International Immunology Advance Access originally published online on July 5, 2004
International Immunology 2004 16(8):1161-1171; doi:10.1093/intimm/dxh116
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2004 The Japanese Society for Immunology
ORIGINAL RESEARCH PAPERS |
BASH-deficient mice: limited primary repertoire and antibody formation, but sufficient affinity maturation and memory B cell generation, in anti-NP response
1 Division of Molecular Biology and 2 Division of Biosignaling, Research Institute for Biological Sciences, Tokyo University of Science, Yamazaki 2669, Noda, Chiba 278-0022, Japan
3 Present address: Department of Molecular Embryology, Research Institute, Osaka Medical Center for Maternal and Child Health, 840, Murodo-cho, Izumi, Osaka 594-1101, Japan
4 Present address: Age Dimension Research Center, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba Central 6, 1-1-1, Higashi, Tsukuba, Ibaraki 305-8566, Japan
Correspondence to: D. Kitamura; E-mail: kitamura{at}rs.noda.tus.ac.jp
| Abstract |
|---|
|
|
|---|
Signaling through the B cell antigen receptor (BCR) induces activation and proliferation of B cells, a response that requires the adaptor protein BASH (also known as BLNK/SLP-65). Although BASH and other molecules, such as Btk, PLC
2 and PKCß, are known to be essential for T cell-independent immune responses in vivo, their requirement during T cell-dependent immune responses, especially their role in antibody affinity-maturation and memory B cell generation remains unclear. In this study, we examined primary and memory immune responses to the T cell-dependent hapten antigen, (4-hydroxy-3-nitrophenyl)acetyl (NP) conjugated to chicken gammaglobulin (CGG), in BASH-deficient mice on a C57BL/6 background. In the primary response, NP-specific IgM was barely produced and the typical anti-NP IgG1/
production was markedly attenuated, but
chain was unexpectedly over-represented in the anti-NP antibodies. In contrast, CGG-specific IgG1 was normally produced. In the memory response, IgG1/
antibody with high affinity to NP was produced at normal level in the mutant mice. The frequency and distribution of somatic mutations in the VH186.2 genes of the anti-NP IgG1/
antibody were also normal. These results indicate that BASH-mediated BCR signaling is dispensable for somatic hypermutation and affinity selection, as well as generation and response of memory B cells. Interestingly, mutated VH genes with the same clonal origin were prominent in the anti-NP antibodies of BASH-deficient mice, indicating that a limited number of original clones had been recruited into the memory compartment. Thus, the scarcity of specific clones in the primary repertoire and an impaired primary response is not detrimental to the quality and quantity of a memory response.
Keywords: adaptor protein, affinity maturation, B cell antigen receptor, signal transduction, somatic hypermutation
| Introduction |
|---|
|
|
|---|
In a primary immune response to a T cell-dependent (TD) antigen (Ag), Ag-specific B cells first undergo Ag-driven activation in the periarteriolar lymphoid sheath in T cell zones of the spleen (1). Ag-specific B cells either differentiate locally to form foci of plasma cells or migrate to the secondary lymphoid follicles to form germinal centers (GCs). Short-lived plasma cells in the foci are responsible for acute production of IgM class antibodies, and also IgG class after 1 week post-immunization (2). GCs play an important role in affinity maturation following somatic hypermutation and generation of memory B cells as well as long-lived plasma cells (37). Memory B cells are derived from GC B cells and generally express class-switched immunoglobulin (Ig) as an antigen receptor which has been somatically mutated and selected for high affinity binding to the Ag (811). Established memory B cells are maintained for a long time without persisting Ag (12) and respond promptly to a secondary challenge of Ag to produce high affinity antibody. The help of activated T cells through the interaction between CD40 and CD40L, as well as B7-2 and CD28, is required for the generation and response of memory B cells (1316).
BCR engagement evokes a signal whose outcome, such as activation, proliferation, differentiation or apoptosis, depends on the developmental stage and circumstances of the B cells. Ig-
/Ig-ß transduces the signal from BCR through the activation of protein-tyrosine kinases such as Syk, Lyn and Btk, and their substrates such as phospholipase (PLC)
2, phosphatidylinositol-3 kinase, and Vav (17,18). BASH (also known as BLNK and SLP-65) is a B cell-specific member of the SLP-76 family of adaptor proteins containing multiple SH2-binding tyrosine motifs, SH3-binding proline motifs and an SH2 domain. BASH is primarily phosphorylated by Syk and interacts with signaling proteins such as PLC
2, Vav, Grb2, Syk, Btk and HPK1 upon BCR stimulation, and has been shown to mediate PLC
2 activation by Btk, Vav activation in concert with Grb2, and HPK1 activation. Thus BASH is necessary for BCR-mediated calcium signaling and the activation of mitogen-activated protein kinases and NF-
B (1926). BASH-deficient mice display a phenotype reflecting BCR/pre-B cell receptor (pre-BCR) signaling deficiencies including a partial block in early B-cell development, severe reduction of peripheral mature B and peritoneal B-1 cells, defective activation and proliferation of B cells upon BCR-ligation in vitro, and low serum Ig levels (2730).
Mice deficient in BCR-proximal signaling molecules, such as Btk, PI3-kinase p85
, PLC
2, PKCß and BASH, generally lack antibody production after immunization with T cell-independent (TI) Ags, indicating a pivotal role for BCR signaling in clonal expansion and/or plasma-cell differentiation in response to such Ags (27,3035). In a primary immune response to TD Ags, various results for antibody production among the mutant strains have been reported. For example, the primary IgG response to a TD Ag was reported to be intact in mice lacking PLC
2 or PI3-kinase p85
, but impaired in mice lacking Btk or PKCß. By contrast, the secondary IgG response to TD Ags is largely intact in these mutant mice (27,3036). These results, however, cannot easily be compared, because they are from immunization experiments using different Ags and conjugates, measured at different times, and using mice with different genetic backgrounds. As for BASH-deficient mice, one strain on a mixed background (129xC57BL/6) was reported to produce normal levels of hapten-antigen specific IgM and IgG1 as measured at day 8 after the primary immunization with (4-hydroxy-3-nitrophenyl)acetyl (NP) conjugated to chicken gammaglobulin (CGG), but the secondary response was not assessed (30). Another strain on a Balb/c background showed impaired IgM, but normal IgG, responses to secondary immunization with TNP-BSA at day 15 after the primary immunization, although the primary response was not described (27). In addition, the recall response of memory B cells after a long-term interval, as well as long-term maintenance of specific antibodies, has not been assessed so far with these mutant strains. Thus, a requirement for BCR-signaling molecules, or even BCR signaling itself for development and maintenance of long-term memory B cells and long-lived plasma cells, induction of somatic hypermutation and affinity selection of Ig, and recall response of the long-term memory B cells, still remains unclear.
In order to address these issues, we analyzed the primary and the memory responses of BASH-deficient mice on a C57BL/6 background after immunization with the TD Ag, NP conjugated to CGG (NPCGG). Here we demonstrate that BASH-deficient mice can mount a sufficient memory response with high affinity, highly mutated antibodies, in spite of extremely limited primary NP-specific repertoire and attenuated primary antibody response.
| Methods |
|---|
|
|
|---|
Mice
BASH-deficient mice on a C57BL/6 background (37) and normal C57BL/6 mice (CLEA Japan, Tokyo, Japan) were maintained in our animal facility under specific pathogen-free conditions.
Immunization of mice
Mice (812 weeks old) were immunized i.p. with 100 µg of alum-precipitated NP conjugated to CGG [NP:CGG conjugation ratio = 40:1 (NP40)], and boosted i.p. with the same dose of soluble NP40CGG in PBS on day 112 after the primary immunization.
ELISA
Mice were bled from the tail vein on days 0, 7, 14, 21, 28, 35 and 112 after primary immunization and 7 days after the second immunization (day 119). NP-specific Ab titers were determined by ELISA using flat-bottom 96-well plates coated with 10 µg/ml NP1bovine serum albumin (BSA) or NP16BSA. As indicated, CGG (10 µg/ml) was also used to coat the plates in some experiments. The coated plates were blocked with 3% BSA in PBS, then serially diluted serum samples were added to individual wells. Bound antibodies were revealed by a goat anti-mouse IgM, IgG1, Ig
or Ig
(
1 and
2) conjugated with horseradish peroxidase (Southern Biotechnology Associates, Birmingham, AL) in conjunction with a Peroxidase Substrate Kit (Bio-Rad, Hercules, CA). Absorbance at 450 nm was measured with a microplate reader, Benchmark (Bio-Rad). IgG1/
1 mAbs with high and low affinity to NP, C6 and F8, respectively, were used as standards for anti-NP IgG1/
1 antibodies (38). Both high and low affinity antibodies bind to NP16BSA, whereas only high affinity antibodies bind to NP1BSA. Therefore, the ratio of NP1BSA/NP16BSA-binding antibody titers was used as an index of affinity maturation. Since no other isotypes of anti-NP mAbs were available, the relative concentration of NP-bound IgM was estimated with a mouse monoclonal IgM of irrelevant specificity as a standard that was coated directly onto the plates. To directly compare
versus
isotypes in anti-NP antibodies, serially diluted C6 and a mouse IgG1/
mAb of irrelevant specificity were bound with plate-coated goat anti-mouse IgG1 antibody on the same plates that NP16BSA was coated in the other part, and used as standards. Thus estimated concentration (µg/ml) of anti-NP
or
antibodies in the samples was expressed as relative units. In this assay, 1 µg/ml of C6 bound to NP-coated wells was estimated as
0.5 unit.
Flow cytometry and magnetic-activated cell sorting
Spleen cell suspensions were treated with red blood cell lysis solution (0.15 M NH4Cl, 1 mM KHCO3 and 0.1 mM Na2EDTA) to eliminate erythrocytes. Cells were stained with optimal amounts of FITC-conjugated anti-CD3 (1452C11: PharMingen, San Diego, CA) and anti-
(Southern Biotechnology Associates, Birmingham, AL), PE-conjugated anti-B220 (RA3-6B2: PharMingen) and biotin-conjugated anti-Syndecan-1 (2812: PharMingen) antibodies. Biotin-conjugated antibodies were detected by streptavidin-conjugated CyChrome (Southern Biotechnology Associates). Cells were purified by magnetic cell sorting using the MACS system (Miltenyi Biotec, Bergisch Gladbach, Germany). To purify plasma cells, spleen cells were first depleted of CD3+ and
+ cells by magnetic bead-conjugated anti-FITC antibody and passage through MS columns. The unbound cells were then sorted by FACSvantage (Becton Dickinson, San Jose, CA) to obtain the cells that were within the lymphocyte gate and B220dull, Syndecan-1+.
RTPCR and nucleotide sequence analysis
Total RNA was purified from FACS fractionated cells using TRIzol (Life Technologies, Gaithersburg, MD). cDNA was synthesized from 2 µg of total RNA using oligo (dT)-primed reverse transcription (Invitrogen, San Diego, CA), and subjected to nested polymerase chain reaction (PCR) to recover VH186.2 gene sequences joined to the IgG1 constant region. In the first reaction, the 5' primer was ggccgtcgacggtgtccactcccaggt (VH186.2), and the 3' primer was gaaatagcccttgaccaggcatcc (C
1 1st). PCR was performed with Pfu Turbo DNA polymerase (Stratagene, La Jolla, CA) for 40 cycles of 30 sec at 95°C, 1 min at 55°C and 1 min at 72°C. The second PCR was performed with the same 5' primer and the 3' primer (ggccgaattccatggagttagtttggg, C
1 nested) for 25 cycles under the same conditions. Amplified fragments were cloned into pBluescript II SK vector (Invitrogen, San Diego, CA) and transformed into DH-10B bacteria. Plasmids were prepared from randomly selected bacterial colonies, and the VH186.2 gene sequences were obtained by plasmid sequencing using the CEQ Dye Terminator Cycle Sequencing Quick Start Kit with CEQ 2000 Genetic Analysis System (Beckman Coulter, Fullerton, CA).
Statistical analysis
Statistical analysis was performed using the Student's t test.
| Results |
|---|
|
|
|---|
Impaired primary response to NP but not to CGG in BASH-deficient mice
To examine the role for BASH-mediated BCR signaling in T cell-dependent immune response, BASH/ as well as BASH+/ and BASH+/+ mice were immunized with alum-precipitated NP40CGG. These mice are all on the C57BL/6 genetic background, a strain whose immune response to NP conjugates is well characterized and known to be dominated by IgG1 antibodies using the VH186.2, DFL16.1 and JH2 H chain and V
1 L chain combination (39). Sera were collected every 7 days after immunization from the mice, and the concentration of IgM and IgG1 anti-NP antibodies was measured by ELISA. In BASH+/+ mice, anti-NP IgM antibodies were produced rapidly, reaching a peak level 7 days after immunization (Fig. 1A). These IgM Abs are likely to be produced from short-lived plasma cells generated in primary foci (2). By contrast, a significantly lower level of IgM Abs was produced in BASH+/ mice and an almost undetectable level in BASH/ mice (Fig. 1A). IgM antibodies against CGG were similarly suppressed in BASH/ mice (data not shown). Hence, IgM production in the primary response to T cell-dependent antigen is impaired in BASH-deficient mice, as in the case of T cell-independent response (27,30).
|
In BASH+/ mice anti-NP IgG1 antibodies were produced at similar kinetics to, albeit to a lesser extent than, BASH+/+ mice. In BASH/ mice the anti-NP IgG1 production was markedly retarded and eventually reached only one-third of the peak levels in BASH+/+ mice (Fig. 1B). The ratio of NP1-bound high affinity to total anti-NP IgG1 (NP16-bound) increased gradually during the primary response. BASH/ mice showed somewhat slower kinetics in the affinity maturation, but reached a level equal to the controls by 5 weeks (Fig. 1C). Thus, the T cell-dependent IgG1 production to NP antigen appears to be attenuated in BASH/ mice. However, in the same immune sera, IgG1 antibodies specific to CGG were produced at similar levels among the mice of all three genotypes (Fig. 1D). Therefore Ig class switching and antibody production in response to protein antigens is essentially intact, but anti-hapten responses appear to be selectively affected in the mutant mice. We discuss a possible reason for this in the Discussion.
Increased ratio of
to
usage in anti-NP antibodies in the primary response of BASH/ mice
In mice only
5% of the peripheral B cells are
+, about a half of which are
1+ (40). However, it is well known that anti-NP primary antibodies are primarily dominated by
1 isotype in C57BL/6 mice. Accordingly,
1020 times more
isotype than
was detected in the anti-NP antibodies in the primary response in BASH+/+ and somewhat less in BASH+/ mice (Fig. 2A). In BASH/ mice, to our surprise, the ratio of
to
was significantly increased (0.40.8 on average), although the ratio varied considerably among individual mice (Fig. 2A). Taking the absolute number of
+ B cells in the spleen into account (Fig. 2B, top), the frequency of
+ B cells engaged in the anti-NP antibody production is presumably
10-fold higher on average in BASH/ mice than BASH+/+ mice. This was not due to an increase of ratio of the numbers of
+ to
1+ B cells in BASH/ mice, because the ratio was not significantly increased (Fig. 2B, bottom). This finding may be explained as follows: in animals such as BASH/ mice that have extremely reduced numbers of NP-reactive B cells, the advantage of high-affinity
1+ B cells over more abundant, presumably low-affinity,
+ cells in a competition for available antigens is lost, in the presence of relatively excess antigen. Taken together, the retarded and inefficient anti-NP IgG1 production in BASH/ mice is probably due to the scarcity of NP-specific clones, especially
1-bearing high-affinity NP-binding ones, in the primary B cell repertoire.
|
Unimpaired memory response in BASH-deficient mice
To examine the role of BASH in the memory response, mice of each BASH genotype were boosted with soluble NP40CGG at day 112 after the primary immunization. Before the boost, affinity-maturated anti-NP IgG1 antibodies were readily detectable in the sera of BASH/ mice, suggesting unimpaired generation of the long-lived plasma cells (Fig. 3A). At day 7 after the boost, anti-NP IgG1 levels were elevated approximately to the same extent on average in mice of all genotypes. Affinity of these antibodies to NP before and after the boost was relatively high and showed no significant difference among the genotypes (Fig. 3A). In contrast to the early phase of the primary response, the level of
-type anti-NP antibodies became similar among the three genotypes by day 112 and the difference in
to
ratio was less significant at the late phase. This holds true for the secondary (memory) response (Fig. 3B). This indicates that the number of anti-NP long-lived plasma and memory cells bearing the
-isotype in BASH/ mice became equivalent to BASH+/ and BASH+/+ mice, suggesting that the relatively few NP-binding
+ clones had preferentially been selected for differentiation into long-lived plasma and memory cells during the primary response. It is of note that a significant level of
-type anti-NP antibody was also detectable at day 112 and elevated after the boost in all genotypes, indicating
-type long-lived plasma and memory cells were generated in the anti-NP response normally in BASH/ mice. Anti-CGG IgG1 antibody levels were also elevated after the boost in mice of the three genotypes (Fig. 3C). These data indicate that generation and maintenance of memory B cells, as well as their clonal expansion and differentiation into plasma cell at the recall response are independent of BASH-mediated signaling.
|
Somatic hypermutation of the memory antibody repertoire is normal in BASH-deficient mice
To verify whether BASH is required for affinity maturation and somatic hypermutation of antibodies produced in the memory response,
, presumably
+ plasma cells (B220dull, Syndecan+) were sorted from splenocytes of the three genotypes of mice at day 7 after the boost (day 119 after the primary immunization) and VH186.2-C
1 mRNAs from these cells were reverse-transcribed, amplified by two rounds of PCR with specific primers, and the products of the expected size were cloned into a plasmid vector, then randomly selected clones were sequenced. Of 56 readable sequences, 38 (68%) were VH186.2 genes, and the rest were closely related members of the same gene family. These sequences contained the extensive somatic hypermutation typical of antibodies in a memory response (Fig. 4A). The overall frequency of nucleotide changes in VH186.2 gene sequences was similar among BASH+/+, BASH+/ and BASH/ mice (Table 1). The mutations were scattered over the entire V regions including D and J segments, and enriched in CDRs as expected, in mice of the three genotypes. Replacement mutations far exceeded silent mutations in CDRs, indicating selection for the amino-acid changes that may increase affinity for antigen. Half of the VH186.2 sequences from BASH+/+ and BASH+/ mice, and 65% from BASH/ mice had the tryptophan-to-leucine replacement at position 33, a mutation indicative of selection based on high affinity binding to NP (41). This result verified that anti-NP IgG1/
antibodies produced in BASH/ mice during the memory response were hypermutated and selected based on the affinity to NP antigen to the similar extent to those in BASH+/+ and BASH+/ mice. Therefore, we conclude that induction of somatic hypermutation and affinity selection of the mutated clones during the primary, and maybe the memory response as well, does not require BASH-mediated signaling.
|
|
After assignment of V-D and D-J boundaries by comparing to their germline sequences, we noticed that several clones share essentially the same VDJ boundary sequences including D and J segments as well as N (or P) sequences, and the same mutations in some cases (Fig. 4A). They probably represent the transcripts from the cells of the same clonal origin and the IgH genes in such cells had likely diverged by successive somatic mutations. Such clonally related sequences were prominent in the sequences from BASH/ mice (701, 06, 09 and 07; 902 and 07; 901 and 903), although one pair was also found in those from a BASH+/ mouse (507 and 08). Notably, four sequences out of 10 from a BASH/ mouse (No.8) utilized a VHJ558.45 gene segment, and two of them were again clonally related (Fig. 4B). The extraordinarily high frequency of the clonally related sequences implies the scarcity of the original NP-specific clones, from which the memory cells were derived, in the primary repertoire of BASH/ mice. These results also indicate that such scarcity of antigen-specific cells in the primary repertoire is not detrimental for the memory antibody response in terms of quality and quantity.
| Discussion |
|---|
|
|
|---|
BASH is essential for production of IgM, but not for IgG, in the primary response to T cell-dependent antigens
The present data indicate that BASH-mediated BCR signaling is required, in a dose dependent manner, for production of IgM antibody in the primary response. This correlates well to a requirement of BASH for surface IgM (sIgM)-mediated B-cell activation and proliferation in vitro, and for T cell-independent immune response in vivo (27,29,30). Therefore, signaling from sIgM that induces clonal expansion of B cells and/or differentiation into plasma cells is dependent on the quantity of BASH at the initial phase of the response, and T-cell help may be unavailable or insufficient to overcome the BASH-deficiency at this phase. Anti-NP IgG1 production in the primary response was also impaired, though rather mildly, in our BASH-deficient mice, as discussed in detail below. This result contradicts that reported by Xu et al. (30). They reported that their independently derived strain of BASH-deficient mice produced a normal level of anti-NP IgM and IgG1 at day 8 after the primary immunization with NPCGG, at which time point our BASH-deficient mice produced only negligible amounts of anti-NP antibodies of both classes. However, it seems difficult to reconcile their data with our data because they did not show complete serum titration data, nor did they assess transition of the serum antibody titer in a time course after the immunization.
Our results rather resemble those seen in immunization experiments in mice lacking Btk or PKCß (35,36). These mice showed markedly retarded and attenuated anti-NP IgG1 response after the primary immunization of NP-conjugates, which is similar to, but more severe than in our BASH-deficient mice. However, these mice also showed similarly impaired primary IgG1 responses to carrier proteins (31,35), whereas our mice produced normal level of IgG1 anti-CGG in the primary response to NPCGG. Thus, the primary response of isotype-switched B cells to protein antigens appears to be essentially intact in BASH-deficient mice, but not in Btk- or PKCß-deficient mice. This does not correlate with B-cell response to T-cell help in vitro: proliferation of B cells upon stimulation through CD40 with IL4 is intact in the latter mice, whereas it is rather reduced in BASH-deficient mice (27,29,35,36). Therefore, BCR signaling required for the primary response to TD Ags seems more dependent on Btk and PKCß than BASH. Thus we conclude that, in the presence of T-cell help, BASH-mediated signaling is not essential for B cells to undergo isotype switching, clonal expansion and plasma-cell differentiation of the switched cells, as well as affinity maturation (including somatic hypermutation and affinity selection of Ig) and differentiation into memory B cells as mentioned above.
Selective impairment of anti-NP primary response in BASH-deficient mice
Given the above conclusion, why is production of IgG1 antibody to NP, but not to CGG, selectively affected during the primary response to NPCGG immunization in BASH-deficient mice? One hypothesis would be the following: stimulation through the BCR, specifically of IgG class, by binding of a monomeric epitope such as CGG provides would cause modest activation of each B cell in the presence of the T-cell help. By contrast, BCR crosslinking by multimeric epitopes such as provided by NP40CGG would cause stronger and more rapid response of each B cell, while making the cell less accessible to the T-cell help. The BCR signaling leading to B cell response through the latter, but not the former, pathway would be dependent on BASH. As the result, BASH-deficient B cells could only receive a signal through the former pathway with less T-cell help when the BCR is crosslinked by multimeric NP antigen, and therefore they show lower and slower response than wild-type B cells, whereas both types of B cells would respond equally to CGG through the former pathway. IgM class BCR might always signal through the latter BASH-dependent pathway in response to any type of antigen because it can oligomerize on the cell surface (42).
Another possible explanation is the following: the number of epitopes in one NP molecule would be one, or a few at most, whereas that in a CGG molecule would be many, therefore the repertoire of B cells which respond to NP should be far smaller than that to CGG in the whole primary repertoire. Since the number of mature B cells is severely reduced in BASH/ mice, NP-specific B cells may have been initially very few and required far more expansion to produce a measurable amount of IgG1 than wild-type cells, whereas the number of CGG-specific cells may have been enough for normal level of IgG production. The extreme scarcity of NP-specific B cells in the primary repertoire may also be responsible for the unusual level of
production in the primary anti-NP antibodies, and for the limited number of clonal origins in the memory anti-NP antibody repertoire in BASH/ mice.
A limited antigen-specific B-cell repertoire is not detrimental for memory formation
Despite the limited anti-NP repertoire and the attenuated anti-NP IgG1 production in the primary response, anti-NP memory response as a whole is unimpaired in quantity as well as quality in BASH-deficient mice: dominant IgG1/
antibodies with high affinity to NP were produced at normal level before and shortly after the recall immunization, and the antibodies were highly mutated and selected, in the mutant mice. Thus, it seems likely that extremely few NP-specific
-bearing B cells, which had poorly differentiated into short-lived plasma cells in the primary response, expanded enormously and eventually differentiated into long-lived plasma as well as memory B cells. This result suggests that BCR affinity to antigen is a key determinant in the selection and expansion of B cells destined to become long-lived plasma and memory B cells. Thus, scarcity of antigen-specific clones in the primary repertoire is not detrimental for formation of memory plasma and memory B cells.
The present results indicate that BASH-mediated signaling is not essential for the clonal expansion that proceeds into IgG1 production during the primary response of naive B cells as well as the recall response of memory B cells to TD Ag. This contrasts to its indispensable role in IgM production in the primary response to TD Ag, which should also be preceded by clonal expansion. Several explanations for the differential requirements of BASH for clonal expansion are possible, though they may not be mutually exclusive: (i) BASH is indispensable for BCR signaling only for the early phase (the first few days) of the TD immune response, which is responsible for the expansion of B cells destined to be IgM-secreting cells but not for that to be IgG-secreting cells. (ii) BASH is dispensable for B-cell proliferation once T-cell help becomes available. Indeed, a defect in anti-IgM-mediated proliferative response in vitro in BASH/ mice is partially overcome by anti-CD40 antibody and IL-4 (27,29). (iii) BASH is dispensable for signal transduction from IgG1-class BCR that is essential for efficient IgG1 production (43), but required for signaling through an IgM-class BCR having an oligomeric nature (42). Testing these hypotheses should be the subject of future studies.
So far, long-lasting antibody production or memory-recall response after a long period (several months) post-immunization has not been assessed in mice deficient for BCR-signaling molecules, except for xid mice which have a mutation in the Btk gene (44). Thus, it has been unclear which molecule in BCR-signaling is required for the selection of B cells to be long-lived plasma and memory cells during the primary response. The present studies clarify that BASH, in addition to Btk, is not necessary for this process. This raises the question as to whether the development of long-lived memory B and plasma cells is an antigen-selected event at all. However, extensive selection of the
isotype for memory anti-NP repertoire in BASH-deficient mice suggests that this is indeed the case, as already discussed. Studies of long-range immune responses in other mutant mice will be necessary to identify the molecules involved in the BCR-mediated selection process.
| Acknowledgements |
|---|
We are grateful to Drs Y. Takahashi and T. Takemori for helpful advice for the analysis of anti-NP sequences, and Dr P. Burrows for reading the manuscript. We also thank Dr A. Terauchi, Dr T. Shimizu, M. Yoshida, A. Furukawa and Y. Hara for reagents and technical assistance. This work is supported by grants to D. K., R. G. and K. H. from the Ministry of Education, Culture, Sports, Science, and Technology (MEXT) in Japan, and Japan Society for the Promotion of Science.
| Abbreviations |
|---|
| BASH | B-cell specific adaptor protein containing SH2 domain |
| BCR | B cell antigen receptor |
| Btk | Bruton's tyrosine kinase |
| CD40L | CD40 ligand |
| CDR | complementarity determining region |
| CGG | chicken -globulin |
| GC | germinal center |
| PI3 | phosphatidylinositol-3 |
| PLC | phospholipase C |
| NP | (4-hydroxy-3-nitrophenyl)acetyl |
| TD | T-cell dependent |
| Notes |
|---|
Transmitting editor: T. Watanabe
Received 14 February 2004, accepted 25 May 2004.
| References |
|---|
|
|
|---|
- MacLennan, I. C. and Gray, D. 1986. Antigen-driven selection of virgin and memory B cells. Immunol. Rev. 91:61.[CrossRef][ISI][Medline]
- Jacob, J., Kassir, R. and Kelsoe, G. 1991. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. I. The architecture and dynamics of responding cell populations. J. Exp. Med. 173:1165.
[Abstract/Free Full Text] - Jacob, J., Kelsoe, G., Rajewsky, K. and Weiss, U. 1991. Intraclonal generation of antibody mutants in germinal centres. Nature 354:389.[CrossRef][Medline]
- Kuppers, R., Zhao, M., Hansmann, M. L. and Rajewsky, K. 1993. Tracing B cell development in human germinal centres by molecular analysis of single cells picked from histological sections. EMBO J. 12:4955.[ISI][Medline]
- Jacob, J., Przylepa, J., Miller, C. and Kelsoe, G. 1993. In situ studies of the primary immune response to (4-hydroxy-3-nitrophenyl)acetyl. III. The kinetics of V region mutation and selection in germinal center B cells. J. Exp. Med. 178:1293.
[Abstract/Free Full Text] - Berek, C., Berger, A. and Apel, M. 1991. Maturation of the immune response in germinal centers. Cell 67:1121.[CrossRef][ISI][Medline]
- Slifka, M. K., Antia, R., Whitmire, J. K. and Ahmed, R. 1998. Humoral immunity due to long-lived plasma cells. Immunity 8:363.[CrossRef][ISI][Medline]
- Schittek, B. and Rajewsky, K. 1990. Maintenance of B-cell memory by long-lived cells generated from proliferating precursors. Nature 346:749.[CrossRef][Medline]
- Weiss, U. and Rajewsky, K. 1990. The repertoire of somatic antibody mutants accumulating in the memory compartment after primary immunization is restricted through affinity maturation and mirrors that expressed in the secondary response. J. Exp. Med. 172:1681.
[Abstract/Free Full Text] - Nossal, G. J. 1992. The molecular and cellular basis of affinity maturation in the antibody response. Cell 68:1.[CrossRef][ISI][Medline]
- Gray, D. 1993. Immunological memory. Annu. Rev. Immunol. 11:49.[CrossRef][ISI][Medline]
- Maruyama, M., Lam, K. P. and Rajewsky, K. 2000. Memory B-cell persistence is independent of persisting immunizing antigen. Nature 407:636.[CrossRef][Medline]
- Gray, D., Dullforce, P. and Jainandunsing, S. 1994. Memory B cell development but not germinal center formation is impaired by in vivo blockade of CD40CD40 ligand interaction. J. Exp. Med. 180:141.
[Abstract/Free Full Text] - Foy, T. M., Laman, J. D., Ledbetter, J. A., Aruffo, A., Claassen, E. and Noelle, R. J. 1994. gp39CD40 interactions are essential for germinal center formation and the development of B cell memory. J. Exp. Med. 180:157.
[Abstract/Free Full Text] - Han, S., Hathcock, K., Zheng, B., Kepler, T. B., Hodes, R. and Kelsoe, G. 1995. Cellular interaction in germinal centers. Roles of CD40 ligand and B7-2 in established germinal centers. J. Immunol. 155:556.[Abstract]
- Ferguson, S. E., Han, S., Kelsoe, G. and Thompson, C. B. 1996. CD28 is required for germinal center formation. J. Immunol. 156:4576.[Abstract]
- Reth, M. and Wienands, J. 1997. Initiation and processing of signals from the B cell antigen receptor. Annu. Rev. Immunol. 15:453.[CrossRef][ISI][Medline]
- Kurosaki, T. 2002. Regulation of B-cell signal transduction by adaptor proteins. Nat. Rev. Immunol. 2:354.[CrossRef][ISI][Medline]
- Fu, C., Turck, C. W., Kurosaki, T. and Chan, A. C. 1998. BLNK: a central linker protein in B cell activation. Immunity 9:93.[CrossRef][ISI][Medline]
- Wienands, J., Schweikert, J., Wollscheid, B., Jumaa, H., Nielsen, P. J. and Reth, M. 1998. SLP-65: a new signaling component in B lymphocytes which requires expression of the antigen receptor for phosphorylation. J. Exp. Med. 188:791.
[Abstract/Free Full Text] - Goitsuka, R., Fujimura, Y., Mamada, H., Umeda, A., Morimura, T., Uetsuka, K., Doi, K., Tsuji, S. and Kitamura, D. 1998. BASH, a novel signaling molecule preferentially expressed in B cells of the bursa of Fabricius. J. Immunol. 161:5804.
[Abstract/Free Full Text] - Hashimoto, S., Iwamatsu, A., Ishiai, M., Okawa, K., Yamadori, T., Matsushita, M., Baba, Y., Kishimoto, T., Kurosaki, T. and Tsukada, S. 1999. Identification of the SH2 domain binding protein of Bruton's tyrosine kinase as BLNK-functional significance of Btk-SH2 domain in B-cell antigen receptor-coupled calcium signaling. Blood 94:2357.
[Abstract/Free Full Text] - Tsuji, S., Okamoto, M., Yamada, K., Okamoto, N., Goitsuka, R., Arnold, R., Kiefer, F. and Kitamura, D. 2001. B cell adaptor containing src homology 2 domain (BASH) links B cell receptor signaling to the activation of hematopoietic progenitor kinase 1. J. Exp. Med. 194:529.
[Abstract/Free Full Text] - Ishiai, M., Kurosaki, M., Pappu, R., Okawa, K., Ronko, I., Fu, C., Shibata, M., Iwamatsu, A., Chan, A. C. and Kurosaki, T. 1999. BLNK required for coupling Syk to PLC
2 and Rac1-JNK in B cells. Immunity 10:117.[CrossRef][ISI][Medline]
- Johmura, S., Oh-hora, M., Inabe, K., Nishikawa, Y., Hayashi, K., Vigorito, E., Kitamura, D., Turner, M., Shingu, K., Hikida, M. and Kurosaki, T. 2003. Regulation of Vav localization in membrane rafts by adaptor molecules Grb2 and BLNK. Immunity 18:777.[CrossRef][ISI][Medline]
- Tan, J. E., Wong, S. C., Gan, S. K., Xu, S. and Lam, K. P. 2001. The adaptor protein BLNK is required for B cell antigen receptor-induced activation of nuclear factor-
B and cell cycle entry and survival of B lymphocytes. J. Biol. Chem. 276:20055.[Abstract/Free Full Text] - Jumaa, H., Wollscheid, B., Mitterer, M., Wienands, J., Reth, M. and Nielsen, P. J. 1999. Abnormal development and function of B lymphocytes in mice deficient for the signaling adaptor protein SLP-65. Immunity 11:547.[CrossRef][ISI][Medline]
- Pappu, R., Cheng, A. M., Li, B., Gong, Q., Chiu, C., Griffin, N., White, M., Sleckman, B. P. and Chan, A. C. 1999. Requirement for B cell linker protein (BLNK) in B cell development. Science 286:1949.
[Abstract/Free Full Text] - Hayashi, K., Nittono, R., Okamoto, N., Tsuji, S., Hara, Y., Goitsuka, R. and Kitamura, D. 2000. The B cell-restricted adaptor BASH is required for normal development and antigen receptor-mediated activation of B cells. Proc. Natl Acad. Sci. USA 97:2755.
[Abstract/Free Full Text] - Xu, S., Tan, J. E., Wong, E. P., Manickam, A., Ponniah, S. and Lam, K. P. 2000. B cell development and activation defects resulting in xid-like immunodeficiency in BLNK/SLP-65-deficient mice. Int. Immunol. 12:397.
[Abstract/Free Full Text] - Khan, W. N., Alt, F. W., Gerstein, R. M., Malynn, B. A., Larsson, I., Rathbun, G., Davidson, L., Muller, S., Kantor, A. B., Herzenberg, L. A. et al. 1995. Defective B cell development and function in Btk-deficient mice. Immunity 3:283.[CrossRef][ISI][Medline]
- Suzuki, H., Terauchi, Y., Fujiwara, M., Aizawa, S., Yazaki, Y., Kadowaki, T. and Koyasu, S. 1999. Xid-like immunodeficiency in mice with disruption of the p85
subunit of phosphoinositide 3-kinase. Science 283:390.[Abstract/Free Full Text] - Wang, D., Feng, J., Wen, R., Marine, J. C., Sangster, M. Y., Parganas, E., Hoffmeyer, A., Jackson, C. W., Cleveland, J. L., Murray, P. J. and Ihle, J. N. 2000. Phospholipase C
2 is essential in the functions of B cell and several Fc receptors. Immunity 13:25.[CrossRef][ISI][Medline]
- Hashimoto, A., Takeda, K., Inaba, M., Sekimata, M., Kaisho, T., Ikehara, S., Homma, Y., Akira, S. and Kurosaki, T. 2000. Cutting edge: essential role of phospholipase C
2 in B cell development and function. J. Immunol. 165:1738.[Abstract/Free Full Text] - Leitges, M., Schmedt, C., Guinamard, R., Davoust, J., Schaal, S., Stabel, S. and Tarakhovsky, A. 1996. Immunodeficiency in protein kinase Cß-deficient mice. Science 273:788.[Abstract]
- Ridderstad, A., Nossal, G. J. and Tarlinton, D. M. 1996. The xid mutation diminishes memory B cell generation but does not affect somatic hypermutation and selection. J. Immunol. 157:3357.[Abstract]
- Hayashi, K., Yamamoto, M., Nojima, T., Goitsuka, R. and Kitamura, D. 2003. Distinct signaling requirements for Dµ selection, IgH allelic exclusion, pre-B cell transition and tumor suppression in B cell progenitors. Immunity 18:825.[CrossRef][ISI][Medline]
- Terauchi, A., Hayashi, K., Kitamura, D., Kozono, Y., Motoyama, N. and Azuma, T. 2001. A pivotal role for DNase I-sensitive regions 3b and/or 4 in the induction of somatic hypermutation of IgH genes. J. Immunol. 167:811.
[Abstract/Free Full Text] - Allen, D., Cumano, A., Dildrop, R., Kocks, C., Rajewsky, K., Rajewsky, N., Roes, J., Sablitzky, F. and Siekevitz, M. 1987. Timing, genetic requirements and functional consequences of somatic hypermutation during B-cell development. Immunol. Rev. 96:5.[CrossRef][ISI][Medline]
- Takemori, T. and Rajewsky, K. 1981.
chain expression at different stages of ontogeny in C57BL/6, BALB/c and SJL mice. Eur. J. Immunol. 11:618.[ISI][Medline]
- Allen, D., Simon, T., Sablitzky, F., Rajewsky, K. and Cumano, A. 1988. Antibody engineering for the analysis of affinity maturation of an anti-hapten response. EMBO J. 7:1995.[ISI][Medline]
- Schamel, W. W. and Reth, M. 2000. Monomeric and oligomeric complexes of the B cell antigen receptor. Immunity 13:5.[CrossRef][ISI][Medline]
- Kaisho, T., Schwenk, F. and Rajewsky, K. 1997. The roles of
1 heavy chain membrane expression and cytoplasmic tail in IgG1 responses. Science 276:412.[Abstract/Free Full Text] - Ridderstad, A. and Tarlinton, D. M. 1997. B cell memory in xid mice is long-lived despite reduced memory B cell frequency. Scand. J. Immunol. 45:655.[CrossRef][ISI][Medline]
This article has been cited by other articles:
![]() |
K. Hayashi, T. Nojima, R. Goitsuka, and D. Kitamura Impaired Receptor Editing in the Primary B Cell Repertoire of BASH-Deficient Mice J. Immunol., November 15, 2004; 173(10): 5980 - 5988. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





