoerfer, R. and Deepe, G. S., Jr 1997. Intrapulmonary response to Histoplasma capsulatum in gamma interferon knockout mice. Infect. Immun. 65:2564.[Abstract/Free Full Text]
  18. Zhou, P., Sieve, M. C., Bennett, J. et al. 1995. IL-12 prevents mortality in mice infected with Histoplasma capsulatum through induction of IFN-gamma. J. Immunol. 155:785.[Abstract]
  19. Kuhn, R., Rajewsky, K. and Muller, W. 1991. Generation and analysis of interleukin-4 deficient mice. Science 254:707.[Abstract/Free Full Text]
  20. Kuhn, R., Lohler, J., Rennick, D., Rajewsky, K. and Muller, W. 1993. Interleukin-10-deficient mice develop chronic enterocolitis. Cell 75:263.[CrossRef][Web of Science][Medline]
  21. Bouaboula, M., Legoux, P., Pessegue, B. et al. 1992. Standardization of mRNA titration using a polymerase chain reaction method involving co-amplification with a multispecific internal control. J. Biol. Chem. 267:21830.[Abstract/Free Full Text]
  22. Wu-Hsieh, B. A., Chen, W. and Lee, H. J. 1998. Nitric oxide synthase expression in macrophages of Histoplasma capsulatum-infected mice is associated with splenocyte apoptosis and unresponsiveness. Infect. Immun. 66:5520.[Abstract/Free Full Text]
  23. Munder, M., Eichmann, K., Moran, J. M., Centeno, F., Soler, G. and Modolell, M. 1999. Th1/Th2-regulated expression of arginase isoforms in murine macrophages and dendritic cells. J. Immunol. 163:3771.[Abstract/Free Full Text]
  24. Wu-Hsieh, B. 1989. Relative susceptibilities of inbred mouse strains C57BL/6 and A/J to infection with Histoplasma capsulatum. Infect. Immun. 57:3788.[Abstract/Free Full Text]
  25. D'Andrea, A., Aste-Amezaga, M., Valiante, N. M., Ma, X., Kubin, M. and Trinchieri, G. 1993. Interleukin 10 (IL-10) inhibits human lymphocyte interferon gamma-production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells. J. Exp. Med. 178:1041.[Abstract/Free Full Text]
  26. Rakasz, E., Blum, A. M., Metwali, A. et al. 1998. Localization and regulation of IFN-gamma production within the granulomas of murine schistosomiasis in IL-4-deficient and control mice. J. Immunol. 160:4994.[Abstract/Free Full Text]
  27. Seder, R. A., Paul, W. E., Dvorak, A. M. et al. 1991. Mouse splenic and bone marrow cell populations that express high-affinity Fc epsilon receptors and produce interleukin 4 are highly enriched in basophils. Proc. Natl Acad. Sci. USA 88:2835.[Abstract/Free Full Text]
  28. Le Gros, G., Ben-Sasson, S. Z., Seder, R., Finkelman, F. D. and Paul, W. E. 1990. Generation of interleukin 4 (IL-4)-producing cells in vivo and in vitro: IL-2 and IL-4 are required for in vitro generation of IL-4-producing cells. J. Exp. Med. 172:921.[Abstract/Free Full Text]
  29. O'Garra, A. and Vieira, P. 2004. Regulatory T cells and mechanisms of immune system control. Nat. Med. 10:801.[CrossRef][Web of Science][Medline]
  30. Wu-Hsieh, B. A., Lee, G. S., Franco, M. and Hofman, F. M. 1992. Early activation of splenic macrophages by tumor necrosis factor alpha is important in determining the outcome of experimental histoplasmosis in mice. Infect. Immun. 60:4230.[Abstract/Free Full Text]
  31. Lane, T. E., Wu-Hsieh, B. A. and Howard, D. H. 1994. Antihistoplasma effect of activated mouse splenic macrophages involves production of reactive nitrogen intermediates. Infect. Immun. 62:1940.[Abstract/Free Full Text]
  32. Lane, T. E., Otero, G. C., Wu-Hsieh, B. A. and Howard, D. H. 1994. Expression of inducible nitric oxide synthase by stimulated macrophages correlates with their antihistoplasma activity. Infect. Immun. 62:1478.[Abstract/Free Full Text]
  33. Gordon, S. 2003. Alternative activation of macrophages. Nat. Rev. Immunol. 3:23.[CrossRef][Web of Science][Medline]
  34. Mocci, S. and Coffman, R. L. 1995. Induction of a Th2 population from a polarized Leishmania-specific Th1 population by in vitro culture with IL-4. J. Immunol. 154:3779.[Abstract]
  35. Szabo, S. J., Sullivan, B. M., Stemmann, C., Satoskar, A. R., Sleckman, B. P. and Glimcher, L. H. 2002. Distinct effects of T-bet in TH1 lineage commitment and IFN-gamma production in CD4 and CD8 T cells. Science 295:338.[Abstract/Free Full Text]
  36. Pearce, E. L., Mullen, A. C., Martins, G. A. et al. 2003. Control of effector CD8+ T cell function by the transcription factor Eomesodermin. Science 302:1041.[Abstract/Free Full Text]
  37. Hoffmann, K. F., James, S. L., Cheever, A. W. and Wynn, T. A. 1999. Studies with double cytokine-deficient mice reveal that highly polarized Th1- and Th2-type cytokine and antibody responses contribute equally to vaccine-induced immunity to Schistosoma mansoni. J. Immunol. 163:927.[Abstract/Free Full Text]
  38. Wu-Hsieh, B. A., Lee, G. S., Franco, M. and Hofman, F. M. 1992. Early activation of splenic macrophages by tumor necrosis factor alpha is important in determining the outcome of experimental histoplasmosis in mice. Infect. Immun. 60:4230.[Abstract/Free Full Text]
  39. Zhou, P., Miller, G. and Seder, R. A. 1998. Factors involved in regulating primary and secondary immunity to infection with Histoplasma capsulatum: TNF-alpha plays a critical role in maintaining secondary immunity in the absence of IFN-gamma. J. Immunol. 160:1359.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Infect. Immun.Home page
A. J. Guimaraes, S. Frases, F. J. Gomez, R. M. Zancope-Oliveira, and J. D. Nosanchuk
Monoclonal Antibodies to Heat Shock Protein 60 Alter the Pathogenesis of Histoplasma capsulatum
Infect. Immun., April 1, 2009; 77(4): 1357 - 1367.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. S. Deepe Jr. and R. S. Gibbons
TNF-{alpha} Antagonism Generates a Population of Antigen-Specific CD4+CD25+ T Cells That Inhibit Protective Immunity in Murine Histoplasmosis
J. Immunol., January 15, 2008; 180(2): 1088 - 1097.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
17/2/193    most recent
dxh200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Peng, J.-K.
Right arrow Articles by Wu-Hsieh, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Peng, J.-K.
Right arrow Articles by Wu-Hsieh, B. A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?