International Immunology Advance Access originally published online on September 12, 2005
International Immunology 2005 17(11):1391-1397; doi:10.1093/intimm/dxh316
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Allograft inflammatory factor-1 (AIF-1) is crucial for the survival and pro-inflammatory activity of macrophages
Centre for the Study of Liver Disease and Department of Surgery, L9-41 Faculty of Medicine Building, University of Hong Kong, 21 Sassoon Road, Pokfulam, Hong Kong, China
Correspondence to: Z. F. Yang; E-mail: zfyang{at}hkucc.hku.hk
| Abstract |
|---|
|
|
|---|
Our previous studies revealed that macrophages played an important role in linking injury, inflammatory and immune response in small-for-size liver transplantation. However, the molecular basis that promoted macrophage activation was not clear. In the present study, we explored the potential role of allograft inflammatory factor-1 (AIF-1) in mediating the survival and pro-inflammatory activity of macrophages in a macrophage cell line. First, the expression of AIF-1 was investigated with the stimulation of pro-inflammatory cytokines and anti-inflammatory treatment. Second, the level of inducible nitric oxide synthase (iNOS) and the survival and migration activity of macrophages were determined with the alterations of AIF-1 expression. Finally, a potential molecule that regulated AIF-1 expression was identified by the proteomic approach. The macrophage cell line expressed a certain level of endogenous AIF-1, which could be enhanced by pro-inflammatory cytokines IL-1ß or tumor necrosis factor-
and suppressed by anti-inflammatory drug sodium salicylate. AIF-1 augmentation induced by AIF-1/PCDNA3.1(+) transfection enhanced the levels of iNOS and monocyte chemoattractant protein-1, and promoted the cell migration. On the other hand, suppression of AIF-1 expression by AIF-1/short interference RNA (siRNA) inhibited iNOS production, induced macrophage cell apoptosis and blocked the cell migration. Using two-dimensional electrophoresis, a disintegrin and metalloproteinase domain 3 (ADAM3) was identified after AIF-1/siRNA transfection. Transfection of ADAM3/PCDNA3.1(+) up-regulated the expression of AIF-1 and iNOS, whereas suppression of ADAM3 expression down-regulated AIF-1 and iNOS expression. In conclusion, AIF-1 played an important role in the survival and pro-inflammatory activity of macrophages, and ADAM3 might be an upstream molecule that regulated AIF-1 expression.
Keywords: allograft inflammatory factor-1, macrophages
| Introduction |
|---|
|
|
|---|
The monocyte/macrophage system has been shown to be responsible for a variety of diseases, including autoimmune disease (1), tissue injury (2) and acute and chronic allograft rejections (3, 4). Our previous studies revealed that early activation of macrophages played an important role in mediating injury, inflammation and cellular rejection in small-for-size liver transplantation (5, 6), and the angiogenesis processes during small-for-size graft regeneration might facilitate proliferation and migration activities of the macrophages (7). However, the molecular basis that mediates macrophage activities is still largely unclear.
Allograft inflammatory factor-1 (AIF-1) was first identified by Utans et al. (8) in 1995 in rat cardiac allografts with chronic rejection, in which inflammatory reaction played a key role, and Autieri et al. (9) further demonstrated that expression of AIF-1 was correlated with the severity of cardiac rejection in clinical heart transplantation. Enhancement of AIF-1 expression was found to be able to augment production of IL-6, -10 and -12 in a mouse macrophage cell line (10). In addition, AIF-1 was identified to be a Rac1-activating protein that promoted vascular smooth muscle cell migration (11). However, the direct relationship between AIF-1 expression and macrophage activities during the acute phase injury and inflammation is not fully understood. In addition, the molecular basis that regulates AIF-1 expression also remains to be determined.
Therefore, in an in vitro system, we tried to explore the expression of AIF-1 under the inflammatory circumstance, and the impact of AIF-1 alterations on macrophage activities and molecular changes in these cells. In addition, we attempted to identify any potential upstream molecule that regulates AIF-1 expression.
| Methods |
|---|
|
|
|---|
Cell lines
Macrophage cell line CRL-2192 was purchased from the American Type Culture Collection (Manassas, VA, USA). Cells were maintained in F-12K medium with 15% fetal bovine serum (FBS) and 1% penicillinstreptomycin (Life Technologies, Carlsbad, CA, USA) at 37°C in a humidified atmosphere of 5% CO2 in air. Cells were cultured in serum-free medium for 12 h prior to adding rat IL-1ß 10 ng ml, tumor necrosis factor-
(TNF-
) 10 ng ml (BioVision, Inc., Mountain View, CA, USA), sodium salicylate 1 mM or sodium salicylate combined with either IL-1ß or TNF-
for another 12 h. Cells were then harvested and subjected to western blot analysis.
Transfection and short interference RNA
Full-length AIF-1 and a disintegrin and metalloproteinase domain 3 (ADAM3) were cloned into PCDNA3.1(+) vector by T4 DNA ligase (Life Technologies). Primer sequences for rat AIF-1 were sense, 5' CGGGATCCGAGCTATGAGCCAGAGCAAG 3', and anti-sense, 5' GGAATTCCCCACCGTGTTATATCCACC 3'. Primer sequences for rat ADAM3 were sense 5' CAGGATCCCTATTCTGCCTTGCCTGCTT 3' and anti-sense, 5' CAGAATTCCGGAGAAAGAGATGGACTGG 3'. BamHI and EcoRI sites (underlined sequences) were inserted into the primer sequences for cloning purpose. AIF-1/PCDNA3.1(+) and ADAM3/PCDNA3.1(+) were then transfected into the macrophage cell line by FuGENE 6 transfection reagent (Roche, Basel, Switzerland) and cultured for 24 h. The three pairs of AIF-1/short interference RNAs (siRNAs) for AIF-1 targeted on the sites of 1323 (S1), 1271 (S2) and 1135 (S3), respectively, in the rat AIF-1 gene, with each sequence lengthening 21 bp. The two pairs of ADAM3/siRNAs targeted on the sites of 253 (siAD1) and 1373 (siAD2), respectively, in the rat ADAM3 gene, with each sequence lengthening 21 bp. The siRNAs were transfected into the macrophage cell line by jetSI siRNA delivery reagent (Qbiogene, Irvine, CA, USA), and incubated for 24 h. The siRNA targeting on luciferase gene was used as a negative control, and the same amount of siRNA delivery reagent only was added to the cell line to determine its possible toxicity in apoptosis. The AIF-1/PCDNA3.1(+) and AIF-1/siRNAs were also co-transfected into the macrophage cell line by FuGENE 6 transfection reagent, and maintained for 24 h.
Flow cytometry
After a 24-h incubation, the cells were labeled with FITC-conjugated Annexin V antibody (BD Biosciences PharMingen, San Diego, CA, USA), and detected in a FACS Calibur (Becton Dickinson Immunocytometry Systems, San Jose, CA, USA). Unstained cells were used as a negative control.
Cell migration assay
After receiving the above treatment for 24 h, cells were harvested and suspended in 50 µl F-12K medium with 1.5% FBS, and inoculated on the surface of a polycarbonate filter of a 96-well microchemotaxis chamber (1 x 105 cells per well) (Neuroprobe, Bethesda, MD, USA). In the lower chamber, 299 µl 1.5% FBSF-12K medium was applied into each well. The cells were then cultured at 37°C in a humidified atmosphere of 5% CO2 in air for 4 h before they were counted under microscope. Five areas were randomly chosen in each well and the number of cells was expressed as mean ± standard deviation.
Reverse transcriptionPCR and western blot
After a 24-h culture, macrophages were harvested, and reverse transcriptionPCR and western blot were performed. Total RNA extraction, first-strand DNA synthesis and PCR reaction were performed according to the methods previously described (5). Primer sequences for rat inducible nitric oxide synthase (iNOS) were sense, 5' CTGGCAGCAGCGGCTCCATG 3', and anti-sense, 5' GAAAAGACCGCACCGAAGAT 3', and for rat ADAM3 were sense, 5' GACTTACGGAATTGAACCCTTAGAG 3', and anti-sense, 5' TAACATCACAGTCATCTTCAGCTGG 3'. Total protein was extracted from the cells and the protein levels were determined by standard western blot analysis using 12% SDS-PAGE gel. Antibodies were purchased from Santa Cruz Biotechnology (polyclonal rabbit anti-rat iNOS antibody), Upstate, Waltham, MA, USA [polyclonal rabbit anti-rat monocyte chemoattractant protein-1 (MCP-1) and polyclonal rabbit anti-rat caspase 3 antibodies] and Cell Signaling Technology, Inc., Beverly, MA, USA (polyclonal rabbit anti-rat Bax antibody). The rabbit anti-rat AIF-1 polyclonal antibody was kindly provided by Michael Autieri (12).
In addition, culture medium was also collected at the time of cell harvesting for detection of nitric oxide (NO).
Measurement of NO levels in culture medium
After transfection with AIF-1/PCDNA3.1(+) and being cultured for 24 h, the culture medium was collected, and the production of NO by the macrophage cell line was detected using Nitric Oxide Assay Kit (Calbiochem, San Diego, CA, USA). Fifty microliters of sample was added into each well of a 96-well plate. All the procedures were performed according to the instruction of the Kit.
Two-dimensional electrophoresis, in-gel trypsin digestion and mass spectrometry
After transfection and incubation for 24 h, the macrophage cells (1 x 106) were harvested. Proteins were extracted by homogenizing in 0.1 ml extraction buffer containing 8 M urea, 4% (w/v) CHAPS, 40 mM Tris, 0.2% (w/v) carrier ampholytes (pH 310) and 2 mM tributyl phosphine. Thirty micrograms of protein was applied to two-dimensional (2-D) electrophoresis according to our previous protocol (13). An up-regulated protein (compared with non-transfected or siRNA-targeting luciferase gene), with molecular weight
80 kDa, in AIF-1/siRNA transfected cells was excised from the gel, and digested by trypsin. The digested peptides were analyzed using a Voyage-De STR matrix-assisted laser desorption ionization with time of flight (MALDI-TOF) mass spectrometer (Applied Biosystems, Foster City, CA, USA) and the peptide mass spectra were generated. Peptide mass profiles produced by MALDI-TOF were then analyzed using MS-FIT (http://prospector.ucsf.edu). The protein was identified with high confidence based on high scores and sequence coverage by comparing its peptide masses with the theoretical masses derived from the sequences displayed in SWISS-PROT and the National Center for Biotechnology Information data banks.
Statistical analysis
Comparisons of Annexin V-positive cells and the number of migrated cells between different treatment groups were performed using one-way analysis of variance (GraphPad, San Diego, CA, USA). P-value <0.05 was considered as statistically significant.
| Results |
|---|
|
|
|---|
Pro-inflammatory cytokines induced up-regulation of AIF-1 in macrophages
The macrophage cell line expressed a certain level of endogenous AIF-1. With the stimulation of pro-inflammatory cytokines IL-1ß or TNF-
, an increased expression of AIF-1 was detected. Administration of sodium salicylate down-regulated the endogenous level of AIF-1, and also reversed the up-regulation of AIF-1 which was induced by either IL-1ß or TNF-
(Fig. 1).
|
The levels of iNOS and NO production in macrophage cell line altered with the expression of AIF-1
After transfection with AIF-1/PCDNA3.1(+), an enhanced expression of AIF-1 was detected in the macrophage cell line, whereas AIF-1/siRNA (both S2 and S3) down-regulated the level of AIF-1 in both lower cell number (5 x 105) and higher cell number (1 x 106), whereas transfection of siRNA-targeting luciferase gene did not alter the level of AIF-1. Simultaneously, the mRNA and protein levels of iNOS displayed a similar pattern with AIF-1 expression. Co-transfection of AIF-1/siRNA with AIF-1/PCDNA3.1(+) could obviously reverse the up-regulated protein levels of AIF-1 and iNOS induced by AIF-1/PCDNA3.1(+) transfection (Fig. 2A).
|
The macrophage cell line produced a certain level of NO under normal culture condition. With the transfection of AIF-1/PCDNA3.1(+), an increased level of NO was detected in the culture medium, whereas a reduction of NO was detected with the transfection of AIF-1/siRNA. Co-transfection of AIF-1/PCDNA3.1(+) and AIF-1/siRNA reversed the increase of NO production induced by AIF-1/PCDNA3.1(+), but the level was still higher than that without transfection (Fig. 2B).
AIF-1 suppression induced apoptosis of macrophages
With the normal culture condition, a small number of macrophage cells were undergoing apoptosis. The siRNA delivery reagent only did not alter the number of apoptotic cells. In addition, transfection of AIF-1/PCDNA3.1(+) or siRNA-targeting luciferase gene did not affect the number of apoptotic cells. However, blocking the expression of AIF-1 by AIF-1/siRNA induced a significantly increased number of apoptotic macrophages, whereas co-transfection of AIF-1/PCDNA3.1(+) with AIF-1/siRNA could reverse the increase of apoptotic cells induced by AIF-1/siRNA (Fig. 3A). AIF-1/siRNA transfection stimulated an augmentation of the cleaved form of caspase 3 and Bax in the macrophage cell line, whereas the up-regulation of cleaved caspase 3 and Bax could be inhibited by co-transfection of AIF-1/PCDNA3.1(+) with AIF-1/siRNA (Fig. 3B).
|
AIF-1 up-regulation promoted macrophage cell migration
By cell migration assay, it was found that AIF-1/PCDNA3.1(+) transfection could induce a significantly increased number of migrated cells, whereas the migration behavior was partially suppressed when AIF-1/siRNA (both S2 and S3) was co-transfected with AIF-1/PCDNA3.1(+) (Fig. 4A). With the increase of migrated cells, an augmentation of MCP-1 expression was detected after AIF-1/PCDNA3.1(+) transfection, whereas blockade of the expression of AIF-1 could down-regulate the level of MCP-1 (Fig. 4B).
|
ADAM3 regulated AIF-1 expression
By 2-D electrophoresis, 10 proteins were found up-regulated with AIF-1/siRNA transfection. Among these 10 molecules, 4 demonstrated a down-regulation in the AIF-1/PCDNA3.1(+) transfected cells. Therefore, we considered that these molecules might be closely related to AIF-1 expression. By mass spectrometry and after searching in the online database, a protein with molecular weight
80 kDa was identified as ADAM3. By using specific primers, the mRNA level of ADAM3 was confirmed to be higher in the AIF-1/siRNA transfected cells (Fig. 5). Transfection of ADAM3/PCDNA3.1(+) and suppression of ADAM3 by ADAM3/siRNA up-regulated and reduced the mRNA level of this molecule, respectively, and at the same time, altered the levels of AIF-1 and iNOS accordingly (Fig. 6).
|
|
| Discussion |
|---|
|
|
|---|
Our previous studies have demonstrated the potential role of macrophages in linking injury, inflammation and acute rejection in small-for-size liver transplantation (5, 6). However, the initiation of the early macrophage activation in the small-for-size liver grafts remains unclear. Our unpublished data revealed that AIF-1 was up-regulated as early as 1 h after reperfusion in these small-for-size liver grafts, indicating the potential role of AIF-1 in mediating macrophage activity during acute phase injury and inflammation. Therefore, we further investigated the relationship between AIF-1 expression and pro-inflammatory activity of macrophages in the present study.
It was reported that pro-inflammatory cytokine IFN-
induced AIF-1 expression in macrophages (14). Our study revealed that pro-inflammatory cytokines IL-1ß and TNF-
could also induce AIF-1 up-regulation, and non-steroid anti-inflammatory drug sodium salicylate could decrease the expression of AIF-1, and suppress the up-regulation of AIF-1 stimulated by pro-inflammatory cytokines, indicating a close relationship between inflammatory status and AIF-1 expression. In addition, an enhanced expression of AIF-1 by AIF-1/PCDNA3.1(+) transfection stimulated an up-regulation of iNOS in the macrophage cell line, and a reduced expression of iNOS was induced by AIF-1 suppression, providing a direct evidence that AIF-1 achieved its pro-inflammatory properties in an iNOS-dependent manner.
Corresponding to iNOS expression, the production of NO was also regulated by AIF-1/PCDNA3.1(+) and AIF-1/siRNA transfection. However, the role of NO on cell viability and apoptosis was quite variable, depending largely on the level of NO produced (15, 16). In our unpublished experiments, we found an increased number of apoptotic cells during the course of stable clone selection after AIF-1/PCDNA3.1(+) transfection, indicating that high levels of AIF-1 and NO might be toxic to the cells. However, further study is needed to explore this phenomenon.
The present study revealed, for the first time, that AIF-1 expression was crucial for macrophage cell survival, as AIF-1/siRNA transfection induced a significantly increased number of apoptotic cells in the macrophage cell line, whereas AIF-1/PCDNA3.1(+) and AIF-1/siRNA co-transfection protected those macrophages from undergoing apoptosis. AIF-1/siRNA transfection stimulated up-regulation of pro-apoptotic molecules, Bax and caspase 3, whose over-expression was associated with cytochrome c release (17) and a marker of the end stage of the apoptotic pathway (18), whereas AIF-1/PCDNA3.1(+) and AIF-1/siRNA co-transfection reversed the increased expression of these two molecules, indicating that the alterations of Bax and caspase 3 played an important role in AIF-1-related cell death and survival. Similar to its ability to promote vascular cell migration, AIF-1 was also involved in the migration activity of macrophages, probably through augmenting the expression of MCP-1, as MCP-1 was well documented to be a chemotactic molecule that promoted macrophage migration (19, 20).
Although the pro-inflammatory characteristics of AIF-1 were documented by some studies (21, 22), few reports have explored the molecules that directly regulated AIF-1 expression. Members of the ADAM family of proteolytic enzymes play an essential role in signaling many single transmembrane-bound proteins, ranging from cell-surface receptors to growth factors and cytokines (2325), and it was reported that a metalloproteinase disintegrin could regulate cell migration in Caenorhabditis elegans (26). Therefore, targeting on the ADAM family is a new therapeutic strategy for the treatment of a variety of diseases (27, 28). Using the proteomic technique, we identified one of the ADAM members, ADAM3, as a potential upstream molecule that regulated AIF-1 expression as stimulating the expression of ADAM3 could induce an increased expression of AIF-1 and iNOS in the macrophages, whereas suppressing the expression of ADAM3 could significantly down-regulate the levels of AIF-1 and iNOS in these cells. However, suppression of AIF-1 expression induced up-regulation of ADAM3, probably due to a feedback regulation between these two molecules. On the other hand, blocking of the ADAM3 expression neither affected the proliferation properties of the macrophages nor obviously increased the number of apoptotic cells (data not shown), implying that ADAM3 mediated the pro-inflammatory activities of macrophages in a cell proliferation-independent manner and ADAM3 might affect multiple apoptosis-related molecules. However, further studies are needed to explore the mechanism.
In conclusion, AIF-1 expression was related to the inflammatory status of macrophages. AIF-1 expression played an important role in mediating the survival, migration and pro-inflammatory properties of macrophages. ADAM3 was identified as a potential upstream molecule that regulated AIF-1 expression.
| Acknowledgements |
|---|
The study was supported by the grant from the Sun Chieh Yeh Research Foundation for Hepatobiliary and Pancreatic Surgery of the University of Hong Kong. The rabbit anti-rat AIF-1 polyclonal antibody used in this project was kindly provided by Michael Autieri, Department of Physiology, Cardiovascular Research Centre, Temple University School of Medicine, Philadelphia, PA, USA.
| Abbreviations |
|---|
| ADAM3 | a disintegrin and metalloproteinase domain 3 |
| AIF-1 | allograft inflammatory factor-1 |
| 2-D | two-dimensional |
| FBS | fetal bovine serum |
| iNOS | inducible nitric oxide synthase |
| MALDI-TOF | matrix-assisted laser desorption ionization with time of flight |
| MCP-1 | monocyte chemoattractant protein-1 |
| NO | nitric oxide |
| siRNA | short interference RNA |
TNF-![]() | tumor necrosis factor-![]() |
| Notes |
|---|
Transmitting editor: K. Sugamura
Received 13 May 2005, accepted 2 August 2005.
| References |
|---|
|
|
|---|
- Richards, P. J., Williams, A. S., Goodfellow, R. M. and Williams, B. D. 1999. Liposomal clodronate eliminates synovial macrophages, reduces inflammation and ameliorates joint destruction in antigen-induced arthritis. Rheumatology (Oxford) 38:818.[Medline]
- Jose, M. D., Ikezumi, Y., van Rooijen, N., Atkins, R. C. and Chadban, S. J. 2003. Macrophages act as effectors of tissue damage in acute renal allograft rejection. Transplantation 76:1015.[CrossRef][ISI][Medline]
- Sun, Z., Wada, T., Maemura, K. et al. 2003. Hepatic allograft-derived Kupffer cells regulate T cell response in rats. Liver Transplant. 9:489.[CrossRef][ISI][Medline]
- Yun, J. J., Whiting, D., Fischbein, M. P. et al. 2004. Combined blockade of the chemokine receptors CCR1 and CCR5 attenuates chronic rejection. Circulation 109:932.
[Abstract/Free Full Text] - Yang, Z. F., Ho, D. W., Chu, A. C., Wang, Y. Q. and Fan, S. T. 2004. Linking inflammation to acute rejection in small-for-size liver allografts: the potential role of early macrophage activation. Am. J. Transplant. 4:196.[CrossRef][ISI][Medline]
- Yang, Z. F., Tsui, T. Y., Ho, D. W., Tang, T. C. and Fan, S. T. 2004. Heme oxygenase-1 potentiates the survival of small-for-size liver graft. Liver Transplant. 10:784.[CrossRef][ISI][Medline]
- Yang, Z. F., Poon, R. T., Luo, Y. et al. 2004. Up-regulation of vascular endothelial growth factor (VEGF) in small-for-size liver grafts enhances macrophage activities through VEGF receptor 2-dependent pathway. J. Immunol. 173:2507.
[Abstract/Free Full Text] - Utans, U., Arceci, R. J., Yamashita, Y. and Russell, M. E. 1995. Cloning and characterization of allograft inflammatory factor-1: a novel macrophage factor identified in rat cardiac allografts with chronic rejection. J. Clin. Invest. 95:2954.[ISI][Medline]
- Autieri, M. V., Kelemen, S., Thomas, B. A., Feller, E. D., Goldman, B. I. and Eisen, H. J. 2002. Allograft inflammatory factor-1 expression correlates with cardiac rejection and development of cardiac allograft vasculopathy. Circulation 106:2218.
[Abstract/Free Full Text] - Watano, K., Iwabuchi, K., Fujii, S. et al. 2001. Allograft inflammatory factor-1 augments production of interleukin-6, -10 and -12 by a mouse macrophage line. Immunology 104:307.[CrossRef][ISI][Medline]
- Autieri, M. V., Kelemen, S. E. and Wendt, K. W. 2003. AIF-1 is an actin-polymerizing and Rac1-activating protein that promotes vascular smooth muscle cell migration. Circ. Res. 92:1107.
[Abstract/Free Full Text] - Autieri, M. V. and Carbone, C. M. 2001. Overexpression of allograft inflammatory factor-1 promotes proliferation of vascular smooth muscle cells by cell cycle deregulation. Arterioscler. Thromb. Vasc. Biol. 21:1421.
[Abstract/Free Full Text] - Yang, Z. F., Ho, D. W., Lam, C. T. et al. 2005. Identification of brain-derived neurotrophic factor as a novel functional protein in hepatocellular carcinoma. Cancer Res. 65:219.
[Abstract/Free Full Text] - Sibinga, N. E., Feinberg, M. W., Yang, H., Werner, F. and Jain, M. K. 2002. Macrophage-restricted and interferon gamma-inducible expression of the allograft inflammatory factor-1 gene requires Pu.1. J. Biol. Chem. 277:16202.
[Abstract/Free Full Text] - Hortelano, S., Castrillo, A., Alvarez, A. M. and Bosca, L. 2000. Contribution of cyclopentenone prostaglandins to the resolution of inflammation through the potentiation of apoptosis in activated macrophages. J. Immunol. 165:6525.
[Abstract/Free Full Text] - Hortelano, S., Traves, P. G., Zeini, M., Alvarez, A. M. and Bosca, L. 2003. Sustained nitric oxide delivery delays nitric oxide-dependent apoptosis in macrophages: contribution to the physiological function of activated macrophages. J. Immunol. 171:6059.
[Abstract/Free Full Text] - Jurgensmeier, J. M., Xie, Z., Deveraux, Q., Ellerby, L., Bredesen, D. and Reed, J. C. 1998. Bax directly induces release of cytochrome c from isolated mitochondria. Proc. Natl Acad. Sci. USA 95:4997.
[Abstract/Free Full Text] - Steinbrecher, U. P., Gomez-Munoz, A. and Duronio, V. 2004. Acid sphingomyelinase in macrophage apoptosis. Curr. Opin. Lipidol. 15:531.[CrossRef][ISI][Medline]
- Khmelewski, E., Becker, A., Meinertz, T. and Ito, W. D. 2004. Tissue resident cells play a dominant role in arteriogenesis and concomitant macrophage accumulation. Circ. Res. 95:E56.[CrossRef][ISI][Medline]
- Sho, E., Sho, M., Hoshina, K., Kimura, H., Nakahashi, T. K. and Dalman, R. L. 2004. Hemodynamic forces regulate mural macrophage infiltration in experimental aortic aneurysms. Exp. Mol. Pathol. 76:108.[CrossRef][ISI][Medline]
- Morohashi, T., Iwabuchi, K., Watano, K. et al. 2003. Allograft inflammatory factor-1 regulates trinitrobenzene sulphonic acid-induced colitis. Immunology 110:112.[CrossRef][ISI][Medline]
- Nishimura, M., Obayashi, H., Mizuta, I. et al. 2003. TNF, TNF receptor type 1, and allograft inflammatory factor-1 gene polymorphisms in Japanese patients with type 1 diabetes. Hum. Immunol. 64:302.[CrossRef][ISI][Medline]
- Black, R. A., Rauch, C. T., Kozlosky, C. J. et al. 1997. A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature 385:729.[CrossRef][Medline]
- Sunnarborg, S. W., Hinkle, C. L., Stevenson, M. et al. 2002. Tumor necrosis factor-alpha converting enzyme (TACE) regulates epidermal growth factor receptor ligand availability. J. Biol. Chem. 277:12838.
[Abstract/Free Full Text] - Moss, M. L. and Bartsch, J. W. 2004. Therapeutic benefits from targeting of ADAM family members. Biochemistry 43:7227.[CrossRef][Medline]
- Nishiwaki, K., Hisamoto, N. and Matsumoto, K. 2000. A metalloprotease disintegrin that controls cell migration in Caenorhabditis elegans. Science 288:2205.
[Abstract/Free Full Text] - Asakura, M., Kitakaze, M., Takashima, S. et al. 2002. Cardiac hypertrophy is inhibited by antagonism of ADAM12 processing of HB-EGF: metalloproteinase inhibitors as a new therapy. Nat. Med. 8:35.[CrossRef][ISI][Medline]
- Gschwind, A., Hart, S., Fischer, O. M. and Ullrich, A. 2003. TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells. EMBO J. 22:2411.[CrossRef][ISI][Medline]
This article has been cited by other articles:
![]() |
F. Alkassab, P. Gourh, F. K. Tan, T. McNearney, M. Fischbach, C. Ahn, F. C. Arnett, and M. D. Mayes An allograft inflammatory factor 1 (AIF1) single nucleotide polymorphism (SNP) is associated with anticentromere antibody positive systemic sclerosis Rheumatology, August 1, 2007; 46(8): 1248 - 1251. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






