International Immunology Advance Access originally published online on June 7, 2004
International Immunology 2004 16(7):1009-1017; doi:10.1093/intimm/dxh105
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
International Immunology, Vol. 16, No. 7, pp. 1009-1017,
July 2004
© 2004 Japanese Society for Immunology
Tumor cells secreting IL-13 but not IL-13R
2 fusion protein have reduced tumorigenicity in vivo
Wyeth Research, 200 Cambridge Park Drive, Cambridge MA 02140, USA
Correspondence to: K. Dunussi-Joannopoulos; Email: kdunussi{at}wyeth.com
Transmitting editor: G. Trinchieri
| Abstract |
|---|
|
|
|---|
IL-13 is a Th2 cytokine that plays crucial roles in the pathophysiology of allergy, asthma and helminth infection. The high affinity receptor for IL-13, IL-13R
2, may act as a decoy receptor for IL-13. The anti-tumor effect of IL-13 and its soluble receptor IL-13R
2 have been examined in different tumor systems. Previous studies have shown that IL-13 enhances anti-tumor responses in some model systems, whereas IL-13R
2Fc prevents IL-13 mediated suppression of tumor immuno-surveillance in a different model system. In this study, we have used a cytokine (receptor) gene therapy approach and studied the immune responses mediated by IL-13 and IL-13R
2Fc in poorly immunogenic B16F1 melanoma and immunogenic MethA fibrosarcoma tumor models. We find that IL-13 reduces the tumorigenicity of B16F1 melanoma and MethA fibrosarcoma cells in vivo, most likely through the recruitment of neutrophils and macrophages. IL-13 mediated anti-tumor responses do not lead to the generation of tumor-specific T cells. Neither IL-13R
2Fc gene transduction nor in vivo treatment with soluble IL-13R
2Fc has a statistically significant effect of tumor growth. IL-13R
2 deficient host background does not alter tumor growth, suggesting that endogenous levels of IL-13 do not contribute to an anti-tumor response in these models. We conclude that IL-13, but not soluble IL-13R
2, has anti-tumor activity in the models described here, possibly by enhancing innate anti-tumor immunity.
Keywords: IL-13, IL-13 receptor alpha 2, neutrophils and macrophages, tumor models
| Introduction |
|---|
|
|
|---|
IL-13 is a Th2 type cytokine produced by Th2 cells, macrophages, dendritic cells, NKT, NK cells, mast cells and basophils (1,2). It has structural and functional similarities to IL-4 (35). Like IL-4, IL-13 has important pro-inflammatory effects in allergy and asthma, as well as in parasitic infection by influencing myelopoiesis, regulation of monocyte/macrophage functions and class switching of B cells (6). In addition, IL-13 also plays a unique role of inducing changes in smooth muscle and epithelial cell functions that lead to asthma or expulsion of gastrointestinal nematode (7).
Two highly conserved IL-13 binding proteins have been identified. Both IL-13R
1 and IL-13R
2 belong to the class I cytokine receptor family. IL-13R may exist in three different forms in different cell types (811). Specifically, IL-13 can bind to IL-13R
1, IL-13R
2, or a high affinity IL-13R
1-IL-4R
heterodimer (12,13). The cytoplasmic domain of IL-13R
2 does not possess any obvious signaling motif or JAK/STAT binding sequence. It is therefore hypothesized that IL-13R
2 may act as a dominant negative inhibitor or a decoy receptor, similar to the IL-1R type II decoy receptor (11,14).
To understand the role IL-13R
2 plays in the immune response, IL-13R
2/ mice were generated. These mice exhibit enhanced IL-13 responses similar to transgenic mice engineered to over-express IL-13, such as elevated IgE levels, and reduced macrophage-derived IL-12 and NO levels (1518). Moreover, the IL-13R
2/ mice have reduced serum but elevated tissue levels of IL-13. Strikingly, by adding exogenous IL-13R
2Fc, Chiaramonte et al. (19) detected profoundly increased serum IL-13 level, which suggests IL-13R
2 not only modulates the level of IL-13 but also influences the partition of IL-13 between serum and tissue. In addition, IL-13R
2 has been engineered as a soluble IL-13R
2Fc fusion protein that has successfully blocked several functions attributed to IL-13 including fibrogenesis (20), airway hyperactivity (21) and gastrointestinal parasite expulsion (22).
IL-13 receptors are abundant in various human carcinoma cell lines (2325). IL-13 has been shown to have an anti-proliferative effect on human breast cancer, renal cell carcinoma, and B-lineage acute lymphoblastic leukemia cell lines in vitro (2629). Mice inoculated with IL-13 transduced P815 mastocytoma developed potent anti-tumor responses mainly by recruiting infiltrating neutrophils and macrophages (30). Interestingly, over-expression of the IL-13R
2 chain in human tumor cells also inhibited the tumorigenicity of some breast and pancreatic cancer cells in immunodeficient mice (31,32). Of note, with the over-expression of either IL-13 or IL-13R
2, substantial amounts of neutrophils and macrophages were found in the regressing tumor (30,31). Recent results also suggest that IL-13 produced by NKT cells antagonizes tumor immunosurveillance in HIV gp160 transduced fibrosarcoma system. In this model, treatment of susceptible mice with IL-13R
2Fc almost completely prevents tumor recurrence (33).
From the current literature reviewed above, both IL-13 and IL-13R
2Fc can inhibit tumor formation when expressed by the tumor cells, albeit in different systems. In order to better understand the roles that IL-13 and IL-13R
2 play in modulating anti-tumor immune function, tumorigenic (B16F1) and immunogenic (MethA) tumor cells were transduced with either IL-13 or IL-13R
2Fc genes and used for in vivo studies. We find that IL-13 but not IL-13R
2Fc substantially inhibits tumor growth in both B16F1 and MethA tumor models.
| Methods |
|---|
|
|
|---|
Mice
Female 68-week-old C57BL/6 and BALB/c mice were purchased from Jackson Laboratories (Bar Harbor, ME). IL-13R
2 deficient mice in C57BL/6 and BALB/c background were generated (18) and maintained at Wyeth Research under conditions in accordance with guidelines from the committee on Animals of Wyeth Research.
Tumor cell lines and reagents
B16F1 and B16F1-IL-21 (34) melanoma cells were maintained in culture in DMEM medium supplemented with 10% heat inactivated fetal bovine serum, 2% glutamine and 1% penicillinstreptomycin. MethA fibrosarcoma cells were maintained by intraperitoneal passage in BALB/c mice. B16F1 melanoma-specific TRP-2 (SVYDFFVWL) (35,36) and control peptide OVA257264 (SIINFEKL) were synthesized at Wyeth Research. mAbs against NK1.1, Gr1 and Mac3 and isotype controls were all purchased from PharMingen (San Diego, CA).
Generation of IL-13, IL-13R
2Fc, mutated murine IgG2a (mIgG2a) and green fluorescent protein (GFP) expressing tumor cells.
B16F1 and MethA tumor cells were engineered to express IL-13, IL-13R
2Fc (11), mIgG2a and GFP, or only GFP. Retroviral vectors encoding mIL-13, IL-13R
2Fc, mIgG2a-IRES-GFP, or IRES-GFP were constructed using GFP-RV vector (kindly provided by Dr K. Murphy, Washington University) (37). High titer retrovirus was obtained by transfecting 293-VSVg ecotropic packaging cell line (38). Spin infections were performed at 1800 r.p.m. (model Eppendorf C 5810R) for 40 min at room temperature. Cells were infected three times. Tumor cells expressing GFP were enriched by flow sorting and the purity of GFP expressing cells was >90%. Of note, IL-13R
2Fc is a fusion protein of murine IL-13R
2 and murine at hinge-C2-C3 domains. Recombinant fusion proteins are dimeric and therefore bivalent (11).
IL-13 and mIgG2a, IL-13R
2Fc Elisa
For IL-13 Elisa, overnight supernatants from 106 B16F1-IL-13, B16F1-GFP, MethA-IL-13 and MethA-GFP tumor cells were assayed for IL-13 levels by using Quantikine M mouse IL-13 ELISA kit following manufacturers instructions (R&D Systems, Minneapolis, MN). To determine the ability of IL-13R
2Fc to bind with IL-13, serial dilutions of overnight supernatants from 106/ml B16F1-IL-13R
2Fc cells were incubated with 500 pg/ml of IL-13 at 1:1 (vol/vol) for 10 min before assaying for IL-13 by Elisa. For mIgG2a Elisa, the detecting antibody used is goat anti-mouse IgG (Calbiochem, La Jolla, LA). Mouse IgG2a (Zymed, South San Francisco, CA) and peroxidase- conjugated goat anti-mouse IgG (Calbiochem) were used as standards and detecting antibodies respectively.
In vivo tumor studies
C57BL/6 mice were shaved on the back and injected subcutaneously (s.c.) with 105 B16F1-IL-13, B16F1-IL-13R
2Fc or control B16F1-GFP, B16F1-mIgG2a. BALB/c mice were injected s.c. with 106 MethA-IL-13, MethA-IL-13R
2Fc or control MethA-GFP, MethA-mIgG2a cells. Tumor growth was monitored by measuring perpendicular diameters with a caliper. Mice were sacrificed when the tumors displayed severe ulceration or reached a size of 250 mm2. In general, 10 mice per group were used in each experiment and tumor size averages from each group are shown. Results here represent experiments repeated two or more times with similar results. The difference in tumor size between the control and experimental groups was statistically analyzed using Students t-test.
IL-13R
1, IL-13R
2, IL-4R mRNA expression detected by TaqMan
RNA was isolated from different tumor cell lines using RNA purification kit according to the manufacturer instructions (Promega, Madison, WI). Purified RNA was treated with DNase (Ambion Inc, Austin, TX) and adjusted to a concentration of 50 ng/µl before mRNA analysis by quantitative TaqMan polymerase chain reaction (PCR) analysis. IL-4R
, IL-13R
1, IL-13R
2 and cyclophylin-specific primer pairs and probes were designed using PrimerExpress software and were prepared by Wyeth Research (IL-4R
primers: 5'-CCTCACACTCCACACCAATGT, 3'-TGTTCGATGGGTACAG GTTATTC and Probe TCCGACGAATGGCTGCTGACC; IL-13R
1 primers: 5'-AGTGAGAAGCCTAGCCCTTTG, 3'-CAC AGCGGACTCAGGATCA and probe TGAAAAAGTGCATC TCACCCCCTGA; IL-13R
2 primers: 5'-TCTGGTATGA GGGCTTGGAT, 3'-TCCAAGTTGGACAGTTTGCA and probe ATGCCTTACAGTGTGCTGATTACCTCCA). Standard curves for each gene were generated with RNA from known receptor expressing cells. mRNA expression in control and transduced cell lines was normalized based on cyclophilin expression in each cell line and the results are presented as relative units (R.U.) of mRNA.
Elispot Assay
TRP-2-specific T cell responses were determined by IFN
Elispot kit (R&D systems) following manufacturers instructions. Splenocytes (2 x 1054 x 105) in 200 µl of medium containing 20 U/ml murine IL-2 (PharMingen) were placed into each well in the presence of 5 µg/ml of specific TRP-2 peptides (35) or non-specific OVA peptides. The plate was incubated for 24 h at 37°C in a CO2 incubator followed by thorough washing. Plates were then incubated overnight at 4°C with detection antibody, followed by 2 h incubation with Streptavidinalkaline phosphatase conjugate. Spots were visualized with 5-bromo-4 chloro-3' indolylphosphate p-toluidine salt/nitro bluetetrazolium chloride (BCIP/NBT) alkaline phosphatase substrate (R&D systems). Plates were washed with tap water and air-dried, and spots were counted with a stereomicroscope and recalculated as number of spot-forming units per 106 cells with background spots subtracted. Generally, fewer than 10 spots/well were detected when OVA peptide was used as antigen.
In vitro restimulation of splenocytes from tumor cell-inoculated mice
Tumor peptide specific T cell lines were generated as described elsewhere (39). In brief, mice were inoculated with either B16F1-GFP or B16F1-IL-13 cells. After 811 days, splenocytes were harvested and cultured with 5 µg/ml of TRP-2 peptide (35). On the third day of culture, 20 U/ml of IL-2 (BD PharMingen) was added to each culture. After 5 days, cells were used for 51Cr release assay.
CTL assay
Cytotoxicity against targets was quantified using a 4 h 51Cr release assay. RMA-S cells (generously provided by Dr K. Karre, Stockholm, Sweden) were pulsed with TRP-2 peptide at 10 µg/ml and labeled with Na251CrO4 (PerkinElmer Life Sciences, Boston, MA) for 1 h at 37°C. After washing, 51Cr-labeled target cells were incubated with T cell lines generated from C57BL/6 mice injected with tumor cells described earlier at different E:T ratios in 96-well round bottom plates. After 4 h incubation at 37°C, supernatants were collected and radioactivity was detected in a scintillation counter (Wallac, Turku, Finland). Percent specific lysis was calculated as 100 x [(release by CTL spontaneous release) / (maximal release spontaneous release)]. Maximal release was determined by the addition of 1% Triton X-100. Spontaneous release in the absence of CTL was generally <15% of maximal release.
| Results |
|---|
|
|
|---|
IL-13 and IL-13R
2Fc transduced B16F1 and MethA cells secrete IL-13 and IL-13R
2Fc, respectivelyB16F1 melanoma and MethA fibrosarcoma tumor cells were transduced to express GFP plus IL-13 (B16F1/MethA-IL-13), GFP (B16F1/MethA-GFP), GFP plus IL-13R
2Fc (B16F1/MethA-IL-13R
2Fc) or GFP plus mutated murine IgG2a Fc (B16F1/MethA-mIgG2a Fc), respectively. GFP positive cells were sorted and expanded, and levels of IL-13 secretion were determined by IL-13 Elisa (Fig. 1A). IL-13R
2 mRNA expression was assayed by real time RTPCR (Fig. 1B). Since IL-13R
2Fc fusion protein contains the hinge-CH2-CH3 domains of murine IgG2a, secretion of the soluble form of IL-13R
2 and mIgG2a protein was further confirmed by mIgG Elisa (Fig. 1C). IL-13-, IL-13R
2Fc- and mIgG2a transduced tumor cells secreted large amounts of IL-13 (
1500 pg/ml), IL-13R
2Fc (
15 ng/ml) and mIgG2a (
26 ng/ml), respectively, but not parental tumor cell lines. To determine whether the IL-13R
2Fc released by the transduced cells was functional, overnight supernatants from various concentrations of B16F1-IL-13R
2Fc or B16F1-mIgG2a cells were incubated with 500 pg/ml of IL-13 for 10 min at room temperature. IL-13 concentration in the mixture was then determined by IL-13 Elisa. As shown in Fig. 1(D), supernatants from IL-13R
2Fc but not control mIgG2a expressing cells lowered the resultant IL-13 levels in a dose-dependent manner. Similar results were observed in supernatants for MethA cells transduced with IL-13R
2Fc (data not shown).
|
IL-13 and IL-13R
2Fc do not affect tumor growth in vitroVarious tumor cell lines express IL-13 receptors (IL-13R
1, IL-4R
and IL-13R
2) and IL-13 has been demonstrated to play a prominent role in their growth (7). To determine the in vitro growth kinetics of IL-13 and IL-13R
2Fc expressing tumor cells, B16F1 cells (Fig. 2A) or MethA cells (Fig. 2B) expressing IL-13, GFP, IL-13R
2Fc or mIgG2a were cultured at a concentration of 105 cells per 1.5 ml of culture media in duplicate. Cell numbers were monitored daily by trypan blue exclusion assay. Transduced tumor cells grew at rates similar to their parental cells. These results suggest that neither IL-13 nor IL-13R
2 affects the growth of transduced tumor cells in vitro, in spite of low-level expression of IL-4R
and IL-13R
1 on B16F1 and MethA cells detected by real time PCR analysis (Fig. 2C).
|
IL-13 but not IL-13R
2Fc attenuates tumor growth in vivoB16F1 tumor cells are poorly immunogenic, in that prior vaccination with irradiated tumor cells protects only 20% of vaccinated mice against live B16F1 challenge (34,40). On the other hand, MethA, a methycholantheren-induced fibrosarcoma, is an immunogenic tumor model, in which vaccination with irradiated MethA cells leads to almost 100% protection against subsequent live MethA challenge (data not shown).
B16F1-IL-13 or MethA-IL-13 tumor cells were inoculated s.c. into the flank of syngeneic mice. B16F1-IL-13 tumor cell inoculated mice displayed a significant delay in tumor formation as compared to B16F1-GFP cell inoculated control mice (Fig. 3A). B16F1-GFP transduced tumors grew so rapidly that the hosts had to be sacrificed two to three weeks after inoculation due to heavy tumor burden. In the MethA model, small tumor masses were palpable at 1 week post tumor inoculation with either MethA-IL-13 or MethA-GFP transduced cells in BALB/c mice (Fig. 3B). However, MethA-IL-13 tumors gradually reduced in size starting from week 2 (day 11) and eventually regressed completely in 100% of mice, whereas 80% of control MethA-GFP tumors continued to grow in size until the mice were sacrificed. These results suggest that IL-13 can induce immune responses that either delay or eradicate both non-immunogenic and immunogenic tumor formation.
|
It has been reported that over-expression of IL-13R
2 inhibits the tumorigenicity of human breast and pancreatic cancer cells in nude mice (31). Therefore, we sought to examine the effect of IL-13R
2Fc on the tumorigenicity of B16F1 and MethA cells in vivo. B16F1 cells expressing IL-13R
2Fc or mIgG2a were injected into B6 mice. Due to rapid tumor growth towards later time points, substantial number of mice had to be sacrificed because of the heavy tumor burden. As a result, large error bars and smaller sample sizes were used for P-value calculation in each experiment. In order to increase the sample number and thus the statistical significance (similarity/difference) between the treated groups, we pooled data from three sets of experiments by including the mice that lasted for the whole duration of the experiment. As illustrated in Fig. 3(C), mice inoculated with B16F1-IL-13R
2Fc expressing cells developed tumors at a similar rate as those injected with mIgG2a control cells. Similar results were obtained with MethA-IL-13R
2 and MethA-mIgG2a cells (Fig. 3D). In an attempt to confirm that IL-13R
2Fc released from the transduced B16F1 is able of binding IL-13 in vivo, mice were injected with a mixture of B16F1-IL13R
2Fc plus B16F1-IL-13 or B16F1-mIgG2a plus B16F1-IL-13. As shown in Fig. 3(E), mice that were injected with B16F1-IL13R
2Fc and B16F1-IL13 grew slightly faster than the mice injected with B16F1-mIgG2a and B16F1-IL-13 cells, indicating that IL-13R
2Fc is capable of neutralizing the effect of IL-13 in vivo. These results also suggest that although IL-13R
2Fc released by tumor cells is capable of binding IL-13, it has no apparent anti-tumor effect in our tumor systems.
Similar growth of IL-13 and GFP expressing tumor cells in IL-13R
2/ mice
To further understand the role of IL-13R
2 in anti-tumor response, we also injected GFP or IL-13 expressing B16F1/MethA tumor cells into syngeneic IL-13R
2/ or control mice respectively. As demonstrated in Fig. 4(A and B), B16F1 cells expressing GFP or IL-13, respectively, grew similarly in IL-13R
2/ or control mice. A similar tumor growth trend was observed in MethA tumor models (Fig. 4C and D).
|
Treatment with soluble IL-13R
2Fc has no effect on tumor growthTo further examine the role of IL-13R
2Fc in tumor response, mice were treated with IL-13R
2Fc or mIgG2a isotype control before and after the inoculation of B16F1 cells. As demonstrated in Fig. 5, B16F1 tumors grew out similarly in mice treated with IL-13R
2Fc or mIgG2a. Taken together, these results indicate that IL-13R
2 is not required for IL-13 mediated anti-tumor responses and that IL-13R
2 does not appear to play a significant role in the rejection of these tumors.
|
Vaccination with irradiated tumor cells secreting IL-13 does not have an effect on protective immunity
Next, we determined whether IL-13 could generate better protective immunity against subsequent tumor challenge. C57Bl/6 mice were vaccinated with 2 x 105 of irradiated IL-13 or GFP (control) expressing tumor cells followed by challenging with 105 parental tumor cells 810 days later. As demonstrated in Fig. 6(A), 1020% mice vaccinated with irradiated B16F1-IL-13 cells were protected against parental challenge, similar to what is achieved with the control group (1020%). In order to test if IL-13 secreted by tumor cells was reducing anti-tumor responses, mice were vaccinated with irradiated MethA cells expressing either IL-13 or GFP and subsequently challenged with live MethA cells. Vaccinations with irradiated cells resulted in 100% protection against live challenge in both groups of Balb/C mice (Fig. 6B). These results suggest that although IL-13 secreted by tumor cells enhances tumor rejection, it does not have an apparent effect on anti-tumor immunity against subsequent challenge in both tumorigenic and immunogenic tumor models.
|
IL-13 enhances granulocyte trafficking to the draining lymph nodes but does not affect the generation of tumor-specific CTLs
To further investigate the mechanism of IL-13 mediated anti-tumor responses, draining lymph nodes from C57BL/6 mice previously inoculated with IL-13 or GFP expressing B16F1 cells were harvested. The lymph node cells were stained for CD4, CD8, CD11c, NK1.1, Mac3 and Gr1 surface marker expression. As shown in Table 1, at day 3 post-inoculation, higher levels of Mac3 and Gr1 expressing cells were detected in the draining lymph nodes of B16F1-IL-13 injected mice when compared with B16F1-GFP injected mice. The same trend was maintained until post-inoculation day 10 before the levels of Gr1 and Mac3 positive cells started to normalize to those of control mice. However, no apparent changes in the percentages of CD4, CD8, NK1.1 or CD11c positive cells were appreciated (data not shown). These results suggest that IL-13 can facilitate the trafficking of innate immune cells such as neutrophils and macrophages to the draining lymph nodes of the tumor inoculation site.
|
Using IL-13 transduced P815 mastocytoma tumor model, Lebel-Binay et al. (30) have demonstrated that rejection of P815-IL-13 cells leads to the development of tumor-specific immunity and protection against challenge with parental tumor cells. To determine whether IL-13 expressing tumor cells could enhance a tumor antigen-specific response in the B16F1 melanoma model, we used the B16F1 tumor-specific tyrosinase related protein-2 (TRP-2) peptide to evaluate the effect of IL-13 on T cell responses in vivo (35,36). The presence of TRP-2-specific CD8+ T cells in tumor cell injected mice was determined with tetramer containing TRP-2 peptides. Single cell suspensions from draining lymph nodes of B16F1-GFP or B16F1-IL-13 injected mice were stained with TRP-2 tetramer. Compared with the control mice, B16F1-IL-13 cell injected mice had similar numbers of tumor-specific CD8+ T cells (0.11% in B16F1-GFP vs 0.09% in B16F1-IL-13). As expected, cells from naive mice (negative control) and mice injected with same number of B16F1-IL-21 (positive control) (35) stained with 0.04% and 0.59% tetramer positive respectively (Fig. 7AD).
|
To determine whether IL-13 could have an effect on the generation of tumor-specific CTLs, splenocytes from mice injected with either IL-13 or GFP expressing B16F1 cells were stimulated with TPR-2 peptide or OVA control peptide in an IFN
ELISPOT assay. After the background with OVA peptide was subtracted, the number of IFN
producing cells in B16F1-IL-13 injected mice was slightly lower than those in B16F1-GFP injected mice (Fig. 7E). TNF
and IL-10 ELISPOT assays were performed similarly, and no significant difference in spot forming units (SFU) was detected between B16F1-GFP and B16F1-IL-13 tumor cell injected mice (data not shown). To further demonstrate if IL-13 could lyse tumor cells, splenocytes from either IL-13 or GFP expressing tumor-injected mice were first stimulated with TRP-2 peptide in vitro prior to CTL assays. Splenocytes from B16F1-IL-13 injected mice had very similar cytolytic activity towards TRP-2 peptide pulsed RMA-S cells compared to splenocytes from GFP expressing tumor bearing mice at all E:T ratios (Fig. 7F). Taken together, the above data suggest IL-13 does not significantly affect the tumor-specific CTL responses but enhances the recruitment of granulocytes and macrophages, which may be responsible for the complete tumor rejection in MethA tumor models and the inhibition of tumor growth in B16F1 tumor model. This finding is also consistent with the result that mice vaccinated with irradiated B16F1-IL-13 tumor cells demonstrated no added protection (1020% protection) against challenge with parental B16F1 cells as compared with irradiated B16F1-GFP cells (Fig. 6).
| Discussion |
|---|
|
|
|---|
We show in this study that although IL-13 and IL-13R
2Fc do not affect the growth of B16F1 melanoma and MethA fibrosarcoma cells in vitro, IL-13 significantly reduces their tumorigenicity in vivo, possibly via the recruitment of neutrophils, macrophages and enhancement of innate anti-tumor immunity. Moreover, expression of IL-13R
2Fc by tumor cells does not significantly alter tumor growth pattern both in vitro and in vivo. Additionally, using IL-13R
2Fc protein, we further demonstrate that IL-13R
2Fc alone is not sufficient to prevent tumor growth in B16F1 tumor system.
B16F1 and MethA cells have been widely used for gene therapy studies. In particular, various cytokine genes such as IL-4, IL-5, IL-6, IL-12, IFN-
, TNF-
or GM-CSF transduced B16 cells displayed moderate delays in tumor formation although all mice eventually succumbed to overwhelming tumor burden (40). To date, only IL-2, IL-10 and IL-21 have been reported to induce complete regression of transduced B16 tumors in vivo (34,40,41). Although IL-13 has anti-proliferative effects on some tumor cell lines and both B16F1 and MethA cells express low levels of IL-4R
and IL-13R
1 transcripts, IL-13 and IL-13R
2 transduced B16F1 and MethA cells grew at similar kinetics as GFP and mIgG2a expressing control cells in vitro. This suggests that expression of the cytokine and its decoy receptor has no direct effect on B16F1 and MethA cell proliferation in vitro.
We found that IL-13 reduced the tumorigenicity of both B16F1 and MethA cells in vivo. This is consistent with findings in the IL-13 transfected P815 tumor model (30). In that system, however, IL-13 also leads to the development of systemic specific anti-tumor response that ultimately results in a long-lasting protective immunity. In contrast, IL-13 did not confer any better protection against parental challenge than GFP in our B16F1 tumor model. Extensive cytokine assays and proliferation assays done on draining lymph node cells and splenocytes of tumor injected mice revealed no significant difference between IL-13 and GFP expressing tumors (data not shown). Additionally, the fact that B16F1-IL13 and B16F1-GFP cells induced similar numbers of tumor-specific T cells as detected by tetramer, IFN
ELISPOT and CTL assays, suggests that T cells are not major players in IL-13 induced anti-tumor response in our system. This may be explained by the fact that although IL-13 is produced by T cells, T cells have no or minimal ability to respond to IL-13, due to a lack of IL-13R
1 expression on their surface (6,42). Therefore, it is likely that in the P815 mastocytoma model, the effect of IL-13 on tumor-specific protective response is indirect. Indeed, infiltrating macrophages and neutrophils were found in IL-13 transduced P815 tumor models, which is similar to our finding (30). Although the exact role of neutrophils and macrophages in tumor immuno-surveillance is not clear, it is widely accepted that IL-13 can activate macrophages. Also, it has been reported that high levels of IL-13 have some antiangiogenic effect and enhance antigen presentation to T cells (43,44).
The role of IL-13 in tumor immunity appears to be complex, and may depend upon both the tumor type and the genetic background of the host. Previous studies using the 15-12RM fibrosarcoma model, data from CD1 and Stat6 knockout mice and IL-13R
2Fc inhibitor have suggested that IL-13, secreted by NKT cells, inhibits the differentiation of tumor-specific CD8+ T cells and thus suppresses immuno-surveillance (33). However, in the 4T1 mammary carcinoma model, where NKT deficient CD1/ mice also exhibit enhanced immunity to tumor, inhibition of IL-13 by IL-13R
2Fc alone is not sufficient to induce protective immunity against the 4T1 tumor (45,46). The possible discrepancies in the effect of IL-13 in tumor rejection may be due to the fact that while CD8+ cytotoxic CTLs are solely responsible for the rejection of 15-13RM cells, both innate and adaptive immune responses are required for the complete elimination of B16F1 tumor (47). In addition, local secretion of high levels of IL-13 by transduced tumor cells in B16F1 and P815 tumor systems may be more effective in recruiting granulocytes to the tumor sites, which contributes to the induction of effective innate anti-tumor immunity.
Recently, Wood et al. and Chiaramonte et al. (18,19) have demonstrated that IL-13R
2 not only profoundly modulates the level of IL-13 but also influences its distribution between serum and tissue in mice. Here we show that tumor growth is not affected in IL-13R
2 deficient mice inoculated with either B16F1 melanoma or MethA fibrocarcoma. This suggests that modulation of systemic IL-13 levels has little or no effect on tumor rejection. Also, this finding correlates with our observation that IL-13R
2Fc expressing tumors have similar growth kinetics as those of control tumors in wild-type mice. However, our result is in contrast with previous finding that human tumors over-expressing surface IL-13R
2 lose their tumorigenicity in nude mice (31). In that model, neutrophils and macrophages were also detected in regressing tumors. It is unclear whether the solubility of IL-13R
2Fc or the nature of tumor cells has influenced the anti-tumor immunity. Taken together, we conclude that high doses of IL-13, but not IL-13R
2Fc, at the tumor inoculation site may enhance the recruitment of neutrophils and macrophages that ultimately attenuate tumor growth. Furthermore, endogenous IL-13 does not appear to play a major role in rejection of either tumor, in that modulation of endogenous levels by either deletion of the decoy IL13R
2, or expression of soluble IL-13R
2Fc by the tumor neither enhances nor delays tumor rejection. Rather, ectopic expression of IL-13 by the tumor appears to be critical in facilitating the anti-tumor response. An understanding of the mechanisms by which IL-13 enhances recruitment of neutrophils and macrophages to the tumor site and results in growth attenuation may allow the design of better strategies for tumor therapy.
| Acknowledgements |
|---|
The authors thank Dr Marion Kasaian for critically reviewing this manuscript, Dr K. Karre for providing RMA-S cell line, and Leslie Lowe and Barbara Sibley for providing ELISA protocols.
| Abbreviations |
|---|
IL-13R
2FcIL-13 receptor alpha 2 fusion protein
IL-13R
2IIL-13 receptor alpha 2 deficient mice
JAK/STATJanus kinases/signal transducers and activators of transcription
VSV-Gvesicular somatic virus G protein
| References |
|---|
|
|
|---|
- Finkelman, F. D., Wynn, T. A., Donaldson, D. D. and Urban, J. F. 1999. The role of IL-13 in helminth-induced inflammation and protective immunity against nematode infections. Curr. Opin. Immunol. 11:420.[CrossRef][Web of Science][Medline]
- Peritt, D., Robertson, S., Gri, G., Showe, L., Aste-Amezaga, M. and Trinchieri, G. 1998. Differentiation of human NK cells into NK1 and NK2 subsets. J. Immunol. 161:5821
[Abstract/Free Full Text] - McKenzie, A. N., Li, X., Largaespada, D. A., Sato, A., Kaneda, A., Zurawski, S. M., Doyle, E. L., Milatovich, A., Francke, U., Copeland, N. G. et al. 1993. Structural comparison and chromosomal localization of the human and mouse IL-13 genes. J. Immunol. 150:5436.[Abstract]
- McKenzie, G. J., Bancroft, A., Grencis, R. K. and McKenzie, A. N. 1998. A distinct role for interleukin-13 in Th2-cell-mediated immune responses. Curr. Biol. 8:339.[CrossRef][Web of Science][Medline]
- Minty, A., Chalon, P., Derocq, J. M., Dumont, X., Guillemot, J. C., Kaghad, M., Labit, C., Leplatois, P., Liauzun, P., Miloux, B. et al. 1993. Interleukin-13 is a new human lymphokine regulating inflammatory and immune responses. Nature 362:248.[CrossRef][Medline]
- Zurawski, G. and de Vries, J. E. 1994. Interleukin 13, an interleukin 4-like cytokine that acts on monocytes and B cells, but not on T cells. Immunol. Today 15:19.[CrossRef][Web of Science][Medline]
- Wynn, T. A. 2003. IL-13 effector functions. Annu. Rev. Immunol. 21:425.[CrossRef][Web of Science][Medline]
- Miloux, B., Laurent, P., Bonnin, O., Lupker, J., Caput, D., Vita, N. and Ferrara, P. 1997. Cloning of the human IL-13R alpha1 chain and reconstitution with the IL4R alpha of a functional IL-4/IL-13 receptor complex. FEBS Lett. 401:163.[CrossRef][Web of Science][Medline]
- Nelms, K., Keegan, A. D., Zamorano, J., Ryan, J. J. and Paul, W. E. 1999. The IL-4 receptor: signaling mechanisms and biologic functions. Annu. Rev. Immunol. 17:701.[CrossRef][Web of Science][Medline]
- Caput, D., Laurent, P., Kaghad, M., Lelias, J. M., Lefort, S., Vita, N. and Ferrara, P. 1996. Cloning and characterization of a specific interleukin (IL)-13 binding protein structurally related to the IL-5 receptor alpha chain. J. Biol. Chem. 271:16921.
[Abstract/Free Full Text] - Donaldson, D. D., Whitters, M. J., Fitz, L. J., Neben, T. Y., Finnerty, H., Henderson, S. L., OHara, R. M. Jr, Beier, D. R., Turner, K. J., Wood, C. R. and Collins, M. 1998. The murine IL-13 receptor alpha 2: molecular cloning, characterization and comparison with murine IL-13 receptor alpha 1. J. Immunol. 161:2317.
[Abstract/Free Full Text] - Aman, M. J., Tayebi, N., Obiri, N. I., Puri, R. K., Modi, W. S. and Leonard, W. J. 1996. cDNA cloning and characterization of the human interleukin 13 receptor alpha chain. J. Biol. Chem. 271:29265.
[Abstract/Free Full Text] - Hilton, D. J., Zhang, J. G., Metcalf, D., Alexander, W. S., Nicola, N. A. and Willson, T. A. 1996. Cloning and characterization of a binding subunit of the interleukin 13 receptor that is also a component of the interleukin 4 receptor. Proc. Natl Acad. Sci. USA 93:497.
[Abstract/Free Full Text] - Colotta, F., Re, F., Muzio, M., Bertini, R., Polentarutti, N., Sironi, M., Giri, J. G., Dower, S. K., Sims, J. E. and Mantovani, A. 1993. Interleukin-1 type II receptor: a decoy target for IL-1 that is regulated by IL-4. Science 261:472.
[Abstract/Free Full Text] - Di Santo, E., Meazza, C., Sironi, M., Fruscella, P., Mantovani, A., Sipe J. and Ghezzi, P. 1997. IL-13 inhibits TNF production but potentiates that of IL-6 in vivo and ex vivo in mice. J. Immunol. 159:379.[Abstract]
- Muchamuel, T., Menon, S., Pisacane, P., Howard, M. C. and Cockayne, D. A. 1997. IL-13 protects mice from lipopolysaccharide-induced lethal endotoxemia: correlation with down-modulation of TNF-alpha, IFN-gamma and IL-12 production. J. Immunol. 158:2898.[Abstract]
- Nicoletti, F., Mancuso, G., Cusumano, V., Di Marco, R., Zaccone, P., Bendtzen, K. and Teti, G. 1997. Prevention of endotoxin-induced lethality in neonatal mice by interleukin-13. Eur. J. Immunol. 27:1580.[Web of Science][Medline]
- Wood, N., Whitters, M. J., Jacobson, B. A., Witek, J., Sypek, J. P., Kasaian, M., Eppihimer, M. J., Unger, M., Tanaka, T., Goldman, S. J., Collins, M., Donaldson, D. D. and Grusby, M. J. 2003. Enhanced interleukin (IL)-13 responses in mice lacking IL-13 receptor
2. J. Exp. Med. 197:703.[Abstract/Free Full Text] - Chiaramonte, M. G., Mentink-Kane, M., Jacobson, B. A., Cheever, A. W., Whitters, M. J., Goad, M. E. P., Wong, A., Collins, M., Donaldson, D. D., Grusby, M. J. and Wynn, T. A. 2003. Regulation and function of the interleukin 13 receptor
2 during a T helper cell type 2-dominant immune response. J. Exp. Med. 197:687.[Abstract/Free Full Text] - Chiaramonte, M. G., Donaldson, D. D., Cheever, A. W. and Wynn, T. A. 1999. An IL-13 inhibitor blocks the development of hepatic fibrosis during a T-helper type 2-dominated inflammatory response. J. Clin. Invest. 104:777.[Web of Science][Medline]
- Wills-Karp, M., Luyimbazi, J., Xu, X., Schofield, B., Neben, T. Y., Karp, C. L. and Donaldson, D. D. 1998. Interleukin-13: central mediator of allergic asthma. [comment] Science 282:2258.
[Abstract/Free Full Text] - Grunig, G., Warnock, M., Wakil, A. E., Venkayya, R., Brombacher, F., Rennick, D. M., Sheppard, D., Mohrs, M., Donaldson, D. D., Locksley, R. M. and Corry, D. B. 1998. Requirement for IL-13 independently of IL-4 in experimental asthma. [comment] Science 282:2261.
[Abstract/Free Full Text] - Debinski, W., Miner, R., Leland, P., Obiri, N. I. and Puri, R. K. 1996. Receptor for interleukin (IL) 13 does not interact with IL4 but receptor for IL4 interacts with IL13 on human glioma cells. J. Biol. Chem. 271:22428.
[Abstract/Free Full Text] - Obiri, N. I., Debinski, W., Leonard, W. J. and Puri, R. K. 1995. Receptor for interleukin 13. Interaction with interleukin 4 by a mechanism that does not involve the common gamma chain shared by receptors for interleukins 2, 4, 7, 9 and 15. J. Biol. Chem. 270:8797.
[Abstract/Free Full Text] - Husain, S. R., Obiri, N. I., Gill, P., Zheng, T., Pastan, I., Debinski, W. and Puri, R. K. 1997. Receptor for interleukin 13 on AIDS-associated Kaposis sarcoma cells serves as a new target for a potent Pseudomonas exotoxin-based chimeric toxin protein. Clin. Cancer Res. 3:151.[Abstract]
- Blais, Y., Gingras, S., Haagensen, D. E., Labrie, F. and Simard, J. 1996. Interleukin-4 and interleukin-13 inhibit estrogen-induced breast cancer cell proliferation and stimulate GCDFP-15 expression in human breast cancer cells. Mol. Cell Endo. 121:11.[CrossRef][Web of Science][Medline]
- Obiri, N. I., Husain, S. R., Debinski, W. and Puri, R. K. 1996. Interleukin 13 inhibits growth of human renal cell carcinoma cells independently of the p140 interleukin 4 receptor chain. Clin. Cancer Res. 2:1743.[Abstract]
- Serve, H., Oelmann, E., Herweg, A., Oberberg, D., Serve, S., Reufi, B., Mucke, C., Minty, A., Thiel, E. and Berdel, W. E. 1996. Inhibition of proliferation and clonal growth of human breast cancer cells by interleukin 13. Cancer Res. 56:3583.
[Abstract/Free Full Text] - Renard, N., Duvert, V., Banchereau, J. and Saeland, S. 1994. Interleukin-13 inhibits the proliferation of normal and leukemic human B-cell precursors. Blood 84:2253.
[Abstract/Free Full Text] - Lebel-Binay, S., Laguerre, B., Quintin-Colonna, F., Conjeaud, H., Magazin, M., Miloux, B., Pecceu, F., Caput, D., Ferrara, P. and Fradelizi, D. 1995. Experimental gene therapy of cancer using tumor cells engineered to secrete interleukin-13. Eur. J. Immunol. 25:2340.[Web of Science][Medline]
- Kawakami, K., Kawakami, M., Snoy, P. J., Husain, S. R. and Puri, R. K. 2001. In vivo overexpression of IL-13 receptor alpha2 chain inhibits tumorigenicity of human breast and pancreatic tumors in immunodeficient mice. J. Exp. Med. 194:1743.
[Abstract/Free Full Text] - Kawakami, K., Husain, S. R., Bright, R. K. and Puri, R. K. 2001. Gene transfer of interleukin 13 receptor alpha2 chain dramatically enhances the antitumor effect of IL-13 receptor-targeted cytotoxin in human prostate cancer xenografts. Cancer Gene Ther. 8:861.[CrossRef][Web of Science][Medline]
- Terabe, M., Matsui, S., Noben-Trauth, N., Chen, H., Watson, C., Donaldson, D. D., Carbone, D. P., Paul, W. E. and Berzofsky, J. A. 2000. NKT cell-mediated repression of tumor immunosurveillance by IL-13 and the IL-4R-STAT6 pathway. Nat. Immunol. 1:515.[CrossRef][Web of Science][Medline]
- Ma, H., Whitters, M. J., Konz, R. F., Senices, M, Young, D. A., Grusby, M. J., Collins, M. and Dunussi-Joannopoulos, K. 2003. IL-21 activates both innate and adaptive immunity to generate potent anti-tumor responses that require perforin but are independent of IFN-g. J. Immunol. 171:608.
[Abstract/Free Full Text] - van Elsas, A., Sutmuller, R. P., Hurwitz, A. A., Ziskin, J., Villasenor, J., Medema, J. P., Overwijk, W. W., Restifo, N. P., Melief, C. J., Offringa, R. and Allison, J. P. 2001. Elucidating the autoimmune and antitumor effector mechanisms of a treatment based on cytotoxic T lymphocyte antigen-4 blockade in combination with a B16 melanoma vaccine: comparison of prophylaxis and therapy. J. Exp. Med. 194:481.
[Abstract/Free Full Text] - Sutmuller, R. P., van Duivenvoorde, L. M., van Elsas, A., Schumacher, T. N., Wildenberg, M. E., Allison, J. P., Toes, R. E., Offringa, R. and Melief, C. J. 2001. Synergism of cytotoxic T lymphocyte-associated antigen 4 blockade and depletion of CD25(+) regulatory T cells in antitumor therapy reveals alternative pathways for suppression of autoreactive cytotoxic T lymphocyte responses. J. Exp. Med. 194:823.
[Abstract/Free Full Text] - Ranganath, S., Ouyang, W., Bhattarcharya, D., Sha, W. C., Grupe, A., Peltz, G. and Murphy, K. M. 1998. GATA-3-dependent enhancer activity in IL-4 gene regulation. J. Immunol. 161:3822.
[Abstract/Free Full Text] - Ory, D. S., Neugeboren, B. A. and Mulligan, R. C. 1996. A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes. Proc. Natl Acad. Sci. USA 93:11400.
[Abstract/Free Full Text] - Bloom, M. B., Perry-Lalley, D., Robbins, P. F., Li, Y., el-Gamil, M., Rosenberg, S. A. and Yang, J. C. 1997. Identification of tyrosinase-related protein 2 as a tumor rejection antigen for the B16 melanoma. J. Exp. Med. 185:453.
[Abstract/Free Full Text] - Dranoff, G., Jaffee, E., Lazenby, A., Golumbek, P., Levitsky, H., Brose, K., Jackson, V., Hamada, H., Pardoll, D. and Mulligan, R. C. 1993. Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimulates potent, specific and long-lasting anti-tumor immunity. Proc. Natl Acad. Sci. USA 90:3539.
[Abstract/Free Full Text] - Gerard, C. M., Bruyns, C., Delvaux, A., Baudson, N., Dargent, J. L., Goldman, M. and Velu, T. 1996. Loss of tumorigenicity and increased immunogenicity induced by interleukin-10 gene transfer in B16 melanoma cells. Hum. Gene Ther. 7:23.[Web of Science][Medline]
- Sornasse, T., Larenas, P. V., Davis, K. A., de Vries, J. E. and Yssel, H. 1996. Differentiation and stability of T helper 1 and 2 cells derived from naive human neonatal CD4+ T cells, analyzed at the single-cell level. J. Exp. Med. 184:473.
[Abstract/Free Full Text] - Gordon, S. 2003. Alternative activation of macrophages. Nat. Rev. Immunol. 3:23.[CrossRef][Web of Science][Medline]
- Volpert, O. V., Fong, T., Koch, A. E., Peterson, J. D., Waltenbaugh, C., Tepper, R. I. and Bouck, N. P. 1998. Inhibition of angiogenesis by interleukin 4. J. Exp. Med. 188:1039.
[Abstract/Free Full Text] - Ostrand-Rosenberg, S., Grusby, M. J. and Clements, V. K. 2000. Cutting edge: STAT6-deficient mice have enhanced tumor immunity to primary and metastatic mammary carcinoma. J. Immunol. 165:6015.
[Abstract/Free Full Text] - Ostrand-Rosenberg, S., Clements, V. K., Terabe, M., Park, J. M., Berzofsky, J. A. and Dissanayake, S. K. 2002. Resistance to metastatic disease in STAT6-deficient mice requires hemopoietic and nonhemopoietic cells and is IFN-gamma dependent. J. Immunol. 169:5796.
[Abstract/Free Full Text] - van Elsas, A., Hurwitz, A. A. and Allison, J. P. 1999. Combination immunotherapy of B16 melanoma using anti-cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and granulocyte/macrophage colony-stimulating factor (GM-CSF)-producing vaccines induces rejection of subcutaneous and metastatic tumors accompanied by autoimmune depigmentation. J. Exp. Med. 190:355.
[Abstract/Free Full Text]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






