International Immunology Advance Access originally published online on April 19, 2004
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
International Immunology, Vol. 16, No. 6, pp. 777-786,
June 2004
© 2004 Japanese Society for Immunology
PYNOD, a novel Apaf-1/CED4-like protein is an inhibitor of ASC and caspase-1
Center for the Development of Molecular Target Drugs, Cancer Research Institute, Kanazawa University, Kanazawa 920-0934, Japan
Correspondence to: T. Suda; E-mail: sudat@kenroku.kanazawa-u.ac.jp
Transmitting editor: T. Watanabe
| Abstract |
|---|
|
|
|---|
Recently, a large subfamily of nucleotide-binding and oligomerization domain-containing proteins that have an N-terminal pyrin-like domain and C-terminal leucine-rich repeats has been described. In this study, we identified PYNOD, a novel member of this family that lacks the leucine-rich repeats. We found that human PYNOD mRNA is expressed in various tissues and at high levels in heart, skeletal muscle and brain. It is also expressed in various cell lines, including haematopoietic cell lines. PYNOD oligomerizes and binds to ASC, an adaptor protein that plays a role in apoptotic and inflammatory signal transduction, and to caspase-1 and IL-1ß. PYNOD inhibits apoptosis-associated speck-like protein containing a CARD (ASC)-mediated NF-
B activation and apoptosis, and caspase-1-mediated IL-1ß maturation, and it does so in the presence and absence of constitutively active mutants of CARD12 and PYPAF1, which are enhancers of these processes. Thus, PYNOD is a novel regulator of apoptosis and inflammation.
Keywords: apoptosis, IL-1ß, inflammation, NF-
B
| Introduction |
|---|
|
|
|---|
A large family of mammalian Apaf-1-like proteins has recently emerged (14). The first-reported members of this family, CIITA, Nod1, Nod2 and CARD12 (also called Ipaf, or CLAN), possess an N-terminal caspase activation and recruitment domain (CARD), a mid-sequence nucleotide-binding and oligomerization domain (NOD) and C-terminal leucine-rich repeats (LRRs). More recently reported members of this family (the PYPAF or NALP family) possess an N-terminal pyrin-like domain (PYD) instead of a CARD. The 3-dimensional structure of PYD determined by NMR spectroscopy (5,6) revealed that PYD is the fourth member of the death domain (DD) fold domains; the others are DD, the death effector domain, and CARD. The N-terminal domains of Apaf-1-like molecules recruit downstream signaling molecules. In addition, because the truncation of C-terminal LRRs enhances the activity of Apaf-1-like molecules, it has been postulated that the LRRs are negative regulatory domains, and that ligand binding to this region relieves the suppression (710).
Some members of the Apaf-1-like molecules have been show to play important roles in the immune system. For instance, CIITA, originally identified as product of the gene that restores class II MHC expression in the cells from patients with bare lymphocyte syndrome, is a transactivator of the class II MHC gene expression (11). On the other hand, Nod1 and Nod2 were recently demonstrated to be cytoplasmic pathogen receptors that play an important role in the innate immune system (1214), in parallel with toll-like receptors that are cell-surface pathogen receptors. Nod1 and Nod2 recognize partial structures of bacterial peptidoglycans,
-D-glutamyl-meso-diaminopimelic acid and muramyl dipeptides respectively, using their LRRs (1214), and induce NF-
B activation through interaction with RICK/RIP2 with their N-terminal CARD domains (8,9). Several other members of Apaf-1-like molecules, including CARD12, NALP1 (also called DEFCAP, NAC or CARD7), PYPAF1 (Cryopyrin), PYPAF5 (NALP6) and PYPAF7 (NALP12, Monarch-1), induce NF-
B activation, caspase-1-mediated IL-1ß processing, and/or apoptosis (1,10,1518). Based on these functions, it is likely that these Apaf-1-like molecules also play an important role in innate immunity. However, our knowledge about their physiological roles are limited, because their upstream signaling molecules or ligands (possibly some pathogen-derived molecules in analogy with Nod1 and Nod2) are not known. Finally, PAN2 (PYPAF4, NALP4) interacts with IKK
and inhibits TNF
- and IL-1ß-induced NF-
B activation (19). Thus, some Apaf-1-like molecule may play regulatory roles in immune/inflammatory responses. Many other Apaf-1-like molecules remain uncharacterized.
Some PYD-containing members of Apaf-1-like molecules (such as PYPAF1, PYPAF5, PYPAF7 and NALP1) bind apoptosis-associated speck-like protein containing a CARD (ASC) (also called as PYCARD or TMS1), an adaptor protein consisting of PYD and CARD. ASC links these Apaf-1-like molecules and caspase-1, and induces IL-1ß maturation (1,10,16,17). ASC also couples these Apaf-1-like molecules onto an NF-
B activating pathway, although the downstream molecular links to this direction is not known. In addition to the PYD-containing Apaf-1-like molecules described above, CARD12 requires ASC to induce NF-
B activation, although CARD12 induces caspase-1-mediated IL-1ß processing through direct interaction with caspase-1 in the absence of ASC (20).
ASC also plays an important role in apoptosis, as it was originally identified as a protein that generates speck-like structure in apoptotic HL-60 cells treated with chemotherapeutic agents (21). The expression of ASC gene has been found ubiquitously in various tissues, while its highest expression was observed in peripheral blood lymphocytes. Interestingly, the expression of ASC is suppressed by hypermethylation in various tumor cell lines and tissues, suggesting that ASC is a tumor suppressor gene (2226). Consistent with this notion, overexpression of ASC only or its moderate expression together with PYPAF1 or CARD12 induces apoptosis (27). Interestingly, apoptosis induced by the expression of CARD12 plus ASC was mediated by caspase 8. In contrast, it was recently reported that the expression of ASC was induced by p53, and ASC promotes translocation of BAX to mitochondria and caspase-9-dependent apoptosis, suggesting that ASC plays an essential role in the p53-mediated apoptosis (28). Thus, ASC may activate different apoptotic signaling pathways in different contexts.
Mutations of Apaf-1-like proteins have been connected to several genetic inflammatory diseases. For example, loss-of-function mutations in the Nod2 gene are associated with susceptibility to Crohns disease (2931). On the other hand, gain-of-function mutations in Nod2 are responsible for Blau syndrome (32). Furthermore, mutations in the PYPAF1/cryopyrin genes cause familial cold autoinflammatory syndrome and MuckleWells syndrome (33). Thus, the dysregulation of Apaf-1-like molecules may be involved in immunological diseases such as inflammatory diseases, autoimmune diseases or allergy.
By basing a search on homology to PYPAF1, we have identified a gene encoding a novel Apaf-1-like protein, PYNOD, and have characterized its expression pattern and function. Unlike other Apaf-1-like molecules, PYNOD lacks the C-terminal LRRs. Our analyses demonstrate that PYNOD is a novel negative regulator of inflammatory and apoptotic signal transduction.
| Methods |
|---|
|
|
|---|
Cell lines
HepG2, PK-1, PK-8, PK-9, SW480, DLD-1 and SH-10-TC were provided by the Cell Resource Center for Biomedical Research, Institute of Development, Aging and Cancer, Tohoku University. HEK293 cells were obtained from Dr Hiroshi Sato (Cancer Research Institute, Kanazawa University). HEK293T cells were obtained from two sources, HEK293T-S from Dr Hiroshi Sato and HEK293T-Y from Dr Takashi Yokota (Graduate School of Medicine, Kanazawa University). Transfection with expression plasmids for Fas, Bid or ASC induces apoptosis in HEK293T-Y cells, whereas HEK293T-S cells are relatively resistant to the same treatment.
Isolation of PYNOD cDNAs
Human and mouse PYNOD cDNAs were amplified by nested RTPCR from human heart total RNA (Clontech, Palo Alto, CA) and mouse brain poly(A) positive RNA, respectively, using the following primers: human PYNOD first round sense, AGCTTTGCACATGTATCTCG; antisense, TCTTTCCTCAGA GTGTTGTC; second round sense, CCTTCCCCCAGATCA CCATG; antisense, TCCTCATAGAGATCTTGTAC; mouse PYNOD first round sense, TTCTCGTTTCCAGGTGCCAG; antisense, TGCACATGCTAAGACTCCTG; second round sense, GCTGAACTCTGACCATCATG; antisense, CTACCCA TTCATCTTATCTATC.
Plasmids
Human cDNAs for ASC, CARD12, PYPAF1, IL-1ß, caspase-1, RIP and Bid were amplified by RTPCR. The resultant cDNAs and human and mouse PYNOD cDNAs were cloned into the mammalian expression vector pEF-BOS-EX (34), and the plasmids were named pEF-PYNOD, pEF-mPYNOD, pEF-IL-1ß, pEF-ASC, pEF-CARD12 and pEF-caspase-1, respectively. To generate a plasmid (pEF-CARD12
LRR) expressing LRR-truncated CARD12 (residues 1457), pEF-CARD12 was digested with BstPI and EcoRV, filled in, and ligated. To generate a similar mutant of PYPAF1 (residues 1739), a stop codon and an XbaI site were introduced next to the codon for residue 739 using PCR. The HindIIIXbaI fragment of the PYPAF1 cDNA in pEF-PYPAF1 was replaced with the corresponding fragment of the PCR product to generate pEF-PYPAF1
LRR.
Plasmids expressing FLAG-tagged proteins were generated as described below. The full-length cDNAs for human PYNOD and IL-1ß were cloned into p3XFLAG-CMV-7.1 (Sigma, Saint Louis, MO), and the plasmids were named p3XFLAG-PYNOD and p3XFLAG-IL-1ß, respectively. The cDNAs encoding caspase-1 (whose initial methionine was replaced with leucine), RIP-DD (residues 558671), a TRADD dominant-negative mutant (DN, residues 158312, S296A, L297A, E299A), and an IKK
-DN (residues 135419) were generated by PCR and cloned into pCMV-Tag2B (Stratagene, La Jolla, CA). The resultant FLAG-tagged cDNAs were subcloned into pEF-BOS-EX to generate pEF-FLAG-caspase-1, pEF-FLAG-RIPDD, pEF-FLAG-TRADDDN, and pEF-FLAG-IKK
DN, respectively. The cDNAs encoding full-length Bid and the Bid C-terminal domain (BidCT, residues 61195) were amplified by PCR and cloned into pBluescript II (Stratagene). The glycine at position 94 of Bid-CT was mutated to glutamic acid using the GeneEditor in vitro Site-Directed Mutagenesis System (Promega, WI). The full-length Bid and G94E-BidCT cDNAs were cloned into pCMV-Tag2A. The resultant cDNAs were subcloned into pEF-BOS-EX to generate pEF-FLAG-Bid and pEF-FLAG-G94E-BidCT. G94E-BidCT showed somewhat weaker apoptosis-inducing activity than did wild-type BidCT, but it was still much more potent than full-length Bid. FLAG-tagged human MyD88 cloned into pEF-BOS was a kind gift of Dr Shizuo Akira (Research Institute for Microbial Diseases, Osaka University). A plasmid expressing MEKK1 (pFC-MEKK) was purchased from Stratagene. A plasmid expressing human Fas (35) was provided by Dr Shigekazu Nagata (Osaka University Medical School).
Analyses of PYNOD mRNA expression
Northern blot analyses were performed using a Human 12-Lane MTN Blot (Clontech) according to the manufacturers protocol. RTPCR analyses were performed as described previously (36). The primers used to detect human PYNOD mRNA were as follows: sense, CCTTCCCCCAGATCACCATG; antisense, CCTCAGAATCTCTGTGACAG. The amounts of template cDNAs were adjusted so that a similar amount of a PCR fragment of ß-actin was generated within the linear range of the PCR.
Assay for the transcriptional activity of NF-
B
HEK293 cells in a 24-well plate were transfected with plasmid DNA including 50 ng of pNF-
B-Luc (carrying a firefly luciferase cDNA driven by 5xNF-
B-binding sites, Stratagene, La Jolla, CA) and 50 ng pRL-TK (carrying renilla luciferase cDNA driven by HSV-TK promoter, Promega, Madison, WI) using the TransIT-LT1 reagent (TAKARA, Otsu, Japan) according to the manufacturers recommendation. The total amount of DNA in each transfection was kept constant by the addition of empty vector (pEF-BOS). Twenty-four hours after the transfection, the firefly and renilla luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega). Relative luciferase activity (RLA) was calculated as follows: RLA = firefly luciferase activity / renilla luciferase activity. Fold induction of NF-
B activity was calculated as follows: fold induction of RLA = experimental RLA / RLA of vector control.
NF-
B electrophoretic mobility shift assay (EMSA)
An EMSA was carried out with extracts of HEK293 cells (10 µg protein) as described previously (37). Oligonucleotides containing the following NF-
B-binding sequence were used (sequence overhangs are in lowercase): forward, gatcTG GGGACTTTCCGC; reverse, gatcGCGGAAAGTCCCCA.
Assay for the caspase-1-mediated IL-1ß secretion
HEK293T-S cells in a 24-well plate were transfected with plasmid DNA including 300 ng of pEFx-hIL-1ß and 5 or 50 ng of pEF-hCaspase-1 using the Lipofectamine and Plus reagents (Invitrogen, Carlsbad, CA). The total amount of DNA in each transfection was kept constant by the addition of empty vector (pEF-BOS). Culture supernatants were harvested 24 h after the transfection, and the concentration of IL-1ß was determined using the Human IL-1ß OptEIA ELISA Set (PharMingen, San Diego, CA) according to the manufacturers protocol.
Apoptosis assay
HEK293T-Y cells in a 96-well plate were transfected with plasmid DNA including 1 ng of pEGFP-C1 (Clontech). Twenty-four hours after the transfection, the cells were stained with propidium iodide and Cy5-annexin V (BioVision, Palo Alto, CA) in binding buffer (10 mM HEPES/NaOH pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1.8 mM CaCl2). The cells were then analyzed using a FACSCalibur equipped with a 488 nm argon laser and a 635 nm diode laser (Becton Dickinson, San Jose, CA).
Immunoprecipitation and western blotting
Immunoprecipitation and western blotting were performed as described previously (38) with some modifications. In brief, HEK293T-S cells in a 24-well plate were transfected with various combinations of plasmids, and then harvested 24 h after the transfection. Cells were lysed in 100 µl of lysis buffer (50 mM Tris/HCl pH 8.0, 150 mM NaCl, 0.2% NP-40, 1 mM APMSF, 1 µg/ml pepstatins, 1 µg/ml leupeptins). After centrifugation, the cleared lysates were incubated with mouse anti-ASC (a kind gift of Dr Junji Sagara, Graduate School of Medicine, Shinshu University), anti-FLAG (Sigma), or anti-Myc monoclonal antibody (MBL, Nagoya, Japan) for 1 h, and the immune complex was precipitated using Protein G Sepharose 4 Fast Flow beads (Amersham, Uppsala, Sweden). Precipitates were then subjected to western blotting using a peroxidase-conjugated anti-FLAG antibody (Sigma) or mouse anti-Myc antibody, followed by a peroxidase-conjugated anti-mouse IgG antibody (Chemicon, Temecula, CA).
| Results |
|---|
|
|
|---|
Identification of human, mouse and rat PYNOD genes
We performed a tblastn search using the amino acid sequence of human PYPAF1 as a query sequence against the nucleotide databases of GenBank. As a result, we identified a novel rat gene encoding a member of the PYPAF family proteins in the genomic clone RP32-100G3 (accession number AC118667) derived from the chromosome 1q32. We named it PYNOD because it consists of N-terminal PYD and C-terminal NOD, but it lacks LRRs (Fig. 1AC). Using the rat PYNOD sequence as a query sequence, we found the genomic sequence of mouse PYNOD in the genomic clone RP24-449N4 (accession number AC122046) derived from mouse chromosome 7E3, and of human PYNOD in the genomic clone RP11-21N2 (accession number AC124259) derived from chromosome 11p15, where the genes for PYPAF5/NALP6 and NALP14/NOD5 are also located. We also found EST sequences derived from mouse olfactory brain (accession numbers BB622805 and AV344932) that contain a partial mouse PYNOD cDNA sequence. Human, mouse and rat PYNOD genes consist of two exons corresponding to PYD and NOD, and span about 4.5 kb, 3 kb and 4 kb, respectively.
|
The authenticity of the predicted mRNA sequences for human and mouse PYNOD was confirmed by isolating their cDNAs from human heart and BALB/c mouse brain mRNA using the RTPCR technique. The nucleotide sequences of human and mouse PYNOD cDNAs determined in this paper have been submitted to GenBank with accession numbers AY489192 and AY489193. The homology of the PYNOD amino acid sequences between different species are as follows: human and mouse, 55.5%; human and rat, 55.9%; and mouse and rat, 91.5% (Fig. 1D). Recently, the human PYNOD gene has been reported as NALP10 and Nod8 (3,4). These reviews mentioned the presence of this gene in the chromosome 11p15.
Expression of PYNOD
The tissue distribution of PYNOD mRNA was examined using northern blot analyses (Fig. 2A). A PYNOD mRNA of
2.4 kb was detected at high levels in heart, brain and skeletal muscle, while weak expression was observed in all other tissues. The
4.4 kb transcript was also observed in brain, heart and skeletal muscle. Other variations in PYNOD mRNA size may occur in the small intestine and placenta. We also detected PYNOD mRNA by RTPCR analysis in various cell lines, including those derived from the haematopoietic lineage, endothelium, liver, pancreas and digestive tract (Fig. 2B). In addition, the PYNOD mRNA expression was enhanced after the treatment with PMA plus ionomycin in K562 and Jurkat but not U937 and THP-1 cells. Its expression in Jurkat cells was also slightly increased by LPS stimulation. Thus, PYNOD expression in some haematopoietic cells may enhanced upon inflammatory stimulation.
|
PYNOD specifically inhibited ASC-mediated NF-
B activation.PYPAF1, 5, 7, and CARD12 activate NF-
B in the presence of ASC (1,10,16,27). Deletion of the LRRs in these proteins enhances this activity. Thus, we expected that PYNOD might act as a constitutive NF-
B activator. To investigate this possibility, we transiently transfected HEK293 cells with a human PYNOD expression vector together with an NF-
B-luciferase reporter plasmid in the presence or absence of expression vectors carrying ASC or CARD12
LRR. The expression of PYNOD alone did not induce significant NF-
B activation (Fig. 3A and B). Instead, and unexpectedly, PYNOD inhibited the NF-
B activation induced by ASC or CARD12
LRR plus ASC in a dose-dependent manner (Fig. 3AC). However, PYNOD did not inhibit the NF-
B activity induced by the transfection of MEKK1 or MyD88 cDNA or by stimulation with TNF
(Fig. 3A and B). Consistent with NF-
B transcriptional activity, nuclear NF-
B DNA-binding activity was increased by the expression of CARD12
LRR plus ASC and inhibited by PYNOD expression (Fig. 3D).
|
PYNOD inhibits maturation of IL-1ß mediated by caspase-1.
The proinflammatory cytokine IL-1ß is produced in its proform. Caspase-1 cleaves Pro-IL-1ß into its active form, and this process is also essential for the secretion of IL-1ß. As reported previously, the expression of CARD12
LRR (independent of ASC) or a high dose of ASC stimulates the caspase-1-mediated secretion of IL-1ß (20). In contrast, PYNOD did not induce the caspase-1-mediated IL-1ß maturation by itself; rather, it inhibited the IL-1ß release induced by high-dose caspase-1, or by a combination of caspase-1 and ASC or CARD12
LRR (Fig. 4A). PYPAF1
LRR but not PYNOD enhanced caspase-1-mediated IL-1ß release in the presence of a limited amount of ASC (Fig. 4B). Instead, PYNOD inhibited the IL-1ß release induced by the combination of PYPAF1
LRR and ASC in a dose-dependent manner.
|
PYNOD inhibits apoptosis induced by ASC
The apoptosis protein Ced-4, the Caenorhabditis elegans ortholog of mammalian Apaf-1, lacks the C-terminal regulatory domain, just like PYNOD. In addition, ASC causes speck-like aggregation in apoptotic HL-60 cells (21), and the overexpression of ASC induces apoptosis in HEK293T-Y cells (27). Therefore, we investigated the effect of PYNOD on apoptosis. As reported previously, a high dose of ASC or the combination of CARD12
LRR and ASC induced apoptosis (Fig. 5A). Unlike the Fas death receptor or Bid, the proapoptotic BH3-only member of the Bcl-2 family, PYNOD did not induce apoptosis by itself in HEK293T-Y cells (Fig. 5B). Interestingly, PYNOD selectively inhibited ASC-mediated apoptosis but not that induced by Fas or Bid.
|
PYNOD interacts with multiple proteins
Since PYNOD inhibits various activities of ASC, we investigated the interaction of PYNOD with ASC in HEK293T-S cells. As shown in Fig. 6A, in the presence of ASC, anti-ASC antibody co-precipitated FLAG-tagged PYNOD but not the RIP-DD. These results suggest that PYNOD interacts with ASC in cells. It has been hypothesized that ligand-induced oligomerization of Apaf-1-like proteins is essential for their downstream signaling. Since PYNOD interacts with ASC and inhibits its function, we speculated PYNOD might not be able to self-oligomerize. However, when Myc-tagged and FLAG-tagged PYNOD were co-expressed in cells, Myc-PYNOD was co-precipitated with FLAG-PYNOD and vice versa (Fig. 6B and data not shown). Thus, although PYNOD oligomerizes and interacts with ASC, these interactions did not result in the activation of ASC.
|
Since PYNOD inhibits the IL-1ß maturation induced by high-dose caspase-1 in the absence of ASC or CARD12
LRR, we investigated the interaction between PYNOD and caspase-1 or IL-1ß. We found that human PYNOD interacted with both IL-1ß and caspase-1 (Fig. 6B). When we expressed mouse proteins in a similar experiment, mouse PYNOD also interacted with mouse IL-1ß and caspase-1 (data not shown). In contrast, FLAG-tagged RIP-DD, TRADD-DN, IKK
-DN and full-length Bid did not coprecipitate with Myc-PYNOD (Fig. 6B). | Discussion |
|---|
|
|
|---|
Here we identified a novel Apaf-1 like molecule, PYNOD, that consists of a PYD and a NOD, but lacks LRRs. This is probably the major form of PYNOD, because 3'RACE analyses for mouse PYNOD mRNA failed to detect a cDNA containing LRRs. The
4.4 kb transcript may represent premature PYNOD mRNA, because its length is similar to that of the human PYNOD gene. However, we cannot exclude a possibility that some longer transcripts represent splicing variants carrying LRRs.
We demonstrated that PYNOD interacts with ASC and inhibits multiple functions of ASC, including activation of NF-
B and caspase-1, and induction of apoptosis. PYNOD also interacts with caspase-1 and IL-1ß and inhibits caspase-1-mediated IL-1ß maturation. Thus, PYNOD is likely to be a multifunctional negative regulator of inflammation and apoptosis. On the other hand, PYNOD does not inhibit MEKK1-, MyD88-, or TNF
-induced NF-
B activation, or Fas- or Bid-induced apoptosis. We also failed to show that PYNOD inhibited apoptosis of HEK293T-Y cells induced by staurosporine, etoposide (VP-16), Fas ligand, or TNF-
(see Supplementary figure S2, available at International Immunology Online). Thus, the inhibitory activity of PYNOD in NF-
B activation and apoptosis occurs only when they are mediated by ASC, suggesting that ASC is a direct target of PYNOD. In this context, PYNOD is different from PAN2/PYPAF4, which has been reported to interact directly with IKK
and inhibits the NF-
B activation induced by multiple intracellular molecules that are involved in the TNF receptor and IL-1/toll-like receptor signal transduction pathways (19). On the other hand, PYNOD inhibited the caspase-1-mediated IL-1ß secretion in the absence of exogenous ASC (Fig. 4A). Because ASC expression was not detected in HEK293 cells, it is unlikely that this IL-1ß secretion was mediated by endogenous ASC. Therefore, it is likely that PYNOD has ability to inhibit this response by directly binding to caspase-1 and/or IL-1ß. However, we have not succeeded in showing that PYNOD disrupted the interaction between caspase-1 and IL-1ß. Further experiments are necessary to clarify this point.
It has been hypothesized that Apaf-1-like proteins are oligomerized via their C-terminal region (WD40 repeats or LRRs) upon ligand binding, and this oligomerization then induces the proximity of downstream adapter molecules that interact with the N-terminal region (CARD or PYD) of the Apaf-1-like molecules (3). Here we found that, like the C-terminal truncation mutants of PYPAF1 and CARD12, PYNOD self-oligomerizes and interacts with ASC. However, PYNOD behaves as an inhibitor rather than an activator of ASC. The precise mechanism of this difference between PYNOD and other Apaf-1-like molecules is unclear at present. It is possible that not only the proximity of ASC proteins induced by an oligomer of an Apaf-1-like protein but also a conformational change of ASC is essential for its activation, and that PYNOD may not be able to induce the conformational change. Alternatively, PYNOD may sterically inhibit the interaction between ASC and its downstream interacting molecules.
Pyrin, the gene mutated in familial Mediterranean fever, has been shown to inhibit apoptosis and NF-
B activation induced by ASC (39, 40). Furthermore, targeted disruption of the pyrin gene in macrophages leads to the enhancement of caspase-1 activation and IL-1ß production upon LPS stimulation, and overexpression of pyrin suppresses IL-1ß production (41). Thus, PYNOD has a similar activity to pyrin. The expression plasmids for PYNOD and pyrin showed similar efficacy in the inhibition of NF-
B activation and apoptosis based on the doseresponse curves (data not shown), suggesting that these functions of PYNOD are physiologically relevant. In addition, we found here that PYNOD inhibits the PYPAF1 pathway of IL-1ß secretion. It is noteworthy that mutations in the PYPAF1 gene cause cold-induced auto-inflammatory syndrome (33). In this context, an interesting possibility is that mutation of the PYNOD gene may cause a disease similar to familial Mediterranean fever or cold-induced auto-inflammatory syndrome. On the other hand, the augmentation of PYNOD expression might be a remedy for these genetic diseases.
We found significant expression of PYNOD mRNA in all the organs we examined. High levels of PYNOD expression were found in brain, heart, and skeletal muscle. In contrast, consistent with a previous report (21), the expression of ASC in these organs is relatively low (Supplementary figure S1). Considering the inflammatory and apoptotic activity of ASC, a high expression of ASC could have deleterious effects in these organs. Therefore, PYNOD may play a protective role in ASC-mediated inflammation or apoptosis in these organs. In addition, PYNOD mRNA was detected by RTPCR analysis in all cell lines tested, including those of the lymphoid and myeloid lineages. Stimulation of K562 or Jurkat cells with PMA plus ionomycin and/or LPS enhanced their expression of PYNOD mRNA. Thus, given that Apaf-1-like proteins are intracellular pathogen receptors that activate innate immune responses, PYNOD may play a regulatory role in the innate immune system. Future studies using PYNOD-deficient mice or transgenic mice should elucidate the physiological role of PYNOD in animals.
| Supplementary data |
|---|
|
|
|---|
Supplementary data are available at International Immunology Online.
| Acknowledgements |
|---|
We thank Ms I. Hashitani for secretarial and technical assistance. This work was supported in part by Grant-in-Aid for Scientific Research from the Japanese Ministry of Education, Culture, Sports, Science and Technology.
| Abbreviations |
|---|
ASCapoptosis-associated speck-like protein containing a CARD
BidCTBid C-terminal
CARDcaspase activation and recruitment domain
DDdeath domain
DNdominant-negative mutant
EMSAelectrophoretic mobility shift assay
LRRleucine-rich repeat
PYDpyrin-like domain
NODnucleotide-binding and oligomerization domain
RLArelative luciferase activity
| References |
|---|
|
|
|---|
- Wang, L., Manji, G. A., Grenier, J. M., Al-Garawi, A., Merriam, S., Lora, J. M., Geddes, B. J., Briskin, M., DiStefano, P. S. and Bertin, J. 2002. PYPAF7, a novel PYRIN-containing Apaf1-like protein that regulates activation of NF-kappa B and caspase-1-dependent cytokine processing. J. Biol. Chem. 277:29874.
[Abstract/Free Full Text] - Harton, J. A., Linhoff, M. W., Zhang, J. and Ting, J. P. 2002. Cutting edge: CATERPILLER: a large family of mammalian genes containing CARD, pyrin, nucleotide-binding and leucine-rich repeat domains. J. Immunol. 169:4088.
[Abstract/Free Full Text] - Inohara, N. and Nunez, G. 2003. NODs: intracellular proteins involved in inflammation and apoptosis. Nat. Rev. Immunol. 3:371.[CrossRef][Web of Science][Medline]
- Tschopp, J., Martinon, F. and Burns, K. 2003. NALPs: a novel protein family involved in inflammation. Nat. Rev. Mol. Cell. Biol. 4:95.[CrossRef][Web of Science][Medline]
- Hiller, S., Kohl, A., Fiorito, F., Herrmann, T., Wider, G., Tschopp, J., Grutter, M. G. and Wuthrich, K. 2003. NMR structure of the apoptosis- and inflammation-related NALP1 pyrin domain. Structure (Camb) 11:1199.[Medline]
- Liepinsh, E., Barbals, R., Dahl, E., Sharipo, A., Staub, E. and Otting, G. 2003. The death-domain fold of the ASC PYRIN domain, presenting a basis for PYRIN/PYRIN recognition. J. Mol. Biol. 332:1155.[CrossRef][Web of Science][Medline]
- Bertin, J., Nir, W. J., Fischer, C. M., Tayber, O. V., Errada, P. R., Grant, J. R., Keilty, J. J., Gosselin, M. L., Robison, K. E., Wong, G. H., Glucksmann, M. A. and DiStefano, P. S. 1999. Human CARD4 protein is a novel CED-4/Apaf-1 cell death family member that activates NF-kappaB. J. Biol. Chem. 274:12955.
[Abstract/Free Full Text] - Inohara, N., Koseki, T., del Peso, L., Hu, Y., Yee, C., Chen, S., Carrio, R., Merino, J., Liu, D., Ni, J. and Nunez, G. 1999. Nod1, an Apaf-1-like activator of caspase-9 and nuclear factor-kappaB. J. Biol. Chem. 274:14560.
[Abstract/Free Full Text] - Ogura, Y., Inohara, N., Benito, A., Chen, F. F., Yamaoka, S. and Nunez, G. 2001. Nod2, a Nod1/Apaf-1 family member that is restricted to monocytes and activates NF-kappaB. J. Biol. Chem. 276:4812.
[Abstract/Free Full Text] - Manji, G. A., Wang, L., Geddes, B. J., Brown, M., Merriam, S., Al-Garawi, A., Mak, S., Lora, J. M., Briskin, M., Jurman, M., Cao, J., DiStefano, P. S. and Bertin, J. 2002. PYPAF1, a PYRIN-containing Apaf1-like protein that assembles with ASC and regulates activation of NF-kappa B. J. Biol. Chem. 277:11570.
[Abstract/Free Full Text] - Mach, B., Steimle, V., Martinez-Soria, E. and Reith, W. 1996. Regulation of MHC class II genes: lessons from a disease. Annu. Rev. Immunol. 14:301.[CrossRef][Web of Science][Medline]
- Chamaillard, M., Hashimoto, M., Horie, Y., Masumoto, J., Qiu, S., Saab, L., Ogura, Y., Kawasaki, A., Fukase, K., Kusumoto, S., Valvano, M. A., Foster, S. J., Mak, T. W., Nunez, G. and Inohara, N. 2003. An essential role for NOD1 in host recognition of bacterial peptidoglycan containing diaminopimelic acid. Nat. Immunol. 4:702.[CrossRef][Web of Science][Medline]
- Inohara, N., Ogura, Y., Fontalba, A., Gutierrez, O., Pons, F., Crespo, J., Fukase, K., Inamura, S., Kusumoto, S., Hashimoto, M., Foster, S. J., Moran, A. P., Fernandez-Luna, J. L. and Nunez, G. 2003. Host recognition of bacterial muramyl dipeptide mediated through NOD2. Implications for Crohns disease. J. Biol. Chem. 278:5509.
[Abstract/Free Full Text] - Girardin, S. E., Boneca, I. G., Viala, J., Chamaillard, M., Labigne, A., Thomas, G., Philpott, D. J. and Sansonetti, P. J. 2003. Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection. J. Biol. Chem. 278:8869.
[Abstract/Free Full Text] - Poyet, J. L., Srinivasula, S. M., Tnani, M., Razmara, M., Fernandes-Alnemri, T. and Alnemri, E. S. 2001. Identification of Ipaf, a human caspase-1-activating protein related to Apaf-1. J. Biol. Chem. 276:28309.
[Abstract/Free Full Text] - Grenier, J. M., Wang, L., Manji, G. A., Huang, W. J., Al-Garawi, A., Kelly, R., Carlson, A., Merriam, S., Lora, J. M., Briskin, M., DiStefano, P. S. and Bertin, J. 2002. Functional screening of five PYPAF family members identifies PYPAF5 as a novel regulator of NF-kappaB and caspase-1. FEBS Lett. 530:73.[CrossRef][Web of Science][Medline]
- Martinon, F., Burns, K. and Tschopp, J. 2002. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol. Cell 10:417.[CrossRef][Web of Science][Medline]
- Stehlik, C., Hayashi, H., Pio, F., Godzik, A. and Reed, J. C. 2003. CARD6 is a modulator of NF-kappa B activation by Nod1- and Cardiak-mediated pathways. J. Biol. Chem. 278:31941.
[Abstract/Free Full Text] - Fiorentino, L., Stehlik, C., Oliveira, V., Ariza, M. E., Godzik, A. and Reed, J. C. 2002. A novel PAAD-containing protein that modulates NF-kappa B induction by cytokines tumor necrosis factor-alpha and interleukin-1beta. J. Biol. Chem. 277:35333.
[Abstract/Free Full Text] - Srinivasula, S. M., Poyet, J. L., Razmara, M., Datta, P., Zhang, Z. and Alnemri, E. S. 2002. The PYRIN-CARD protein ASC is an activating adaptor for caspase-1. J. Biol. Chem. 277:21119.
[Abstract/Free Full Text] - Masumoto, J., Taniguchi, S., Ayukawa, K., Sarvotham, H., Kishino, T., Niikawa, N., Hidaka, E., Katsuyama, T., Higuchi, T. and Sagara, J. 1999. ASC, a novel 22-kDa protein, aggregates during apoptosis of human promyelocytic leukemia HL-60 cells. J. Biol. Chem. 274:33835.
[Abstract/Free Full Text] - Conway, K. E., McConnell, B. B., Bowring, C. E., Donald, C. D., Warren, S. T. and Vertino, P. M. 2000. TMS1, a novel proapoptotic caspase recruitment domain protein, is a target of methylation-induced gene silencing in human breast cancers. Cancer Res. 60:6236.
[Abstract/Free Full Text] - Yokoyama, T., Sagara, J., Guan, X., Masumoto, J., Takeoka, M., Komiyama, Y., Miyata, K., Higuchi, K. and Taniguchi, S. 2003. Methylation of ASC/TMS1, a proapoptotic gene responsible for activating procaspase-1, in human colorectal cancer. Cancer Lett. 202:101.[CrossRef][Web of Science][Medline]
- Guan, X., Sagara, J., Yokoyama, T., Koganehira, Y., Oguchi, M., Saida, T. and Taniguchi, S. 2003. ASC/TMS1, a caspase-1 activating adaptor, is downregulated by aberrant methylation in human melanoma. Int. J. Cancer 107:202.[CrossRef][Web of Science][Medline]
- Virmani, A., Rathi, A., Sugio, K., Sathyanarayana, U. G., Toyooka, S., Kischel, F. C., Tonk, V., Padar, A., Takahashi, T., Roth, J. A., Euhus, D. M., Minna, J. D. and Gazdar, A. F. 2003. Aberrant methylation of TMS1 in small cell, non small cell lung cancer and breast cancer. Int. J. Cancer 106:198.[CrossRef][Web of Science][Medline]
- Moriai, R., Tsuji, N., Kobayashi, D., Yagihashi, A., Namiki, Y., Takahashi, H. and Watanabe, N. 2002. A proapoptotic caspase recruitment domain protein gene, TMS1, is hypermethylated in human breast and gastric cancers. Anticancer Res. 22:4163.[Web of Science][Medline]
- Masumoto, J., Dowds, T. A., Schaner, P., Chen, F. F., Ogura, Y., Li, M., Zhu, L., Katsuyama, T., Sagara, J., Taniguchi, S., Gumucio, D. L., Nunez, G. and Inohara, N. 2003. ASC is an activating adaptor for NF-kappa B and caspase-8-dependent apoptosis. Biochem. Biophys. Res. Commun. 303:69.[CrossRef][Web of Science][Medline]
- Ohtsuka, T., Ryu, H., Minamishima, Y. A., Macip, S., Sagara, J., Nakayama, K. I., Aaronson, S. A. and Lee, S. W. 2004. ASC is a Bax adaptor and regulates the p53-Bax mitochondrial apoptosis pathway. Nat. Cell. Biol. 6:121.[CrossRef][Web of Science][Medline]
- Hampe, J., Cuthbert, A., Croucher, P. J., Mirza, M. M., Mascheretti, S., Fisher, S., Frenzel, H., King, K., Hasselmeyer, A., MacPherson, A. J., Bridger, S., van Deventer, S., Forbes, A., Nikolaus, S., Lennard-Jones, J. E., Foelsch, U. R., Krawczak, M., Lewis, C., Schreiber, S. and Mathew, C. G. 2001. Association between insertion mutation in NOD2 gene and Crohns disease in German and British populations. Lancet 357:1925.[CrossRef][Web of Science][Medline]
- Ogura, Y., Bonen, D. K., Inohara, N., Nicolae, D. L., Chen, F. F., Ramos, R., Britton, H., Moran, T., Karaliuskas, R., Duerr, R. H., Achkar, J. P., Brant, S. R., Bayless, T. M., Kirschner, B. S., Hanauer, S. B., Nunez, G. and Cho, J. H. 2001. A frameshift mutation in NOD2 associated with susceptibility to Crohns disease. Nature 411:603.[CrossRef][Medline]
- Hugot, J. P., Chamaillard, M., Zouali, H., Lesage, S., Cezard, J. P., Belaiche, J., Almer, S., Tysk, C., OMorain, C. A., Gassull, M., Binder, V., Finkel, Y., Cortot, A., Modigliani, R., Laurent-Puig, P., Gower-Rousseau, C., Macry, J., Colombel, J. F., Sahbatou, M. and Thomas, G. 2001. Association of NOD2 leucine-rich repeat variants with susceptibility to Crohns disease. Nature 411:599.[CrossRef][Medline]
- Miceli-Richard, C., Lesage, S., Rybojad, M., Prieur, A. M., Manouvrier-Hanu, S., Hafner, R., Chamaillard, M., Zouali, H., Thomas, G. and Hugot, J. P. 2001. CARD15 mutations in Blau syndrome. Nature Genet. 29:19.[CrossRef][Web of Science][Medline]
- Hoffman, H. M., Mueller, J. L., Broide, D. H., Wanderer, A. A. and Kolodner, R. D. 2001. Mutation of a new gene encoding a putative pyrin-like protein causes familial cold autoinflammatory syndrome and MuckleWells syndrome. Nature Genet. 29:301.[CrossRef][Web of Science][Medline]
- Murai, K., Murakami, H. and Nagata, S. 1998. Myeloid-specific transcriptional activation by murine myeloid zinc-finger protein 2. Proc. Natl Acad. Sci. USA 95:3461.
[Abstract/Free Full Text] - Itoh, N., Yonehara, S., Ishii, A., Yonehara, M., Mizushima, S., Sameshima, M., Hase, A., Seto, Y. and Nagata, S. 1991. The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. Cell 66:233.[CrossRef][Web of Science][Medline]
- Fukui, M., Imamura, R., Umemura, M., Kawabe, T. and Suda, T. 2003. Pathogen-associated molecular patterns sensitize macrophages to Fas ligand-induced apoptosis and IL-1beta release. J. Immunol. 171:1868.
[Abstract/Free Full Text] - Masuda, E. S., Tokumitsu, H., Tsuboi, A., Shlomai, J., Hung, P., Arai, K. and Arai, N. 1993. The granulocyte-macrophage colony-stimulating factor promoter cis-acting element CLE0 mediates induction signals in T cells and is recognized by factors related to AP1 and NFAT. Mol. Cell. Biol. 13:7399.
[Abstract/Free Full Text] - Tanaka, M., Suda, T., Takahashi, T. and Nagata, S. 1995. Expression of the functional soluble form of human Fas ligand in activated lymphocytes. EMBO J. 14:1129.[Web of Science][Medline]
- Richards, N., Schaner, P., Diaz, A., Stuckey, J., Shelden, E., Wadhwa, A. and Gumucio, D. L. 2001. Interaction between pyrin and the apoptotic speck protein (ASC) modulates ASC-induced apoptosis. J. Biol. Chem. 276:39320.
[Abstract/Free Full Text] - Dowds, T. A., Masumoto, J., Chen, F. F., Ogura, Y., Inohara, N. and Nunez, G. 2003. Regulation of cryopyrin/Pypaf1 signaling by pyrin, the familial Mediterranean fever gene product. Biochem. Biophys. Res. Commun. 302:575.[CrossRef][Web of Science][Medline]
- Chae, J. J., Komarow, H. D., Cheng, J., Wood, G., Raben, N., Liu, P. P. and Kastner, D. L. 2003. Targeted disruption of pyrin, the FMF protein, causes heightened sensitivity to endotoxin and a defect in macrophage apoptosis. Mol. Cell 11:591.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
J. J. Chae, G. Wood, K. Richard, H. Jaffe, N. T. Colburn, S. L. Masters, D. L. Gumucio, N. G. Shoham, and D. L. Kastner The familial Mediterranean fever protein, pyrin, is cleaved by caspase-1 and activates NF-{kappa}B through its N-terminal fragment Blood, September 1, 2008; 112(5): 1794 - 1803. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Wilmanski, T. Petnicki-Ocwieja, and K. S. Kobayashi NLR proteins: integral members of innate immunity and mediators of inflammatory diseases J. Leukoc. Biol., January 1, 2008; 83(1): 13 - 30. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Stehlik and A. Dorfleutner COPs and POPs: Modulators of Inflammasome Activity J. Immunol., December 15, 2007; 179(12): 7993 - 7998. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Fontalba, O. Gutierrez, and J. L. Fernandez-Luna NLRP2, an Inhibitor of the NF-{kappa}B Pathway, Is Transcriptionally Activated by NF-{kappa}B and Exhibits a Nonfunctional Allelic Variant J. Immunol., December 15, 2007; 179(12): 8519 - 8524. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. S. Sutterwala, Y. Ogura, and R. A. Flavell The inflammasome in pathogen recognition and inflammation J. Leukoc. Biol., August 1, 2007; 82(2): 259 - 264. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kinoshita, C. Kondoh, M. Hasegawa, R. Imamura, and T. Suda Fas-associated factor 1 is a negative regulator of PYRIN-containing Apaf-1-like protein 1 Int. Immunol., December 1, 2006; 18(12): 1701 - 1706. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kinoshita, Y. Wang, M. Hasegawa, R. Imamura, and T. Suda PYPAF3, a PYRIN-containing APAF-1-like Protein, Is a Feedback Regulator of Caspase-1-dependent Interleukin-1{beta} Secretion J. Biol. Chem., June 10, 2005; 280(23): 21720 - 21725. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hasegawa, R. Imamura, T. Kinoshita, N. Matsumoto, J. Masumoto, N. Inohara, and T. Suda ASC-mediated NF-{kappa}B Activation Leading to Interleukin-8 Production Requires Caspase-8 and Is Inhibited by CLARP J. Biol. Chem., April 15, 2005; 280(15): 15122 - 15130. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Stehlik and J. C. Reed The PYRIN Connection: Novel Players in Innate Immunity and Inflammation J. Exp. Med., September 7, 2004; 200(5): 551 - 558. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











