International Immunology Advance Access originally published online on November 15, 2005
International Immunology 2005 17(12):1619-1629; doi:10.1093/intimm/dxh342
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Preferential Th2 polarization by OCH is supported by incompetent NKT cell induction of CD40L and following production of inflammatory cytokines by bystander cells in vivo
Department of Immunology, National Institute of Neuroscience, NCNP, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187-8502, Japan
Correspondence to: S. Miyake; E-mail: miyake{at}ncnp.go.jp
| Abstract |
|---|
|
|
|---|
The altered glycolipid ligand OCH is a selective inducer of Th2 cytokines from NKT cells and a potent therapeutic reagent for Th1-mediated autoimmune diseases. Although we have previously shown the intrinsic molecular mechanism of preferential IL-4 production by OCH-stimulated NKT cells, little is known about the extrinsic regulatory network for IFN-
production. Here we demonstrate that OCH induces lower production of IFN-
, not only by NKT cells but also by NK cells compared with
-galactosylceramide. OCH induced lower IL-12 production due to ineffective primary IFN-
and CD40 ligand expression by NKT cells, and resulted in lower secondary IFN-
induction. Co-injection of a sub-optimal dose of IFN-
and stimulatory anti-CD40 mAb compensates for the lower induction of IL-12 by OCH administration. IL-12 converts OCH-induced cytokine expression from IL-4 predominance to IFN-
predominance. Furthermore, CpG oligodeoxynucleotide augmented IL-12 production when co-administrated with OCH, resulting in increased IFN-
production. Taken together, the lower IL-12 production and subsequent lack of secondary IFN-
burst support the effective Th2 polarization of T cells by OCH. In addition, highlighted in this study is the characteristic property of OCH that can induce the differential production of IFN-
or IL-4 according to the availability of IL-12.
Keywords: cell activation, cytokines, inflammation, natural killer, rodent, T cells
| Introduction |
|---|
|
|
|---|
NKT cells are a unique subset of CD1d-restricted T lymphocytes that express TCR and some NKR. NKT cells recognize glycolipid antigens such as
-galactosylceramide (
GC) by an invariant TCR
chain composed of V
14-J
18 segments in mice and V
24-J
18 segments in humans, associated with TCRß chains using a restricted set of Vß genes (1, 2). NKT cells rapidly secrete large amounts of cytokines including IL-4 and IFN-
upon antigen stimulation and are effective regulators of Th1/Th2 balance in vivo (35). We have previously demonstrated that in vivo administration to mice of altered glycolipid ligand, OCH, ameliorates experimental autoimmune encephalomyelitis (EAE), collagen-induced arthritis (CIA) and type I diabetes by enhancing IL-4-dependent Th2 responses without inducing IFN-
production and pathogenic Th1 responses (68).
Recently, we have clarified the intrinsic molecular mechanism of preferential IL-4 production by OCH-stimulated NKT cells (9). IFN-
production by NKT cells was more susceptible to the sphingosine length of glycolipid ligand than that of IL-4, and the length of sphingosine chain determined the half-life of NKT cell stimulation by CD1d-associated glycolipids. IFN-
production by NKT cells required longer T cell stimulation than did IL-4 production and the transcription of the IFN-
gene required de novo protein synthesis by activated NKT cells. The NF-
B family member transcription factor c-Rel was preferentially transcribed in
GC-stimulated, but not in OCH-stimulated, NKT cells and was identified as essential for IFN-
production by activated NKT cells. Therefore, the differential duration of NKT cell stimulation, due to the binding stability of individual glycolipid antigens to CD1d molecules, determines whether signaling leads to effective c-Rel transcription and IFN-
production by activated NKT cells.
Upon stimulation by
GC in vivo, NKT cells rapidly affect the functions of neighboring cell populations such as T cells, NK cells, B cells and dendritic cells (DCs) in a direct or indirect manner (1013). The serial production of IFN-
by NKT cells and NK cells has been demonstrated, suggesting that activated NKT cells may influence further IFN-
production by other cells including NK cells (3, 10). A C-glycoside analog of
GC has been shown to induce a superior Th1-type response than
GC does by inducing higher IFN-
production by NK cells. IL-12 was indispensable for the Th1-skewing effect of the glycolipid, indicating the importance of IL-12 in enhanced IFN-
production in vivo (14). Furthermore,
GC-stimulated NKT cells can act as an adjuvant in vivo by inducing the full maturation of DCs, as manifested by augmented co-stimulatory molecules and enhanced mixed leukocyte reactions (11). Accordingly,
GC-stimulated NKT cells were shown to express CD40 ligand (CD40L, CD154), which can engage CD40 on antigen-presenting cells and stimulate them to produce IL-12 (15, 16). Furthermore, IFN-
production and Th1-type responses were impaired in CD40-deficient mice (5). A growing body of evidence suggests that both extrinsic and intrinsic factors compose an intricate network for controlling IFN-
production and Th1 polarization after intensive stimulation of NKT cells by superagonistic glycolipid such as
GC.
Although the intrinsic molecular mechanism of preferential IL-4 production by OCH-stimulated NKT cells has been elucidated, little is known about the effect of OCH on bystander cells and the extrinsic regulatory network for IFN-
production and Th1 polarization. Considering the lower IFN-
production by OCH compared with extensive IFN-
production by
GC in vivo, OCH may affect the functions of neighboring cell populations in a different manner from that of
GC. In the current study, we demonstrate that OCH induces less effective production of IFN-
and IL-12 by bystander cells possibly due to lower expression of CD40L by NKT cells. Co-administration of stimulatory anti-CD40 mAb in combination with IFN-
enhanced the production of IL-12 induced by OCH in vivo, and IL-12 modulated OCH-induced cytokine expression by augmenting IFN-
. Consistent with these results, co-administration of CpG oligodeoxynucleotide (ODN) with OCH preferentially induced IFN-
production possibly through augmented IL-12 production. Considering that NKT cell responses to CD1d-presented self-antigens are modified by IL-12 to induce massive IFN-
production during the course of microbial infection (17), OCH, at least partly, mimics the physiological behavior of the putative self-antigen for NKT cells in the context of cytokine milieu in vivo.
| Methods |
|---|
|
|
|---|
Reagents and antibodies
Murine IL-12, IFN-
and Flt3-ligand (Flt3L) were purchased from Peprotech EC (London, UK). Anti-CD40 mAb (HM40-3) was purchased from BD Biosciences PharMingen (San Diego, CA, USA). Mouse anti-IFN-
(R4-6A2) was purified from ascites of hybridoma obtained from American Type Culture Collection. Glycolipids were solubilized in dimethyl sulfoxide (100 µg ml1) and stored at 20°C until use. The following CpG ODN was synthesized: CpG ODN, 5'-GCATGACGTTGAGCT-3'.
Mice
C57BL/6 (B6) mice were purchased from CLEA Laboratory Animal Corporation (Tokyo, Japan). MHC class II-deficient I-Abß/ mice with the B6 background were purchased from Taconic (Germantown, NY, USA). All animals were kept under specific pathogen-free conditions and used at 712 weeks of age. Animal care and use were in accordance with institutional guidelines.
Induction of bone marrow-derived DCs
Bone marrow cells were isolated by flushing femurs of B6 mice and re-suspended in culture medium supplemented with murine Flt3L (100 ng ml1) as described in (18). Cells were harvested from the culture after 10 days and subjected to co-culture experiment with NKT cells.
Flow cytometry and intracellular cytokine staining
Spleen cells or liver mononuclear cells harvested after stimulation with glycolipids in vivo were cultured in complete media containing GolgiStop (BD PharMingen, San Jose, CA, USA). Then cells were incubated with Fc block (anti-mouse Fc
IIIR/IIR mAb clone 2.4G2) and were stained with biotinylated anti-NK1.1 mAb (PK136), washed with PBS and then stained with peridinin chlorophyll protein/cyanine 5.5anti-CD3 mAb and streptavidinallophycoerythrin (APC). Then cells were washed twice with PBS and fixed in BD Cytofix/Cytoperm solution for 20 min at 4°C. After fixation, cells were washed with BD Perm/Wash solution and re-suspended in the same solution containing either PEanti-IFN-
mAb (XMG1.2) or PE-conjugated isotype control Ig for 30 min at 4°C. Then samples were washed and the stained cells were analyzed using a FACS Calibur instrument (Becton Dickinson) with CELLQuest software (Becton Dickinson). Identification of iNKT cells by Dimer XI Recombinant Soluble Dimeric Mouse CD1d (BD PharMingen) was performed as described previously (19). For analysis of CD40L expression, spleen cells harvested after stimulation with glycolipids in vivo for indicated periods of time were cultured in complete media containing biotinylated anti-CD40L mAb (MR1) for 2 h. Cells were harvested, washed with PBS and stained with FITCanti-CD3 mAb, PEanti-NK1.1 mAb and streptavidinAPC for 20 min. CD40L expression was analyzed in CD3/NK1.1 double-positive cell.
Microarray
Microarray analysis was performed as described previously (9). In brief, I-Abß/ mice pre-treated with anti-asialo GM1 antibody were injected with
GC or OCH (100 µg kg1). Total RNA was isolated from liver NKT cells (purified as CD3+ NK1.1+ cells) and applied to microarray by using U74Av2 arrays (GeneChip System, Affymetrix, Santa Clara, CA, USA). From data image files, gene transcript levels were determined using algorithms in the GeneChip Analysis Suit software (Affymetrix).
Quantitative reverse transcriptionPCR
Quantitative reverse transcriptionPCR was conducted using a Light Cycler-FastStart DNA Master SYBR Green I kit (Roche Molecular Biochemicals) as described previously (9). Primers used for the analysis of gene expression are as follows; CD40L (F) CGAGTCAACGCCCATTCATC, (R) GTAATTCAAACACTCCGCCC.
ELISA
The level of cytokine production in cell culture supernatants or in serum was evaluated by standard sandwich ELISA, employing purified and biotinylated mAb sets (11B11/BVD6-24G2 for IL-4, R4-6A2/XMG1.2 for IFN-
and 9A5/C17.8 for IL-12) and standards (OptEIA set, BD PharMingen) as described previously (9). After adding a substrate, the reaction was evaluated using a Microplate reader (BioRad).
Statistics
For statistic analysis, non-parametric MannWhitney test was used to calculate significance levels for all measurements. Values of P < 0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
OCH induces lower IFN-
expression than
GC in both NKT cells and NK cells in vivoAlthough NKT cells are a major source of IL-4 after glycolipid administration in vivo, activated NKT cells are shown to affect the functions of bystander cells such as T cells, NK cells, B cells and DCs in a direct or indirect manner, resulting in possible secondary augmentation of IFN-
production by these cells. To evaluate the contribution of NKT cells and other cells for IFN-
production after glycolipid administration, we performed kinetic analysis of cytokine production by splenic NKT cells, NK cells, T cells and other cells after in vivo administration of glycolipids. IFN-
production was detected both in NKT cells and NK cells (Fig. 1A), and neither CD3+ T cells nor CD3NK1.1 cells showed significant IFN-
production 2 or 6 h after glycolipid administration.
GC induced a larger population of IFN-
-producing NKT cells than OCH did which is consistent with the previous report (9). The kinetic analysis revealed that IFN-
production by NKT cells was dominant in earlier time points (2 h) after glycolipid administration and IFN-
production by NK cells was comparable or even higher at later time points (6 h) (Fig. 1B), suggesting that IFN-
production by NKT cells preceded IFN-
production by NK cells as reported previously (3, 10). As CD3+NK1.1+ cells do not always represent CD1d-restricted iNKT cells, we compared IFN-
production by CD1d-dimerX-positive T cells after treatment with
GC or OCH. Again,
GC induced a larger population of IFN-
-producing iNKT cells than OCH did (Fig. 1C). Interestingly,
GC induced a much larger population of IFN-
-producing NK cells than OCH, suggesting that OCH induces less IFN-
production than
GC not only by direct effect on NKT cells but also by indirect effect on NK cells. To exclude the possibility of the contamination of activated non-CD1d-restricted T cells into NKT fractions or activated NKT cells into NK cells fraction due to the down-regulation of TCR, we conducted the following experiments. First,
GC-loaded DimerXI-stained cells were concentrated in the NK1.1+CD3+ population and <0.4% of cells were reactive to
GC-loaded DimerXI either in NK1.1+CD3 or NK1.1CD3+ cell populations. Second, >95% of
GC-loaded DimerXI-reactive spleen cells were positive for both CD3 and NK1.1 after stimulation with glycolipids. Third, most of the intracellular IFN-
-positive CD3 cells were DX5 positive 2 and 6 h after stimulation with glycolipids (data not shown). These results indicated that the contamination of IFN-
-producing cells into the other fractions was minimum.
|
GC-induced IFN-
production by NK cells is partly dependent on IFN-
produced by NKT cellsTo determine the effect of IFN-
on consequent IFN-
production by NK cells, we treated mice with anti-IFN-
mAb before administration of
GC, and then examined IFN-
-producing cells using intracellular staining. As shown in Fig. 2, there was no significant difference in the frequency of IFN-
-producing NKT cells after administration of
GC with or without anti-IFN-
mAb. Meanwhile, co-administration of anti-IFN-
mAb showed
35% reduction in IFN-
-producing NK cells after
GC treatment (Fig. 2, right panel). These results suggested that NKT cell-derived IFN-
was involved in
GC-induced IFN-
production by NK cells to some extent, but an IFN-
-independent mechanism might be involved in indirect up-regulation of IFN-
production by NK cells after
GC administration in vivo.
|
OCH administration does not induce effective IL-12 production
As DCs were demonstrated to be activated after in vivo administration of
GC (11, 20) to produce large amount of IL-12 (21) and IL-12 is one of the most potent inducers of IFN-
(22), we performed kinetic cytokine analysis of serum levels of IL-12 (p70) together with IFN-
and IL-4 after intra-peritoneal injection of the glycolipids into B6 mice. As shown in Fig. 3, administration of
GC induced a rapid elevation of IL-4 and a delayed elevation of IFN-
in B6 mice. In contrast, administration of OCH induced a rapid elevation of IL-4 comparable to that induced by
GC with significantly less amount of elevation of IFN-
, resulted in Th2 skewing as described previously. Although the level of IL-12 in serum was observed 6 h after
GC injection, OCH injection induced one-tenth amount of serum IL-12 level compared with
GC. In addition, freshly isolated liver NKT cells co-cultured with Flt3L-induced DCs produced significantly higher amount of IL-12 in the presence of
GC compared with OCH. Meanwhile, Flt3L-induced DCs loaded with either
GC or OCH exerted comparable amount of IL-4 production (Fig. 3B), demonstrating directly that DCs loaded with OCH produce less IL-12 upon co-culture with NKT cells than DCs loaded with
GC, and therefore suggest that the in vivo effects of OCH are not simply due to its preferential presentation by antigen-presenting cells that produce less IL-12. Taken together, these results indicated that OCH administration did not induce effective IL-12 production in vivo.
|
Lower expression of CD40L on OCH-stimulated NKT cells
Activated NKT cells stimulate DCs to produce IL-12 through the engagement of CD40 on DCs with CD40L inducibly expressed on NKT cells (15, 21). Furthermore, a C-glycoside analog of
GC induced a superior IFN-
production by NK cells than
GC does in an IL-12-dependent manner (14), which suggests that IFN-
production by NK cells might be regulated by IL-12. To clarify the mechanisms of lack of IL-12 production upon stimulation with OCH, we compared the inducible expression of CD40L on NKT cells after in vivo administration of glycolipids. Microarray analysis revealed that CD40L transcripts were inducibly expressed in NKT cells 1.5 h after stimulation with
GC and disappeared 12 h after stimulation. In contrast, OCH treatment induced approximately one-third of CD40L transcription compared with the effect of
GC (Fig. 4A). Consistent with the data of microarray analysis, real-time PCR analysis confirmed the preferential up-regulation of CD40L transcript after
GC stimulation (Fig. 4B). To demonstrate the differential expression of CD40L between
GC-stimulated and OCH-stimulated NKT cells, surface expression of CD40L on NKT cells were compared by flow cytometry after in vivo treatment with the glycolipids. As shown in Fig. 4(C),
GC induced higher expression of CD40L than OCH did on the surface of NKT cells. If compared quantitatively by mean fluorescence intensity of CD40L-positive subsets after treatment with either glycolipid, OCH treatment induced less CD40L expression on NKT cells compared with the effect of
GC (Fig. 4C, right panel). These results indicated that CD40L expression on
GC-stimulated NKT cells was significantly higher than that on OCH-stimulated NKT cells.
|
Co-administration of IFN-
and CD40 stimulation augments IL-12 production by OCH in vivoAlthough the CD40 pathway plays an intrinsic role in physiological conditions in eliciting IL-12 production, effective production of bioactive IL-12 by DCs requires another signal mediated by innate signals such as microbial stimuli (23) or by IFN-
(2426). Therefore, OCH-induced expression of CD40L and IFN-
may not be effective to initiate IL-12 production from DCs in vivo. To test this hypothesis, we examined whether co-administration of stimulatory anti-CD40 mAb and/or IFN-
confer OCH to induce higher IL-12 production. As shown in Fig. 5, administration of IFN-
, stimulatory anti-CD40 mAb or combination of both reagents did not induce IL-12 expression in vivo. On the contrary, OCH-induced IL-12 production was partially augmented by co-administration of anti-CD40 mAb. Furthermore, concomitant administration of IFN-
and stimulatory anti-CD40 mAb with OCH induced IL-12 production. These results suggest that the signals through CD40 and IFN-
provided by OCH-stimulated NKT cells did not lead to efficient production of IL-12.
|
Co-administration of IL-12 augments IFN-
production by OCH in vivoA series of experiments so far indicated that OCH was less effective for induction of CD40L, IFN-
and consequent IL-12 production than those induced by
GC. To examine directly the role of IL-12 production in less effective IFN-
production by NKT cells and NK cells after OCH administration, we tested whether co-administration of IL-12 with OCH induces IFN-
in vitro and in vivo. As shown in Fig. 6(A), IL-12 augmented IFN-
production from spleen cells after in vitro treatment with OCH in a dose-dependent manner. Higher doses of IL-12 induced IFN-
production even without OCH and the effect of OCH is concealed in this condition. Interestingly, IL-12 treatment inhibits IL-4 production by OCH-stimulated spleen cells in a dose-dependent manner, suggesting the reciprocal regulation of cytokine production by IL-12. Next we examined the effect of co-administration of sub-optimal dose of IL-12 together with OCH. As shown in Fig. 6(B), co-administration of OCH and IL-12 induced significantly higher production of IFN-
compared with either treatment alone, although sub-optimal dose of IL-12 alone failed to induce IFN-
production. In contrast, co-administration of IL-12 did not enhance the IL-4 production 2 h after OCH administration in vivo. As both NKT cells and NK cells are important sources of IFN-
after glycolipid stimulation, we evaluated the frequency of IFN-
-producing NKT and NK cells after co-administration of OCH with IL-12. As shown in Fig. 6(C), IL-12 augmented the proportions of IFN-
-producing cells in both cell populations, but not in conventional T cells, when co-administered with OCH. These results demonstrated that the properties of OCH for less effective IFN-
production by NKT cells and NK cells could be compensated by co-administration of IL-12.
|
Modification of cytokine profiles by pathogen-associated molecular patterns after OCH treatment in vivo
As sub-optimal dose of IL-12 was able to rescue defective IFN-
production by administration of OCH alone, availability of IL-12 might be a crucial determinant for OCH-induced production of IFN-
. As DCs and phagocytes produce IL-12 in response to pathogens during infection, pathogen-associated molecular patterns (PAMPs) are possible important determinants for cytokine profiles after OCH stimulation in vivo. We applied CpG ODN (27), which skews the host's immune milieu in favor of Th1 responses by enhancing the production of pro-inflammatory cytokines including IL-12 (28), for analyzing cytokine profile of OCH. As shown in Fig. 7(A), CpG ODN alone induced no cytokine production within 6 h after injection. Concomitant injection of CpG ODN with OCH induced strong IFN-
production (7.5-fold induction with 10 µg per mouse of CpG ODN plus OCH and 14-fold induction with 100 µg per mouse of CpG ODN plus OCH) and induced moderate IL-4 production (2.6-fold induction with 10 µg per mouse of CpG ODN plus OCH and 2.1-fold induction with 100 µg per mouse of CpG ODN plus OCH). Accordingly, co-administration of OCH and 10 µg per mouse of CpG ODN exhibited strong induction of IL-12 production (Fig. 7B, left panel), suggesting the synergic effect of OCH and CpG ODN for preferential up-regulation of IL-12. These results suggested that the PAMPs could be a considerable determinant for the cytokine profile following in vivo administration of OCH through regulating the availability of pro-inflammatory cytokines such as IL-12.
|
| Discussion |
|---|
|
|
|---|
In this study, we clarified the effect of OCH on bystander cell activation including the sequential IFN-
production by NK cells and the functional conditioning of DCs. In vivo administration of OCH induced much lower IFN-
production from both NKT and NK cells compared with that induced by
GC administration. NKT cell-derived IFN-
was partially involved in inducing IFN-
production by NK cells after
GC administration, implying that an IFN-
-independent mechanism is also important for indirect up-regulation of IFN-
production by NK cells after
GC administration in vivo. OCH administration induced lower CD40L expression by NKT cells compared with
GC administration, resulting in the lower production of IL-12 by DCs. Co-injection of stimulatory CD40 mAb and IFN-
with OCH augmented the OCH-induced IL-12 production. Likewise, co-injection of IL-12 with OCH enhanced the production of IFN-
by OCH administration alone. Furthermore, administration of OCH and CpG ODN into mice selectively induced IFN-
production in vivo.
Consistent with the previous reports (9, 29), we here demonstrated that OCH administration induced less amount of IFN-
than that of
GC in iNKT cells. Supporting these observation is another report in which truncation of the phytosphingosine lipid chain of
GC increases the relative amounts of IL-4 release by human NKT cells (30).
The functional relevance between NKT cells and NK cells was demonstrated in which NK-sensitive tumor incidence was higher and the time of tumor development was earlier in NKT cell-deficient mice compared with B6 mice (31). Considering that NKT cell-deficient mice still possess NK cells (32), NKT cells might serve as a modulator of NK cell function in tumor immunity, though the molecular mechanisms of how NKT cells modulate NK cells has not been clarified yet. Recently, ß-anomeric galactosylceramide has been reported to have a capacity to reduce numbers of NKT cells without inducing typical NK cell-mediated responses (29, 33). We demonstrated in this study that OCH-induced IFN-
production by NK cells was lower compared with that induced by
GC. This is at least partly due to the lower induction of IFN-
by OCH-stimulated NKT cells and the lower induction of IL-12 by DCs, leading to weak activation of NK cells. There is a report showing that OCH and
GC can induce comparable amount of IFN-
by NK cells 8 and 24 h after stimulation (29), even though serum levels of IFN-
induced by OCH treatment were significantly lower than that by
GC treatment 6 or 24 h after stimulation. Since the major producer of IFN-
in vivo after treatment with glycolipids at the later time points were demonstrated to be NK cells (3, 10), it is not clear whether cells other than NKT cells or NK cells could be the IFN-
producer after
GC stimulation in their experimental condition. Although the basis for the discrepancy is not clear, it may be related to the difference in the synthetic methods of those glycolipids. Nevertheless, we reproducibly confirmed the in vivo ameliorating effects of OCH in various autoimmune mouse models including EAE, CIA and inflammatory bowel disease (7, 8, 34) through the differential induction of various cytokines.
The CD40 pathway plays an intrinsic role in physiological conditions by eliciting IL-12 production by DCs (35, 36). However, cross-linking of CD40 alone has been shown to be incapable of inducing IL-12 production by DCs. Schulz et al. (23) has demonstrated that effective production of bioactive IL-12 by DCs through T cell activation should be initiated by innate signals such as microbial stimuli. Activated T cell-mediated IL-12 production by DCs through CD40 signaling requires another signal, for example, IFN-
(2426), which is also shown to be required for uncommitted immature DCs to develop the capacity to produce high levels of IL-12 upon subsequent contact with naive T cells (25). Consistent with the observation, IFN-
enhances gene transcription encoding both the p40 and p35 components of IL-12, resulting in a particularly marked production of the heterodimeric IL-12 (37, 38). Intriguingly,
GC-induced expression of IL-12R on NKT cells requires the production of IFN-
by NKT cells and the production of IL-12 by DCs (21). In addition, IL-12 itself has been shown to act directly on DCs to promote IL-12 production (39).
GC provides dual signals to DCs by up-regulating CD40L on NKT cells and by inducing IFN-
production by NKT cells, resulting in a large amount of IL-12 production by DCs. Our reconstitution experiment clearly showed that signals through CD40 and IFN-
provided by OCH lead to small amount of IL-12 production from DCs that is unable to trigger the IFN-
burst by NKT cells and NK cells.
Treatment of mice with OCH together with sub-optimal doses of IL-12 resulted in significantly augmented IFN-
production in vivo, indicating that the impaired IL-12 production by OCH is likely to be one of the major causes for less effective IFN-
production in vivo. Similar observations were reported previously, in which treatment of mice with sub-optimal doses of
GC together with sub-optimal doses of IL-12 resulted in strongly enhanced natural killing activity and IFN-
production (21). These results indicate an important role for DC-derived IL-12 for glycolipid-induced activation of NKT cells and suggest that NKT cells may be able to condition DCs for subsequent immune responses. To further clarify the cooperative roles of IL-12 for effective IFN-
production by glycolipid-stimulated NKT cells, CpG ODN (27) was co-administered with OCH, in which IFN-
production was preferentially augmented in response to IL-12 expression. CpG ODN induces innate immune responses similar to bacterial DNA, and is one of the PAMPs expressed by a diverse group of microorganisms. Taken together, a variety of glycolipid antigens elicit differential effects, not only on NKT cells but also on bystander cells such as NK cells and DCs, which may modulate subsequent immune responses. Recently, Brigl et al. demonstrated that a bacterial infection can induce a predominantly Th1 cytokine responses from self-antigen-primed NKT cells. In this instance, microbial products were recognized not by NKT cells directly, but by DCs, resulting in IL-12 secretion and subsequent potent IFN-
production (17). Following the exposure of immune cells to exogenous antigens or infection, IL-12 is produced by DCs in response to CD40 signals or microbial products, and co-stimulates the responses of NKT cells to self-antigens, resulting in a significant augmentation of IFN-
production but no detectable IL-4 production (40). It is noteworthy to point out that the behavior of OCH in response to IL-12 is analogous to that of the putative self-antigen for NKT cells (Fig. 6). Therefore, NKT cells also respond to OCH in a diverse manner according to the availability of IL-12, which can be induced by a wide variety of pathogens, and thus OCH may be a useful tool to evaluate the physiological responses of NKT cells to various innate immune conditions.
Regarding the predominant effect of OCH on Th2 polarization by NKT cells, several molecules have been identified that positively regulate Th2 polarization, such as thymus-specific lymphopoietin (TSLP), OX40 ligand (OX40L) or prostaglandin (PG) E2. In the microarray analysis of glycolipid-stimulated NKT cells and DCs, no inducible transcription of TSLP and OX40L in NKT cells was observed 1.5 or 12 h after OCH treatment. Furthermore, synthetic pathway for PGs seems quiescent because the expression of PG H synthetase (or cyclooxygenase 2), a key enzyme initiating PG synthesis, was not induced in either NKT cells or DCs after treatment with OCH. Considering that all of these molecules are regulated transcriptionally upon stimulation, the involvement of these molecules for OCH-mediated Th2 polarization seems minimum. Taken together, the results demonstrated in this study suggest that OCH induces Th2 predominance by a default pathway.
In summary, we have demonstrated here that OCH-mediated dominant Th2 polarization is accomplished not only by the preferential IL-4 induction by NKT cells but also by the evasion of the secondary IFN-
burst. This effect of OCH is due to the ineffective induction of IFN-
and CD40L by NKT cells and the subsequent reduction of IL-12 secretion. These results demonstrate the cellular mechanisms involved in altered glycolipid ligand (OCH)-induced Th2 polarization and immune regulation in vivo. Therefore, proper assessment of the effects of the innate immune system on the host's response should be taken into consideration when modulating NKT responses in vivo by glycolipids, such as OCH.
| Acknowledgements |
|---|
We thank Miho Mizuno for technical assistance and Yuki Kikai for cell sorting. We are grateful to John Ludovic Croxford for critical reading of the manuscript. This work was supported by the Pharmaceutical and Medical Devices Agency, Grant-in-Aid for Scientific Research (B) 14370169 from Japan Society for the Promotion of Science, Kato Memorial Bioscience Foundation and Uehara Memorial Foundation.
| Abbreviations |
|---|
| APC | allophycoerythrin |
| CD40L | CD40 ligand |
| CIA | collagen-induced arthritis |
| DC | dendritic cell |
| EAE | experimental autoimmune encephalomyelitis |
| Flt3L | Flt3-ligand |
GC | -Galactosylceramide |
| iNKT | invariant NKT |
NF- B | nuclear factor- B |
| ODN | oligodeoxynucleotide |
| OX40L | OX40 ligand |
| PAMP | pathogen-associated molecular pattern |
| PG | prostaglandin |
| TSLP | thymus-specific lymphopoietin |
| Notes |
|---|
Transmitting editor: K. Okumura
Received 19 August 2005, accepted 30 September 2005.
| References |
|---|
|
|
|---|
- Kronenberg, M. and Gapin, L. 2002. The unconventional lifestyle of NKT cells. Nat. Rev. Immunol. 2:557.[Web of Science][Medline]
- Taniguchi, M., Harada, M., Kojo, S., Nakayama, T. and Wakao, H. 2003. The regulatory role of Valpha14 NKT cells in innate and acquired immune response. Annu. Rev. Immunol. 21:483.[CrossRef][Web of Science][Medline]
- Smyth, M. J., Crowe, N. Y., Pellicci, D. G. et al. 2002. Sequential production of interferon-gamma by NK1.1(+) T cells and natural killer cells is essential for the antimetastatic effect of alpha-galactosylceramide. Blood 99:1259.
[Abstract/Free Full Text] - Singh, N., Hong, S., Scherer, D. C. et al. 1999. Cutting edge: activation of NK T cells by CD1d and alpha-galactosylceramide directs conventional T cells to the acquisition of a Th2 phenotype. J. Immunol. 163:2373.
[Abstract/Free Full Text] - Hayakawa, Y., Takeda, K., Yagita, H., Van Kaer, L., Saiki, I. and Okumura, K. 2001. Differential regulation of Th1 and Th2 functions of NKT cells by CD28 and CD40 costimulatory pathways. J. Immunol. 166:6012.
[Abstract/Free Full Text] - Mizuno, M., Masumura, M., Tomi, C. et al. 2004. Synthetic glycolipid OCH prevents insulitis and diabetes in NOD mice. J. Autoimmun. 23:293.[CrossRef][Web of Science][Medline]
- Chiba, A., Oki, S., Miyamoto, K., Hashimoto, H., Yamamura, T. and Miyake, S. 2004. Suppression of collagen-induced arthritis by natural killer T cell activation with OCH, a sphingosine-truncated analog of alpha-galactosylceramide. Arthritis Rheum. 50:305.[CrossRef][Web of Science][Medline]
- Miyamoto, K., Miyake, S. and Yamamura, T. 2001. A synthetic glycolipid prevents autoimmune encephalomyelitis by inducing TH2 bias of natural killer T cells. Nature 413:531.[CrossRef][Medline]
- Oki, S., Chiba, A., Yamamura, T. and Miyake, S. 2004. The clinical implication and molecular mechanism of preferential IL-4 production by modified glycolipid-stimulated NKT cells. J. Clin. Investig. 113:1631.[CrossRef][Web of Science][Medline]
- Carnaud, C., Lee, D., Donnars, O. et al. 1999. Cross-talk between cells of the innate immune system: NKT cells rapidly activate NK cells. J. Immunol. 163:4647.
[Abstract/Free Full Text] - Fujii, S. I., Shimizu, K., Smith, C., Bonifaz, L. and Steinman, R. M. 2003. Activation of natural killer T cells by {alpha}-galactosylceramide rapidly induces the full maturation of dendritic cells in vivo and thereby acts as an adjuvant for combined CD4 and CD8 T cell immunity to a coadministered protein. J. Exp. Med. 198:267.
[Abstract/Free Full Text] - Hermans, I. F., Silk, J. D., Gileadi, U. et al. 2003. NKT cells enhance CD4+ and CD8+ T cell responses to soluble antigen in vivo through direct interaction with dendritic cells. J. Immunol. 171:5140.
[Abstract/Free Full Text] - Kitamura, H., Ohta, A., Sekimoto, M. et al. 2000. Alpha-galactosylceramide induces early B-cell activation through IL-4 production by NKT cells. Cell Immunol. 199:37.[CrossRef][Web of Science][Medline]
- Schmieg, J., Yang, G., Franck, R. W. and Tsuji, M. 2003. Superior protection against malaria and melanoma metastases by a C-glycoside analogue of the natural killer T cell ligand alpha-galactosylceramide. J. Exp. Med. 198:1631.
[Abstract/Free Full Text] - Vincent, M. S., Leslie, D. S., Gumperz, J. E., Xiong, X., Grant, E. P. and Brenner, M. B. 2002. CD1-dependent dendritic cell instruction. Nat. Immunol. 3:1163.[CrossRef][Web of Science][Medline]
- Tomura, M., Yu, W. G., Ahn, H. J. et al. 1999. A novel function of Valpha14+CD4+NKT cells: stimulation of IL-12 production by antigen-presenting cells in the innate immune system. J. Immunol. 163:93.
[Abstract/Free Full Text] - Brigl, M., Bry, L., Kent, S. C., Gumperz, J. E. and Brenner, M. B. 2003. Mechanism of CD1d-restricted natural killer T cell activation during microbial infection. Nat. Immunol. 4:1230.[CrossRef][Web of Science][Medline]
- Gilliet, M., Boonstra, A., Paturel, C. et al. 2002. The development of murine plasmacytoid dendritic cell precursors is differentially regulated by FLT3-ligand and granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 195:953.
[Abstract/Free Full Text] - Chiba, A., Kaieda, S., Oki, S., Yamamura, T. and Miyake, S. 2005. The involvement of V(alpha)14 natural killer T cells in the pathogenesis of arthritis in murine models. Arthritis Rheum. 52:1941.[CrossRef][Web of Science][Medline]
- Pal, E., Tabira, T., Kawano, T., Taniguchi, M., Miyake, S. and Yamamura, T. 2001. Costimulation-dependent modulation of experimental autoimmune encephalomyelitis by ligand stimulation of V alpha 14 NK T cells. J. Immunol. 166:662.
[Abstract/Free Full Text] - Kitamura, H., Iwakabe, K., Yahata, T. et al. 1999. The natural killer T (NKT) cell ligand alpha-galactosylceramide demonstrates its immunopotentiating effect by inducing interleukin (IL)-12 production by dendritic cells and IL-12 receptor expression on NKT cells. J. Exp. Med. 189:1121.
[Abstract/Free Full Text] - Trinchieri, G. 2003. Interleukin-12 and the regulation of innate resistance and adaptive immunity. Nat. Rev. Immunol. 3:133.[CrossRef][Web of Science][Medline]
- Schulz, O., Edwards, A. D., Schito, M. et al. 2000. CD40 triggering of heterodimeric IL-12 p70 production by dendritic cells in vivo requires a microbial priming signal. Immunity 13:453.[CrossRef][Web of Science][Medline]
- Hilkens, C. M., Kalinski, P., de Boer, M. and Kapsenberg, M. L. 1997. Human dendritic cells require exogenous interleukin-12-inducing factors to direct the development of naive T-helper cells toward the Th1 phenotype. Blood 90:1920.
[Abstract/Free Full Text] - Vieira, P. L., de Jong, E. C., Wierenga, E. A., Kapsenberg, M. L. and Kalinski, P. 2000. Development of Th1-inducing capacity in myeloid dendritic cells requires environmental instruction. J. Immunol. 164:4507.
[Abstract/Free Full Text] - Snijders, A., Kalinski, P., Hilkens, C. M. and Kapsenberg, M. L. 1998. High-level IL-12 production by human dendritic cells requires two signals. Int. Immunol. 10:1593.
[Abstract/Free Full Text] - Klinman, D. M. 2004. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nat. Rev. Immunol. 4:249.[CrossRef][Medline]
- Krug, A., Towarowski, A., Britsch, S. et al. 2001. Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12. Eur. J. Immunol. 31:3026.[CrossRef][Web of Science][Medline]
- Parekh, V. V., Singh, A. K., Wilson, M. T. et al. 2004. Quantitative and qualitative differences in the in vivo response of NKT cells to distinct alpha- and beta-anomeric glycolipids. J. Immunol. 173:3693.
[Abstract/Free Full Text] - Goff, R. D., Gao, Y., Mattner, J. et al. 2004. Effects of lipid chain lengths in alpha-galactosylceramides on cytokine release by natural killer T cells. J. Am. Chem. Soc. 126:13602.[CrossRef][Web of Science][Medline]
- Smyth, M. J., Thia, K. Y., Street, S. E. et al. 2000. Differential tumor surveillance by natural killer (NK) and NKT cells. J. Exp. Med. 191:661.
[Abstract/Free Full Text] - Whiteside, T. L. and Herberman, R. B. 1995. The role of natural killer cells in immune surveillance of cancer. Curr. Opin. Immunol. 7:704.[CrossRef][Web of Science][Medline]
- Ortaldo, J. R., Young, H. A., Winkler-Pickett, R. T., Bere, E. W., Jr, Murphy, W. J. and Wiltrout, R. H. 2004. Dissociation of NKT stimulation, cytokine induction, and NK activation in vivo by the use of distinct TCR-binding ceramides. J. Immunol. 172:943.
[Abstract/Free Full Text] - Ueno, Y., Tanaka, S., Sumii, M. et al. 2005. Single dose of OCH improves mucosal T helper type 1/T helper type 2 cytokine balance and prevents experimental colitis in the presence of valpha14 natural killer T cells in mice. Inflamm. Bowel Dis. 11:35.[CrossRef][Web of Science][Medline]
- Cella, M., Scheidegger, D., Palmer-Lehmann, K., Lane, P., Lanzavecchia, A. and Alber, G. 1996. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J. Exp. Med. 184:747.
[Abstract/Free Full Text] - Quezada, S. A., Jarvinen, L. Z., Lind, E. F. and Noelle, R. J. 2004. CD40/CD154 interactions at the interface of tolerance and immunity. Annu. Rev. Immunol. 22:307.[CrossRef][Web of Science][Medline]
- Hayes, M. P., Murphy, F. J. and Burd, P. R. 1998. Interferon-gamma-dependent inducible expression of the human interleukin-12 p35 gene in monocytes initiates from a TATA-containing promoter distinct from the CpG-rich promoter active in EpsteinBarr virus-transformed lymphoblastoid cells. Blood 91:4645.
[Abstract/Free Full Text] - Ma, X., Chow, J. M., Gri, G. et al. 1996. The interleukin 12 p40 gene promoter is primed by interferon gamma in monocytic cells. J. Exp. Med. 183:147.
[Abstract/Free Full Text] - Grohmann, U., Belladonna, M. L., Bianchi, R. et al. 1998. IL-12 acts directly on DC to promote nuclear localization of NF-kappaB and primes DC for IL-12 production. Immunity 9:315.[CrossRef][Web of Science][Medline]
- Gumperz, J. E. 2004. CD1d-restricted NKT cells and myeloid IL-12 production: an immunological crossroads leading to promotion or suppression of effective anti-tumor immune responses? J. Leukoc. Biol. 76:307.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
B. A. Sullivan, N. A. Nagarajan, G. Wingender, J. Wang, I. Scott, M. Tsuji, R. W. Franck, S. A. Porcelli, D. M. Zajonc, and M. Kronenberg Mechanisms for Glycolipid Antigen-Driven Cytokine Polarization by V{alpha}14i NKT Cells J. Immunol., January 1, 2010; 184(1): 141 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, X. Chen, L. Rodenkirch, W. Simonson, S. Wernimont, R. M. Ndonye, N. Veerapen, D. Gibson, A. R. Howell, G. S. Besra, et al. Natural killer T-cell autoreactivity leads to a specialized activation state Blood, November 15, 2008; 112(10): 4128 - 4138. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G. Joyee, H. Qiu, Y. Fan, S. Wang, and X. Yang Natural Killer T Cells Are Critical for Dendritic Cells to Induce Immunity in Chlamydial Pneumonia Am. J. Respir. Crit. Care Med., October 1, 2008; 178(7): 745 - 756. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ambrosino, M. Terabe, R. C. Halder, J. Peng, S. Takaku, S. Miyake, T. Yamamura, V. Kumar, and J. A. Berzofsky Cross-Regulation between Type I and Type II NKT Cells in Regulating Tumor Immunity: A New Immunoregulatory Axis J. Immunol., October 15, 2007; 179(8): 5126 - 5136. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Forestier, T. Takaki, A. Molano, J. S. Im, I. Baine, E. S. Jerud, P. Illarionov, R. Ndonye, A. R. Howell, P. Santamaria, et al. Improved Outcomes in NOD Mice Treated with a Novel Th2 Cytokine-Biasing NKT Cell Activator J. Immunol., February 1, 2007; 178(3): 1415 - 1425. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









