Skip Navigation


International Immunology Advance Access originally published online on September 26, 2005
International Immunology 2005 17(11):1495-1503; doi:10.1093/intimm/dxh327
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
17/11/1495    most recent
dxh327v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Roundy, K. M.
Right arrow Articles by Weis, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roundy, K. M.
Right arrow Articles by Weis, J. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?


© The Japanese Society for Immunology. 2005. All rights reserved. For permissions, please e-mail: journals.permissions@oupjournals.org

Partial rescue of B cells in microphthalmic osteopetrotic marrow by loss of response to type I IFNs

Kirstin M. Roundy1, Gerald Spangrude2, Janis J. Weis1 and John H. Weis1

1 Department of Pathology and 2 Department of Medicine, University of Utah School of Medicine, 50 N Medical Drive, Salt Lake City, UT 84132, USA

Correspondence to: J. H. Weis; E-mail: john.weis{at}path.utah.edu


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The microphthalmic (mi) mouse exhibits deficiencies in the development of osteoclasts, melanocytes, mast cells and marrow B cells. Previously, we demonstrated that the marrow of such mice over-express receptor activator of nuclear factor {kappa}B (RANK) ligand (RANKL). RANKL has been shown to induce the production of IFN-ß, a type I IFN. Additionally, maturing B cells have been shown to undergo apoptosis in response to type I IFNs including IFN-ß during differentiation. We hypothesized that the loss of B cells in the marrow of mi mice was due to the over-expression of IFN-ß as a result of heightened RANK–RANKL signaling. Creating a mouse with the mi genotype that was non-responsive to IFN-ß (lacking the type I IFNR) allowed us to test this hypothesis. These mice demonstrated an elevated number of marrow B cells and marrow precursor cells compared with mi animals possessing the type I IFNR. Intriguingly, type I IFNR-deficient wild-type animals also demonstrated an increased number of precursor cells in the marrow, but not an expansion of B220-positive pre-B cells, compared with wild type, suggesting that modulation of type I IFN responses directly controls the development of marrow constituents.

Keywords: B cells, microphthalmic, interferon, marrow, RANK/RANKL, mouse


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The microphthalmic (mi) mutation arises from a deletion in the DNA-binding site of the microphthalmia-associated transcription factor (MITF) that prevents it from binding to genes dependent on it for transcription, such as tyrosinase, tartrate-resistant acid phosphatase and carbonic anhydrase II (1, 2). This mutation is also dominant in that the mutant mi protein can pair with native members of the protein family, sequestering them as non-functional dimers (3). Phenotypic effects of this mutation include a lack of pigmentation due to the loss of melanocytes, decreased numbers of peripheral mast and NK cells and osteopetrosis, due to dysfunctional osteoclasts (4). Our previous examination of the mi bone marrow elucidated a decrease in B precursor cells but an increase in cells belonging to granulocytic lineages (5). B cell differentiation is not directly targeted by the mi mutation in that B cell numbers and types in peripheral immune organs, such as the spleen and Peyer's patches, are very close to normal.

Two contrasting models can be proposed to account for the depressed levels of B cell precursors in the marrow of osteopetrotic mice. The first suggests that the reduced bone cavity does not possess enough space to support B cell development: similar losses in B cell numbers are evident in a variety of osteopetrotic model systems (6). An alternative model suggests that the osteopetrotic marrow is inhospitable for B cell development due to the over/under-expression of products, such as cytokines or chemokines, required for B cell precursor development. To test this second model, we analyzed normal and mi total marrow samples for the aberrant expression of marrow products. The mi marrow demonstrated elevated expression of receptor activator of nuclear factor {kappa}B (RANK) ligand (RANKL) (7), a gene product intimately involved in the regulation of bone morphology (8). In addition, we also observed the elevated expression of Fragilis 5, a gene whose expression is regulated, in part, by type I IFNs (9), and elevated expression of SDF-1{alpha} and BLC, two chemokines important in the development of B lineage cells in the marrow (1013).

The process of bone homeostasis is maintained by a dynamic interplay between osteoclasts (which resorb bone) and osteoblasts (which form bone). During bone development, RANKL, found on osteoblasts as well as bone marrow stromal cells, T cells and pro-B cells, binds to RANK to initiate osteoclastogenesis (1417). RANK is found on osteoclasts, dendritic cells, activated T cells and hematopoietic precursors (14, 18, 19). Binding of RANKL to RANK has also been shown to induce the expression in osteoclasts of c-fos, a transcription factor involved in osteoclast differentiation, which in turn induces the expression of IFN-ß. Mice deficient in a subunit of the type I IFNR (IFNAR1–/–) or IFN-ß (IFN-ß–/–) demonstrated an increase in the number of osteoclasts in the bone when compared with wild-type mice. It has been proposed that the induction of IFN-ß through RANKL signaling via the c-fos pathway serves as a negative regulator of osteoclastogenesis (20).

IFN-ß, along with the IFN-{alpha} family, comprises the type I IFNs, a group of pleiotropic-acting cytokines that function as part of the innate immune system (21). It has been demonstrated that IL-7-responsive lymphoid progenitors (B cells) were susceptible to IFN-{alpha}/ß-induced apoptosis at certain stages of development in vitro (22). Further in vivo investigations showed a reversible block in B cell development with type I IFN treatment, beginning with the pro-B cell stage (23). Type I IFNs act through a receptor that includes a common {alpha} subunit; cells lacking this IFNAR1 subunit are insensitive to the effects of these cytokines (24).

The preceding information led us to propose a model to explain the deficiency of B cell precursors in the marrow of mi mice. We propose that the environment of the mi marrow leads to the over-production of RANKL by osteoblasts and/or stromal cells in an attempt to increase the functional activity of resident osteoclasts. These osteoclasts respond to the excess RANKL by over-activation of c-fos and the over-production of IFN-ß. The release of excess IFN-ß within the marrow leads to the expression of IFN response genes (such as Fragilis 5) as well as the induction of apoptosis of maturing B lymphocytes. In order to test this model, we generated mice that were homozygous for the mi mutation and which also lacked the IFNAR1 protein. These mice demonstrated a partial restoration of maturing B cells and precursors in the marrow, suggesting that IFN signaling in the mi marrow is detrimental to B cell development.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice
Mice lacking a functional type I IFNR (IFNAR1) (24), backcrossed five generations onto a C57BL/6 background, were obtained from Herbert Virgin (Washington University, St Louis, MO, USA). Mice heterozygous for the mi mutation (on a C57BL/6 background) and C57BL/6 control mice were purchased from Jackson Laboratories. Independent breeding colonies of IFNAR1-deficient and heterozygote Mitf/mi animals were maintained in the animal facilities at the University of Utah. All animal experiments were approved by the Institutional Animal Care and Use Committee (Protocol no. 04-08001). IFNAR1–/– mice were mated with heterozygotes for Mitf (+/mi). Progenies were selected first for the lack of IFNAR1 and then for heterozygosity with Mitf (+/mi). The +/mi x IFNAR1–/– mice were mated together to obtain mice with homozygous mi alleles and homozygous knockout (KO) for IFNAR1 (mi/mi x IFNAR1–/– designated as mi IFNAR1–/–). Mice were analyzed at 3–6 weeks of age. Males and females were used in these analyses: no differences were detected due to sex between age-matched, genetically identical animals.

A PCR-based genotyping assay was used to detect the 3-bp deletion in the mi gene and the presence of the neo-cassette and disruption of IFNAR1 in genomic DNA. Primers used were as follows: Mitf-F 5'-TGACGTCAGTACGCACATGC-3', Mitf-R 5'-GCAGATGAACATGCGATTGTAC; IFNAR1-F 5'-AAAAGACGAGGCGAAGTGG-3', IFNAR1-R 5'-CATTCCACGAAGATGTGCTG-3' and neo-R 5'- AATTCGCCAATGACAAGACGC-3'. PCR parameters were 95°C denaturation (1 s), 60°C annealing (1 s) and 72°C extension (5 s) for 25 cycles using an Air Thermo Cycler (Idaho Technologies) (25). Fragments were electrophoresed on an 8% bis-acrylamide (BioRad) gel for 2 h at 65 W for adequate separation. Gels were exposed to film for 1 h (32P label). Mitf forward and reverse primers yielded a 195-bp fragment for wild-type animals, 192-bp fragment for mi animals and both sizes for heterozygote animals. IFNAR1 forward and reverse primers produced a 149-bp fragment. IFNAR1 forward and neo reverse primers yielded a 249-bp fragment.

Matings yielded mi IFNAR1–/– mice with similar physical characteristics as normal mi mice. Wild-type littermates from mi and mi IFNAR1 KO breeding pairs were used as control animals. The genotype for mice used in each experiment is indicated in the figures. Experiments used age-matched mice.

FACS analysis
Single-cell suspensions were obtained from the bone marrow and spleen of each animal. Femurs and tibias from wild-type littermates were flushed with PBS + 0.1% BSA. Bones from mi and mi IFNAR1-deficient animals were sliced with a razor blade to release the cells. Spleens from each animal were mechanically disrupted through a cell strainer. RBCs were lysed in ACK lysis buffer (0.15 M NH4 Cl, 10.0 mM KHCO3 and 0.1 mM Na2EDTA) for 5 min at room temperature. Cells were aliquoted into tubes for staining and re-suspended in PBS + 0.1% BSA containing 10% mouse serum, 10% rat serum, antibody and Fc blocker (CD16/CD32, BD PharMingen). Cells were incubated in the antibody mixes for 20 min on ice. The following antibodies were used: from BD PharMingen, B220 (clone RA3-6B2), CD19 (1D3), Ly-6G/Gr-1 (RB6-8C5), CD3 (145-2C11) and streptavidin–PE; from Caltag Laboratories, F4/80 (C1:A3-1). Cells were stained with a secondary antibody and filtered through nylon mesh to obtain a single-cell suspension. Stained cells were analyzed on the BD FACScan and enumerated with CellQuest software. Isotype controls were used to detect non-specific binding. Figures 1 and 5 were based upon 10 000 live events while Figs 3–5GoGo are representative of 5000 live events. Live cells were differentiated from dead cells by staining with the vital dye, 7-AAD (BD PharMingen).



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1. Lack of response to type I IFNs partially restores B cells in the bone marrow of the mi animal. Single stains were performed on bone marrow and spleen cells obtained from mi mutant animals (mi/mi) that either possessed the IFNAR1 protein (left set in each panel) or lacked the IFNAR1 protein (right set of each panel). One-dimensional dot plots are presented to demonstrate cell subsets. CD19–FITC and B220–PE, Gr-1–PE, F4/80–PE and CD3–PE appear on the vertical axis. Panel A—bone marrow cells from mi IFNAR1-replete animals (left set) and mi IFNAR1-deficient animals (right set). Panel B—spleen cells from mi IFNAR1-replete animals (left set) and mi IFNAR1-deficient animals (right set). Percentages of cells are taken directly from the FACS analysis. As detailed in the text, such analyses on distinct mice were done a number of times: each experiment demonstrated a significant restoration of B lymphocyte precursor cells to the marrow of the mi/IRNAR1-deficient mice compared with the mi/receptor-replete mice.

 


View larger version (33K):
[in this window]
[in a new window]
 
Fig. 5. Lack of response to type I IFNs increases the percentage of non-committed progenitors in the bone marrow. Magnetic bead depletion was used to remove committed cell types from total bone marrow cells isolated from normal C57BL/6 animals and C57BL/6 IFNAR1-deficient animals. Remaining cells were then stained to further identify immature cell lineages. Panel A—percentages of B220-positive (x-axis) and c-kit-positive (y-axis) cells in bone marrow depleted of Ter119+, CD19+ and Gr-1+ cells. Panel B—percentage of cells staining positive for B220, IL-7R and c-kit in bone marrow depleted of Ter119- and Gr-1-positive cells. Percentages of cells are taken directly from the FACS analysis. Data are representative of multiple experiments.

 


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 3. Type I IFNs affect the number of B220/Gr-1 cells in the bone marrow of the mi mouse. Double stain with B220–FITC and Gr-1–PE on bone marrow cells. Panel A—bone marrow cells from mi IRNAR1-replete mice (left panel) versus mi IFNAR1-deficient (right panel) animals. Panel B—Mitf wild-type (+/+) and IFNAR1-replete marrow (left panel) versus Mitf wild-type (+/+) and IFNAR1-deficient marrow (right panel). Percentages of cells are taken directly from the FACS analysis. The data shown are from one set of animals that was confirmed in a number of identical experiments.

 


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 4. Type I IFNs affect the number of IL-7-dependent CFUs but not SCF-dependent colony growth in the bone marrow of IFNAR1-deficient mice. Panel A—IL-7-dependent colony formation. Panel B—SCF-dependent colony formation. Left panels are Mitf wild type possessing IFNAR1 (white bars) or lacking IFNAR1 (black bars). Middle panels are +/mi animals possessing the IFNAR1 protein (white bars) or lacking IFNAR1 (black bars). Right panels are mi/mi animals possessing the IFNAR1 protein (no colonies detected) or lacking the IFNAR1 protein (black bars). Data shown are derived from one experiment with duplicate wells and are representative of multiple identical experiments. Error bars represent standard deviation.

 
Cell depletion
Bone marrow cells were isolated and prepared from femurs and tibia of C57BL/6 and IFNAR1-deficient mice as previously detailed. A lineage cocktail containing antibodies against CD19, Gr-1 and Ter119 or Gr-1 and Ter119 was added to the cells for 30 min on ice. The CD19 antibody depletes B cell precursors, Gr-1 depletes granulocyte precursors and Ter119 antibody depletes cells committed to erythroid lineages. Cells were washed twice with Hanks buffer + 10% FCS. Magnetic beads labeled with sheep anti-rat IgG (Dynabeads M450, Dynal) were washed and added to bone marrow cells for 10 min while rotating at 4°C. Cells binding to the magnetic beads were removed and remaining cells were subjected to a second round of depletion for 20 min. Cells remaining after the second depletion were stained with rat IgG, Sca-1, c-kit and B220 or c-kit, B220 and IL-7R and analyzed with the FACSVantage cell sorter (Becton Dickenson).

Colony-forming units assay
A total of 1 x 106 cells were isolated from the bone marrow of each animal as previously described. RBCs were lysed and live cells were counted via trypan blue exclusion. Cells were re-suspended in 0.3 ml volume of RPMI media (Invitrogen) supplemented with 10% FBS (Hyclone)/1% Pen–strep (Invitrogen) and containing either 20 ng ml–1 IL-7 or 100 ng ml–1 SCF (R&D Systems). Cells and media mixtures were added to 3 ml of methylcellulose (M3231 -erythropoietin, -cytokines, Stem Cell Technologies) and vortexed. Duplicate wells of 1.1 ml were plated into separate wells of a 6-well dish and incubated for 7 days. After the incubation period, the total number of cell colonies was enumerated blindly. Data are representative of the average number of colonies between the duplicate wells for each experiment. Error bars were derived from averaging duplicate wells from each experiment.

Detection of type I IFN transcripts
RNA was isolated from the leg bones of +/+ and mi/mi mice as previously described and used as a template for cDNA synthesis (7). Relative transcript levels for IFN-{alpha}, IFN-ß, IFN-{varepsilon}, IFN-{kappa} and limitin were evaluated for each sample via continuous fluorescence monitoring PCR using the LightCycler (Roche Diagnostics) (26). Copy numbers for each type I IFN were calculated using the LightCycler software and corrected by normalization to ß-actin transcript levels. Primers for type I IFNs were as follows: IFN-{alpha} forward, 5'-CTCTCCTGCCTGAAGGACAG and IFN-{alpha} reverse, 5'-CTGCTGATGGAGGTCATTGC; IFN-ß forward, 5'-CAAGAAAGGACGAACATTCG and IFN-ß reverse, 5'-AGACATTCTGGAGCATGTCT; IFN-{varepsilon} forward, TCCAGCAGTGTCTAGCACACAG and IFN-{varepsilon} reverse, TCCCATGTGTCTGGAGGAGC; IFN-{kappa} forward, TTCTGGGCAGTACCATGACCG and IFN-{kappa} reverse, ATTGAAGATAGTTAGTGCCAGAG; limitin forward, 5'-AAGTGCTGAAGAGCCCAAGAGAG-3' and limitin reverse, 5'-TAGCGGAAGAACCCTCGGAAGTAG-3'.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Defining a model for B cell exclusion in osteopetrotic marrow
In our previous analyses of the osteopetrotic marrow of mi mice, we made two salient observations. First, the marrow of such mice possess granulocyte precursors but lack B cell precursors. Such mice do have mature B cells in their periphery but their development depends upon lymphocyte hematopoiesis in non-marrow compartments of the animal (5). Second, the expression of RANKL is elevated in such marrow presumably as a response to the inactivity of the RANK possessing osteoclasts in their ability to degrade bone (7). Others have shown that osteoclasts respond to RANK signaling by producing IFN-ß (20, 27) and that maturing B cells in the marrow are very sensitive to IFN-ß (28) in that exposure to the cytokine leads to apoptosis (29).

We previously demonstrated the elevated expression of IFN response genes in the marrow of mi mice, suggesting the presence of type I IFNs but the expression of such cytokines was not measured directly. To test this question, we screened multiple RNA preparations from wild-type and mi bone marrows for the expression of {alpha}-IFNs (using a consensus sequence for the members of this gene family), IFN-ß and the other type I IFNs, limitin (also termed IFN-{zeta}), IFN-{kappa} and IFN-{varepsilon}. Real-time reverse transcription (RT)–PCR analysis of these cytokines either could not detect expression levels over background (IFN-{alpha}, IFN-ß and IFN-{varepsilon}) despite robust detection in controls (LPS- or dIdC-treated macrophages) or there was no difference between the samples (IFN-{kappa}) (data not shown). However, the expression of limitin was elevated in the wild-type marrow compared with the mi sample (data not shown). Specifically, the wild-type sample demonstrated 3.05 limitin transcripts (±0.92 transcript) per 1000 ß-actin transcripts while the mi/mi marrow sample demonstrated 0.85 limitin transcripts (±0.25 transcripts) per 1000 ß-actin transcripts. The limitin transcript data were an average of four different samples examined from each genotype with a statistical significance of P < 0.05. Limitin has been described as a cytokine that specifically suppresses B cell lymphopoiesis by inducing the nuclear transduction of Daxx (3032). If the role of limitin in the marrow is, in part, to limit B cell expansion and the mi marrow lacks B cells and their precursors, then it is not surprising to see limited expression of this cytokine in the mi marrow compared with wild-type marrow. The same RT–PCR assays were performed on total splenic RNA: only limitin, which was elevated in the mi compared with wild-type spleen, showed differences in expression (data not shown). Animals with the mi mutation have normal numbers and types of B cells in the spleen and lymph nodes due to the peripheralization of B cell development (such as in the spleen), thus limitin expression appears to coincide with sites of B cell lymphopoiesis.

The inability to demonstrate elevated levels of IFN-ß in the marrow of the mi animal (compared with wild type) did not eliminate the possibility that this cytokine may be instrumental in the RANKL-mediated exclusion of B cells in the developing animal since our analyses were done with animals 3–4 weeks of age instead of at birth when the marrow is seeded with precursors from the fetal liver. Additionally, localized concentrations of the cytokine in marrow microenvironments that could not be detected in a total RT–PCR assay could still provide a potent enough signal to induce maturing B cells to undergo apoptosis. Thus, an alternative approach to this question would be to remove the ability of lymphocyte precursor cells to respond to IFN-ß in the marrow of the mi osteopetrotic marrow and determine if a partial or full restoration of lymphocyte precursors in the marrow would be observed. Accordingly, we created a colony of animals that were deficient in the type I IFNR (IFNAR1) and that were homozygous for the mutant mi allele. IFNAR1-deficient animals do not respond to IFN-{alpha} or IFN-ß. The IFNAR1-deficient animals (wild type for Mitf) do have reduced trabecular bone mass (osteoporosis) due to an increase in osteoclast numbers (20); however, percentages of other bone marrow-derived cell types were normal (33). Analysis of cross-sections of femurs from the IFNAR1-deficient, mi/mi animal did show reduced bone density compared with that of the receptor-replete, mi/mi animal (data not shown). Percentages of offspring were similar to that of the receptor-positive, +/mi breeding (data not shown). The harvest of total cell numbers from the mi/mi IFNAR1 wild-type bone marrow was virtually identical to those obtained from the mi/mi IFNAR1 homozygous KO marrow (see below), indicating that total marrow space and cell occupancy was roughly equivalent.

Loss of type I IFN response restores B cells in the marrow of mi/mi mice
The mice described above possessing the mi mutation and lacking the IFNAR1 protein were compared with mice with the mi mutation but having a functional IFNAR1. Cells were harvested from the bone marrow and spleens of these mice and were stained with various cell-surface markers. In the bone marrow (Fig. 1A) the B220 antibody recognized a 1.6% positive cell population in the mi mouse while identifying a 7.7% positive population in the mi IFNAR1 KO, a 5-fold increase overall. This trend was duplicated with CD19 staining, illustrating a difference of 0.5% compared with 7.7% between these animals. Concomitant with the increased percentage of B cells in the marrow of the mi receptor-deficient animal was a decrease in cells committed to a granulocyte lineage (Gr-1 positive). Although the data shown in Fig. 1(A) are from single mi/mi and mi/mi IFNAR1 KO animals, a similar percentage increase of B cells was seen in identical experiments with additional animals. Specifically, three additional analyses demonstrated B220-positive cells from mi/mi, IFNAR1 wild-type marrow with an average of 3.1% (SD of 1.39), and from mi/mi IFNAR1-deficient marrow with an average of 11.2% (SD of 5.04; P < 0.05) (data not shown). Gr-1-positive cells from the same experiments were an average of 91.2% (SD of 0.77) for wild-type marrow, and from mi/mi IFNAR1-deficient marrow, an average of 72.5% (SD of 2.87; P < 0.001) (data not shown).

Interestingly, the number of macrophage lineage cells (F4/80 positive) also increased in these animals compared with those mi animals that possessed the IFNAR1 protein (7.3% compared with 1.5%; P < 0.04). The colonization of B cells in a peripheral lymphoid organ, such as the spleen, was not altered for mi animals in the presence or absence of the IFNAR1 protein (Fig. 1B). These data suggest that the presence of inhibitory doses of IFN-ß are localized in the marrow cavity and are not widespread in the animal.

The analysis of the IFNAR1-deficient mice was extended using the Mitf wild-type littermates. Analysis of bone marrow constituents between IFNAR1-replete and -deficient animals did not show any major alteration in cell types and percentages (Fig. 2). This was also the case of splenic constituents since there were no significant differences in B cell or T cell percentages between the IFNAR1+/+ and IFNAR1–/– lineages (data not shown). Although the mi mutant protein can act as a dominant negative, no such effect was evident in these experiments (Fig. 2).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 2. Type I IFNs do not affect lineage-committed cell percentages in the bone marrow of wild-type animals. FACS analysis of bone marrow cells from Mitf wild-type mice (+/+) and IFNAR1R-replete mice (left set) and +/mi IFNAR1-deficient mice (right set). CD19–FITC, B220–PE, Gr-1–PE and F4/80–PE are shown on the vertical axis. Percentages of cells are taken directly from the FACS analysis. Shown are data from one experiment that are consistent from several such analyses.

 
Lack of IFNAR1 enriches for immature marrow cells in mi and wild-type animals
The finding that an IFNAR1 deficiency allowed for a partial rescue of B cell development in the mi marrow suggested that the mi marrow produces excess IFN-ß and that this cytokine is deleterious at some point to B cell development. One alternative interpretation to our finding, however, could be that mature B cells can be found in the marrow of the mi IFNAR1-deficient mice but that B cell hematopoiesis itself is not supported in such marrow. To explore this question, we used two-color FACS analysis of marrow cells obtained from a variety of genotypic variants to attempt to determine if the lack of the IFNAR1 protein in the mi/mi background would lead to increased numbers of precursor cells. The mi animal expressing IFNAR1 possessed a marrow population where essentially all the cells were of granulocytic lineage (Gr-1 positive) (93.1%) (Fig. 3A). The receptor deficiency rescues this marrow by not only enriching for the B220+ cells (primarily B cell precursors) but also increasing the percentage of other lineages and progenitors (Gr-1/B220 double negatives). The percentage change from 4.8 to 22.2% of these double-negative cells indicates that blocking the IFN response pathway allows for the stable residence and differentiation of immature cells in the marrow. The wild-type (Mitf) animal did not show the same level of marrow cell enrichment in the absence of the IFNAR1 protein (Fig. 3B), suggesting that the mi phenotype specifically suppresses the maintenance of these immature, Gr-1, B220 double-negative cells in the marrow.

A more accurate determination of potential precursor cells in the marrow is a colony-forming unit (CFU) assay in which lymphocyte precursors can be enumerated by growth in IL-7-supplemented methylcellulose, and granulocyte precursors can be similarly analyzed by growth in SCF-supplemented methylcellulose. Total marrow was obtained from wild-type animals (+/+), heterozygote animals (+/mi) or homozygous mi animals (mi/mi) with or without IFNAR1, plated in the presence of IL-7 or SCF, and CFUs were counted. The mi animals (regardless of the presence or absence of IFNAR1) routinely possessed 6 x 105 total marrow cells per two pooled femurs (data not shown). This quantity of cells was 10% of the quantity obtained from either mi/+ or +/+ animals regardless of the presence or absence of IFNAR1. Plates were blindly read by two individuals: duplicate wells were averaged. For IL-7-dependent CFU (Fig. 4A), the absence of IFNAR1 (black bar) resulted in a greater number of precursor cells compared with marrow cells that possess the receptor (white bar) for the three possible mi genotypes. We have never observed IL-7-dependent CFU present in mi/mi, IFNAR1+/+ samples (5) (Fig. 4A, far right panel). However, by removing the ability of these cells to respond to IFN-ß, IL-7 CFUs were now obtained from the marrow of the mi/mi animals. The marrows from such mice were also used to screen for SCF-dependent CFU. There was no difference in CFU obtained from the various mi genotypes with or without the IFNAR1 protein (Fig. 4B).

The enrichment for IL-7 CFU in the marrow of the Mitf wild-type and heterozygote animals lacking the IFNAR1 protein compared with those expressing the receptor (Fig. 4A, left and middle panels) (without the receptor, black bar) suggested that there is a pool of precursor cells in the marrow whose numbers were expanded in the absence of type I IFN signaling. We sought to identify these precursors by first depleting marrow samples of lineage-committed cells followed by FACS analysis of the remaining cells. For these analyses, C57BL/6 mice were compared with C57BL/6 mice lacking the IFNAR1 protein. Two different strategies were taken. First, cells expressing Ter119, CD19 and Gr-1 (thus already committed to B lymphocyte or granulocyte lineages) were removed by magnetic bead depletion. The remaining cells (which represent immature marrow cells with the potential to contribute to multiple lineages) were stained with antibodies against the c-kit receptor and B220. The IFNAR1-deficient marrow showed a significant increase in cells expressing c-kit only (8.5% wild type versus 36.2% for the KO) (Fig. 5A). In addition, the receptor-deficient marrow demonstrated the loss of a significant percentage of B220+ single-positive cells (18.5–6.2%).

The second strategy utilized marrow samples that were depleted of cells possessing Ter119 and Gr-1 (removing cells committed to a granulocyte lineages), and then counterstained for c-kit, B220 and the IL-7R (Fig. 5B). Depleted marrow obtained from the IFNAR1-deficient animal consistently included more immature precursor cells (double negatives) than did the wild-type animal. This difference is most evident in the B220/IL-7 analysis in which the wild-type animal possessed 19.7% double-positive B lineage precursors and 29.4% double-negative cells, while the receptor-deficient animal possessed 5.2% B lineage precursors and 48.3% double-negative cells. These data do not identify the end-stage capabilities of double-negative precursor cells, but do suggest that the lack of response to type I IFNs increases the percentage of uncommitted precursors in the marrow. It is not known which of the type I IFNs (including loss of response to limitin) would be responsible for the differences observed in the B cell precursor subsets.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In this report, we have analyzed the effect type I IFNs have upon marrow cell development in the mi and wild-type mouse. Osteoblasts utilize the expression of RANKL and its decoy receptor, osteoprotegerin (OPG), to increase or decrease osteoclast differentiation and function (16, 17, 3436). In mi marrow, RANKL expression is elevated which can be viewed as an expected osteoblast response to the dysfunctional mi osteoclast. The expression of OPG between such marrows, however, remains the same (7). Similarly, expression of RANK on the surface of the mi osteoclast might also be expected to increase: in fact RANK expression is elevated in mi marrow (7).

Takayanagi et al. demonstrated that production of IFN-ß is induced in osteoclasts following RANK signaling (20). Their analyses considered this cytokine within an autocrine autoregulatory loop. However, an accentuation of this loop could lead to the release of excess IFN-ß. Type I IFNs including IFN-ß have been shown to inhibit the proliferation of IL-7-dependent bone marrow cells in short-term culture (22). These studies were expanded in vivo and demonstrated that mice treated with type I IFNs exhibited a block in marrow B cell differentiation (23, 37). Cooper and associates proposed that type I IFNs predispose maturing B cells for apoptosis (29). Mice lacking the type I IFNR do possess a skewed antibody repertoire (28). If differentiating B cells are indeed poised upon the razors edge of survival or apoptosis via type I IFN priming, then over-production of IFN-ß in the marrow would be expected to deplete the site of maturing B cells.

The generation of the mi mouse that lacked expression of the key receptor component for the type I IFNs allowed for us to directly test this hypothesis: these mice did show a return of B cell precursors (CD19+ and B220+) as well as a dramatic increase of marrow precursors in general (defined as Gr-1/B220 double-negative cells). It should be noted, however, that the level of B cell precursor reconstitution in the marrow of the mi IFNAR1-deficient animal did not equal that of the normal wild-type mouse, indicating that there are additional factors within the mi marrow that compromise B cell development.

The analysis of the control animals, those with one or two wild-type Mitf alleles, in the presence or absence of the IFNAR1, surprisingly demonstrated that the number of IL-7-dependent CFUs (per cell count) was elevated in the receptor-deficient animals compared with wild-type animals. The same phenomenon was not observed for SCF-dependent-CFUs, suggesting a direct inhibitory effect on IL-7-dependent lymphocyte precursor cells by the type I IFNs.

The key question raised by these data is why lymphocyte precursors returned to the mi marrow when type I IFN signaling was lost. The data derived from both the mi and Mitf wild-type animals lacking IFNAR1 demonstrated that normal type I IFN signaling suppressed the maintenance of lymphocyte progenitor cells (as defined by IL-7-dependent CFU) but that such signaling was required for full expansion of the maturing cells (as evidenced by the reduction of B220/IL-7R double-positive cells in wild-type, IFNAR1-deficient marrow). These data suggest that the type I IFNs are critical in the homeostatic maintenance of marrow lymphocyte precursors. Akin to the RANKL and RANK network for osteoblast and osteoclast functions, there must exist a type I IFN pathway that is functional in the normal marrow in the absence of any exogenous stimulation such as a viral infection. This pathway presumably places a restriction upon the key lineage checkpoints utilized by either (or both) uncommitted precursor cells or lymphocyte progenitors.


    Acknowledgements
 
We thank Herbert Virgin for supplying the mice lacking the type I IFNR (IFNAR1) and M. Aguet for allowing us to analyze the mice. We gratefully acknowledge our colleagues at the university including Sherrie Perkins and members of the Weis laboratories for valuable critiques of the research and manuscript. This research was supported by National Institutes of Health (NIH) grants AI-42032, AI-060618 and AI-24158 (J.H.W.) and NIH grants AI-32223 and AR-43521 (J.J.W.).


    Abbreviations
 
CFU   colony-forming unit
KO   knockout
mi   microphthalmic
MITF   microphthalmia-associated transcription factor
NIH   National Institutes of Health
OPG   osteoprotegerin
RANK   receptor activator of nuclear factor {kappa}B
RANKL   receptor activator of nuclear factor {kappa}B ligand
RT   reverse transcription

    Notes
 
Transmitting editor: T. Tedder

Received 14 January 2005, accepted 26 August 2005.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Hodgkinson, C. A., Moore, K. J., Nakayama, A. et al. 1993. Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix-loop-helix-zipper protein. Cell 74:395.[CrossRef][ISI][Medline]
  2. Mansky, K. C., Marfatia, K., Purdom, G. H., Luchin, A., Hume, D. A. and Ostrowski, M. C. 2002. The microphthalmia transcription factor (MITF) contains two N-terminal domains required for transactivation of osteoclast target promoters and rescue of mi mutant osteoclasts. J. Leukoc. Biol. 71:295.[Abstract/Free Full Text]
  3. Hemesath, T. J., Steingrimsson, E., McGill, G. et al. 1994. Microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family. Genes Dev. 8:2770.[Abstract/Free Full Text]
  4. Moore, K. J. 1995. Insight into the microphthalmia gene. Trends Genet. 11:442.[CrossRef][ISI][Medline]
  5. Roundy, K., Kollhoff, A., Eichwald, E. J., Weis, J. J. and Weis, J. H. 1999. Microphthalmic mice display a B cell deficiency similar to that seen for mast and NK cells. J Immunol. 163:6671.[Abstract/Free Full Text]
  6. Tagaya, H., Kunisada, T., Yamazaki, H. et al. 2000. Intramedullary and extramedullary B lymphopoiesis in osteopetrotic mice. Blood 95:3363.[Abstract/Free Full Text]
  7. Roundy, K., Smith, R., Weis, J. J. and Weis, J. H. 2003. Overexpression of RANKL implicates IFN-beta-mediated elimination of B-cell precursors in the osteopetrotic bone of microphthalmic mice. J. Bone Miner. Res. 18:278.[CrossRef][ISI][Medline]
  8. Theill, L. E., Boyle, W. J. and Penninger, J. M. 2002. RANK-L and RANK: T cells, bone loss, and mammalian evolution. Annu. Rev. Immunol. 20:795.[CrossRef][ISI][Medline]
  9. Lange, U., Saitou, M., Western, P., Barton, S. and Surani, M. 2003. The Fragilis interferon-inducible gene family of transmembrane proteins is associated with germ cell specification in mice. BMC Dev. Biol. 3:1.[CrossRef][Medline]
  10. Dutt, P., Wang, J. F. and Groopman, J. E. 1998. Stromal cell-derived factor-1 alpha and stem cell factor/kit ligand share signaling pathways in hemopoietic progenitors: a potential mechanism for cooperative induction of chemotaxis. J. Immunol. 161:3652.[Abstract/Free Full Text]
  11. Ma, Q., Jones, D. and Springer, T. A. 1999. The chemokine receptor CXCR4 is required for the retention of B lineage and granulocytic precursors within the bone marrow microenvironment. Immunity 10:463.[CrossRef][ISI][Medline]
  12. Ansel, K. M., Ngo, V. N., Hyman, P. L. et al. 2000. A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature 406:309.[CrossRef][Medline]
  13. Legler, D. F., Loetscher, M., Roos, R. S., Clark-Lewis, I., Baggiolini, M. and Moser, B. 1998. B cell-attracting chemokine 1, a human CXC chemokine expressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/CXCR5. J. Exp. Med. 187:655.[Abstract/Free Full Text]
  14. Anderson, D. M., Maraskovsky, E., Billingsley, W. L. et al. 1997. A homologue of the TNF receptor and its ligand enhance T-cell growth and dendritic-cell function. Nature 390:175[CrossRef][Medline]
  15. Wong, B. R., Josien, R., Lee, S. Y. et al. 1997. TRANCE (tumor necrosis factor [TNF]-related activation-induced cytokine), a new TNF family member predominantly expressed in T cells, is a dendritic cell-specific survival factor. J. Exp. Med. 186:2075.[Abstract/Free Full Text]
  16. Lacey, D. L., Timms, E., Tan, H. L. et al. 1998. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 93:165.[CrossRef][ISI][Medline]
  17. Yasuda, H., Shima, N., Nakagawa, N. et al. 1998. Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL. Proc. Natl Acad. Sci. USA 95:3597.[Abstract/Free Full Text]
  18. Nakagawa, N., Kinosaki, M., Yamaguchi, K. et al. 1998. RANK is the essential signaling receptor for osteoclast differentiation factor in osteoclastogenesis. Biochem. Biophys. Res. Commun. 253:395.[CrossRef][ISI][Medline]
  19. Hsu, H., Lacey, D. L., Dunstan, C. R. et al. 1999. Tumor necrosis factor receptor family member RANK mediates osteoclast differentiation and activation induced by osteoprotegerin ligand. Proc. Natl Acad. Sci. USA 96:3540.[Abstract/Free Full Text]
  20. Takayanagi, H., Kim, S., Matsuo, K. et al. 2002. RANKL maintains bone homeostasis through c-Fos-dependent induction of interferon-beta. Nature 416:744.[CrossRef][Medline]
  21. Biron, C. A. 2001. Interferons alpha and beta as immune regulators—a new look. Immunity 14:661.[CrossRef][ISI][Medline]
  22. Wang, J., Lin, Q., Langston, H. and Cooper, M. D. 1995. Resident bone marrow macrophages produce type 1 interferons that can selectively inhibit interleukin-7-driven growth of B lineage cells. Immunity 3:475.[CrossRef][ISI][Medline]
  23. Lin, Q., Dong, C. and Cooper, M. D. 1998. Impairment of T and B cell development by treatment with a type I interferon. J. Exp. Med. 187:79.[Abstract/Free Full Text]
  24. Muller, U., Steinhoff, U., Reis, L. F. et al. 1994. Functional role of type I and type II interferons in antiviral defense. Science 264:1918.[Abstract/Free Full Text]
  25. Tan, S. S. and Weis, J. H. 1992. Development of a sensitive reverse transcriptase PCR assay, RT-RPCR, utilizing rapid cycle times. Genome Res. 2:137.[Abstract/Free Full Text]
  26. Zabel, M. D., Weis, J. J. and Weis, J. H. 1999. Lymphoid transcription of the murine CD21 gene is positively regulated by histone acetylation. J. Immunol. 163:2697.[Abstract/Free Full Text]
  27. Takayanagi, H., Kim, S. and Taniguchi, T. 2002. Signaling crosstalk between RANKL and interferons in osteoclast differentiation. Arthritis Res. 4(Suppl. 3):S227.
  28. Vasconcellos, R., Braun, D., Coutinho, A. and Demengeot, J. 1999. Type I IFN sets the stringency of B cell repertoire selection in the bone marrow. Int. Immunol. 11:279.[Abstract/Free Full Text]
  29. Gongora, R., Stephan, R. P., Zhang, Z. and Cooper, M. D. 2001. An essential role for Daxx in the inhibition of B lymphopoiesis by type I interferons. Immunity 14:727.[CrossRef][ISI][Medline]
  30. Aoki, K., Shimoda, K., Oritani, K. et al. 2003. Limitin, an interferon-like cytokine, transduces inhibitory signals on B-cell growth through activation of Tyk2, but not Stat1, followed by induction and nuclear translocation of Daxx. Exp. Hematol. 31:1317.[CrossRef][ISI][Medline]
  31. Oritani, K., Medina, K. L., Tomiyama, Y. et al. 2000. Limitin: an interferon-like cytokine that preferentially influences B-lymphocyte precursors. Nat. Med. 6:659.[CrossRef][ISI][Medline]
  32. Kouro, T., Medina, K. L., Oritani, K. and Kincade, P. W. 2001. Characteristics of early murine B-lymphocyte precursors and their direct sensitivity to negative regulators. Blood 97:2708.[Abstract/Free Full Text]
  33. Hwang, S. Y., Hertzog, P. J., Holland, K. A. et al. 1995. A null mutation in the gene encoding a type I interferon receptor component eliminates antiproliferative and antiviral responses to interferons alpha and beta and alters macrophage responses. Proc. Natl Acad. Sci. USA 92:11284.[Abstract/Free Full Text]
  34. Simonet, W. S., Lacey, D. L., Dunstan, C. R. et al. 1997. Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell 89:309.[CrossRef][ISI][Medline]
  35. Tsuda, E., Goto, M., Mochizuki, S. et al. 1997. Isolation of a novel cytokine from human fibroblasts that specifically inhibits osteoclastogenesis. Biochem. Biophys. Res. Commun. 234:137.[CrossRef][ISI][Medline]
  36. Yasuda, H., Shima, N., Nakagawa, N. et al. 1998. Identity of osteoclastogenesis inhibitory factor (OCIF) and osteoprotegerin (OPG): a mechanism by which OPG/OCIF inhibits osteoclastogenesis in vitro. Endocrinology 139:1329.[Abstract/Free Full Text]
  37. Bosio, E., Cluning, C. L. and Beilharz, M. W. 2001. Low-dose orally administered type I interferon reduces splenic B cell numbers in mice. J. Interferon Cytokine Res. 21:721.[CrossRef][ISI][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
17/11/1495    most recent
dxh327v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Roundy, K. M.
Right arrow Articles by Weis, J. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Roundy, K. M.
Right arrow Articles by Weis, J. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?