Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lillicrap, M. S.
Right arrow Articles by Gaston, J. S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lillicrap, M. S.
Right arrow Articles by Gaston, J. S. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 16, No. 3, pp. 405-414, March 2004
© 2004 Japanese Society for Immunology

T cell recognition of a highly conserved epitope in heat shock protein 60: self-tolerance maintained by TCR distinguishing between asparagine and aspartic acid

Mark S. Lillicrap1, Richard C. Duggleby1, Jane C. Goodall1 and J. S. Hill Gaston1

1 Department of Medicine, University of Cambridge, Cambridge CB2 2QQ, UK

The first two authors contributed equally to this work
Correspondence to: M. S. Lillicrap; E-mail: mark.lillicrap{at}nnuh.nhs.uk
Transmitting editor: S. H. E. Kaufmann


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cross-reactive T cell recognition of self-heat shock proteins (hsp) has been ascribed a regulatory role in inflammatory arthritis in both animal models and human disease. The previous work implies that a repertoire for epitopes in self-hsp60 should exist in normal subjects. Accordingly, we sought to generate self-hsp60-reactive T cell clones from a healthy individual using a highly purified preparation of recombinant human (Hu) hsp60. Epitope mapping using synthetic peptides and truncated constructs indicated that the T cell clones obtained actually recognized hsp60 derived from Escherichia coli. Using a series of alanine-substituted peptides and additional appropriate synthetic peptides, it was demonstrated that the clones maintain self-tolerance because of their sensitivity to an asparagine to aspartic acid sequence difference between E. coli and HuHsp60 in the epitope-containing peptide. In addition, despite substantial conservation of sequence, the homologous peptide from HuHsp60 did not compete with the E. coli-derived peptide for recognition or antagonize responses by acting as an altered peptide ligand. The results suggest that, even when the immune system targets a highly conserved epitope in bacterial hsp60, self-tolerance is maintained. Furthermore, the finding that T cell clones specific for minor contaminant proteins in HuHsp60 preparations can readily be isolated raises the possibility that the HuHsp60 facilitates presentation of antigenic proteins to the immune system.

Keywords: CD4+ T lymphocyte, chaperonin 60, epitope, human


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
T cell recognition of bacteria heat shock proteins (hsp), particularly hsp60, has been described repeatedly and it is now clear that hsp are major targets of the protective immune response to infection, particularly by intracellular pathogens (1,2). A separate body of literature has considered immune responses to hsp in the context of autoimmune disease, with both pathogenic (38) and, more recently, regulatory roles being ascribed to hsp-reactive T cells (914). The data obtained in the rat adjuvant arthritis model have pointed to the ability of T cells reactive with mycobacterial hsp60, and cross-reactive with rat hsp60, to decrease the incidence and severity of arthritis (1518). A possible regulatory role for self-hsp60-reactive T cells is evidenced by responses to human (Hu) hsp60 in juvenile idiopathic arthritis and their correlation with resolution of joint inflammation (1921). This implies that a repertoire for epitopes in self-hsp60 should exist in normal subjects. Accordingly, we sought to generate self-hsp60-reactive T cell clones from a healthy individual using a highly purified preparation of recombinant HuHsp60. In this paper, we demonstrate that the clones obtained actually recognized hsp60 derived from Escherichia coli, and maintain self-tolerance because of their sensitivity to an asparagine to aspartic acid sequence difference between E. coli and HuHsp60 in the epitope-containing peptide. The results suggest that, even when the immune system targets a highly conserved epitope in bacterial hsp60, self-tolerance is maintained and cross-reactive T cells for the epitope we have studied appear to have been deleted from the repertoire. In addition, the finding that T cell clones specific for minor contaminant proteins in HuHsp60 preparations can readily be isolated raises the possibility that the HuHsp60 facilitates presentation of antigenic proteins to the immune system.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Preparation of recombinant HuHsp60
Total RNA was purified from human peripheral blood mononuclear cells (PBMC) using a High Pure RNA isolation kit (Boehringer Mannheim, Lewes, UK) according to manufacturer’s protocol. First-strand cDNA synthesis was performed with oligo(dT) primer (Gibco/BRL, Life Technologies, Paisley, UK) and superscript reverse transcriptase (Gibco/BRL, Life Technologies). The nucleotide sequence of the mature HuHsp60 polypeptide (excluding the signal peptide) was amplified from cDNA using Taq and Pwo DNA polymerase mix (Boehringer Mannheim), and HuHsp oligonucleotide primers (sense 5'-3'GTCCATGGCCAAAGATGTAAAATTTGG; antisense 3'-5'CGAGATCTGAACATGCCACCTCCCATACC). PCR was performed using a DNA thermal cycler (Hybaid, Teddington, UK) with 30 cycles of an annealing temperature of 55°C. Denaturation was performed at 94°C for 15 s and extension at 72°C for 90 s. The PCR product was ligated into a pQE60 vector (Qiagen, Dorking, UK) as per the manufacturer’s protocol, allowing the addition of six consecutive histidines at the C-terminus of the HuHsp60 sequence. The vector was transfected into competent E. coli ultracompetent XL-2 blue cells (Stratagene, Cambridge, UK) using a heat shock method (22).

Up-regulated expression of the recombinant HuHsp60, in transfected competent cells, was induced by IPTG (Melford, Ipswich, UK) treatment of bacterial cultures in exponential growth. Soluble extracts of E. coli were obtained following disruption by sonication (3 x 2 min sonication, 100 W) using a Vibra-cell sonicator (Jencons-PLS, Leighton Buzzard, UK) and purified by a two-stage purification as previously described (23). Briefly lysates were passed through a nickel/NTA HiTrap purification column (Amersham Pharmacia Biotech, Uppsala, Sweden) prior to selective elution of the bound protein with imidazole (Sigma-Aldrich, Poole, UK). Appearance of protein in the eluate was determined by bicinchonic acid colorometric assessment (Pierce, Rockford, MD) and appropriate fractions resolved by electrophoresis using a 37-mm gel extraction apparatus (Prep Cell, Bio-Rad, Hemel Hempstead, UK) with 10% SDS–PAGE run under denaturing conditions. Samples were concentrated using a VIVASPIN 15-ml concentrator with a 30-kDa molecular mass cut-off (Vivascience, Lincoln, UK) and passed through a 0.2-µm filter (Sartorius, Goettingen, Germany) prior to use in cell culture. SDS–PAGE and immunoblot analysis using a specific anti-GroEL mAb (a kind gift from P. Lund, University of Birmingham, UK) demonstrated no detectable GroEL (the E. coli hsp60) contamination of the recombinant HuHsp60. Immunoblotting was shown to be capable of detecting 1–10 ng GroEL when tested as a single protein and 40 ng GroEL in the presence of 10 µg of HuHsp60. Endotoxin contamination was measured using the Limulus amebocyte lysate assay (E-Toxate; Sigma) and found to be <0.1 EU/µg.

Antigens and peptides
GroEL was obtained from Sigma; synthetic antigenic and alanine-substituted peptides were synthesized using Fmoc chemistry, and obtained from Alta Biosciences (Birmingham, UK).

mAb and flow cytometry
mAb to the following antigens were used: CD3 (UCHT-1), CD4 (QS4120) and CD8 (UCHT-4) hybridomas were a kind gift from P. C. L. Beverley (Jenner Institute, UK), and the HLA-DR (L243) hybridoma was a kind gift from R. Allen (University of Cambridge, UK). Antibodies were purified from hybridoma supernatants using a Protein A column and, if required, FITC conjugated (Fluoro-Tag; Sigma). Phycoerythrin-conjugated CD8 antibody was obtained from Dako (Ely, UK). TCR{alpha}ß and TCR{gamma}{delta} FITC-conjugated antibodies were obtained from Becton Dickinson (San Jose, CA). HLA-DQ- and HLA-DP-specific antibodies were obtained from PharMingen (San Diego, CA). TCRBV8 and TCRBV12 FITC-conjugated antibodies were obtained from Immunotech (Marseille, France), and the TCRBV6.7 FITC-conjugated antibody was obtained from Serotec (Kidlington, UK). For FACS analysis, aliquots of cells were taken from culture and resuspended at 4°C in PBS containing 1% BSA (Sigma) and 0.01% sodium azide (Sigma). Single- and dual-colour cell staining was performed using the mAb at pre-determined concentrations. Cells were incubated for 20 min at 4°C and washed prior to analysis. At least 10,000 events were analysed by a FACSort flow cytometer (Becton Dickinson).

Preparation and isolation of PBMC
PBMC were isolated from peripheral blood by Ficoll-Paque (Amersham Pharmacia Biotech) density centrifugation at 320 g for 30 min (Sigma; 4-10 centrifuge). Cells were harvested from the interface and washed before re-suspension in medium [RPMI 1640 (Sigma) supplemented with 2 mM L-glutamine (Sigma), 1 mM sodium pyruvate (Sigma), 5 mM HEPES buffer (Sigma), 100 U/ml penicillin (Gibco/BRL, Life Technologies), 100 µg/ml streptomycin (Gibco/BRL, Life Technologies) and 5% human male AB serum)]. If required, PBMC were irradiated (4000 or 5000 rad) in a 137Cs source irradiator (Gammacell; AECL, Ontario, Canada).

PBMC proliferation assays
PBMC were cultured in medium at a final concentration of 1 x 106 cells/ml in either 2 ml (Nalge Nunc, Naperville, IL) or 200 µl (Falcon; Becton Dickinson, Franklin Lakes, NJ) flat wells and incubated with HuHsp60 at the appropriate concentration. Proliferation, on the relevant day, was measured by the incorporation of [methyl-3H]thymidine (Amersham, Little Chalfont, UK) over the final 14 h of culture. For all proliferation assessments, 1 µCi/well of [3H]thymidine was used and samples were harvested onto printed glass fibre filter mats (Wallac, Turku, Finland) using a cell harvester (Skatron, Oslo, Norway). The filter mats were treated with scintillation fluid (OptiPhase HiSafe2; Wallac) and [3H]thymidine incorporation measured using a ß-plate counter (1205 Betaplate; Wallac).

Split-well limiting dilution assay
PBMC were stimulated in vitro by seeding cells at 40,000, 20,000, 10,000, 5000 and 2500 cells/0.2 ml U-bottomed microwell (TPP, Trasadingen, Switzerland) with 27 replicate cultures of each cell number being undertaken. Cells were stimulated by the addition of 1 x 105 autologous irradiated PBMC (4000 rad) and 10 µg/ml of the recombinant HuHsp60. On days 7, 10 and 14, fresh medium supplemented with 25 IU/ml of human rIL-2 (Chiron, Harefield, UK) was added to each well. On day 17, a split-well analysis was undertaken. Cells from each well were harvested, washed and cultured for a further 3 days with fresh autologous irradiated PBMC (4000 rad) with or without HuHsp60 at 10 µg/ml. Proliferative responses were assessed by incorporation of [3H]thymidine during the final 14 h of culture. A stimulation index (mean proliferative response in the presence of HuHsp60/mean proliferative response in the absence of HuHsp60) >3 was taken as indicative of a positive response to HuHsp60. The percentage of negative wells for each cell concentration was determined and {chi}2 minimization was used to estimate the frequency of responsive cells in the PBMC

Generation and specificity testing of T cell clones
Cells to be cloned were added to 60-microwell Nunc Terasaki plates (Nalge Nunc) at an average of 0.3 cells/well. These cells were re-stimulated with allogeneic irradiated (5000 rad) PBMC at a final concentration of 4 x 105/ml, with phytohemagglutinin (PHA; Abbot Diagnostics, Dartford, UK) 1 µg/ml and human rIL-2 at 50 IU/ml. Responsive wells were harvested at day 10 and re-stimulated in 0.2 ml wells with further irradiated allogeneic PBMC at a final concentration of 1 x 106/ml in medium supplemented with PHA 1 µg/ml and human rIL-2 50 IU/ml. Cells were fed with fresh medium and human rIL-2 (50 IU/ml final concentration) twice weekly. Cells were re-stimulated with allogeneic irradiated (5000 rad) PBMC, PHA and human rIL-2, using the above protocol, as required. The specificity of the T cell clones was assayed at least 10 days after a previous re-stimulation. T cells (2 x 104) were added, to 0.2-ml flat wells, with 1 x 105 autologous irradiated (4000 rad) PBMC and antigen at different titrations or at the optimal predetermined concentration. Assays were performed in either duplicate or triplicate and proliferative responses assessed on day 3 of culture.

Clones specific for GroEL were generated by stimulating PBMC with 10 µg/ml GroEL for 8 days, adding IL-2 (50 U/ml) on day 7. The resulting T cell line was cloned in Terasaki 20-µl cultures with autologous irradiated PBMC, IL-2 100 U/ml and 10 µg/ml GroEL peptide. The resulting clones were expanded and tested for specificity as above.

Analysis of the effects of altered peptide ligands on T cell clones
In brief, we used an adaptation of the method described by DeMagistris et al (24). In assays to examine inhibition by peptides, autologous irradiated PBMC (0.1 x 106 cells/well) were cultured in round-bottomed, 96-well microtiter plates in the presence of varying concentrations of GroEL-derived peptide 11–23 and varying concentrations of HuHsp60-derived peptide 35–50 or GroEL-derived peptide 11–23 with a single amino acid change (N21 to D21). After 18 h, a GroEL-specific T cell clone recognizing amino acids 11–23 (2 x 104 cells/well) was added and cultured for a further 48 h. [3H]Thymidine (1 µCi/well) was added for the final 6 h of incubation. The cells were then harvested and the level of proliferation assessed as described above. In assays to examine the possibility of antagonism by altered peptide ligands, autologous irradiated PBMC (0.1 x 106 cells/well) were incubated with suboptimal concentrations (0.1 µg/ml) of GroEL peptide 11–23 in round-bottomed, 96-well, microtitre plates for 2 h at 37°C. The wells were then washed, leaving peptide-pre-pulsed adherent cells. The pre-pulsed cells were incubated with varying amounts of HuHsp60 35–50 peptide or the mutated GroEL 11–23 peptide for 1 h. T cell clone (2 x 104 cells/well) was added, co-cultured for a further 72 h and [3H]thymidine incorporation over the final 6 h of incubation was measured.

PCR analysis of TCRBV rearrangements
Total RNA was purified from T cell clones using a High Pure RNA isolation kit according to the manufacturer’s protocol. First-strand cDNA synthesis was performed with oligo(dT) primer and reverse transcriptase (Boehringer Mannheim). The cDNA served as a template for PCR amplification using Taq DNA polymerase (Bioline, London, UK), a panel of forward oligonucleotide primers specific for the ß chain variable regions of the TCR (25) and one reverse ß chain constant region primer. PCR was performed using a DNA thermal cycler with 33 cycles of an annealing temperature of 60°C. Denaturation was performed at 94°C for 60 s and extension at 72°C for 60 s. The final extension step was 10 min. The amplified DNA (~300 bp) was subjected to electrophoresis in 1.5% agarose (Sigma) and stained with ethidium bromide (Sigma).

ELISA assessment of cytokine production
IL-4 and IFN-{gamma} were measured using ELISA kits purchased from Biosource (Camarillo, CA). The ELISA kits obtained from Biosource were specific for human cytokines with no cross-reactivity with other species.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Isolation of T cells responsive to recombinant Huhsp60 preparation
Our initial aim was to clone human T cells reactive with HuHsp60. Accordingly, we expressed Huhsp60 in E. coli and purified the recombinant protein in a two-stage procedure, first on a nickel column utilizing the histidine tag at the C-terminus of the protein and then on the basis of size using preparative SDS–PAGE. The resulting protein was tested by immunoblotting using a GroEL-specific mAb and found to be negative. As noted in Methods, our immunoblotting method was capable of detecting GroEL as a 0.4% contaminant of Huhsp60 (40 ng/10 µg Huhsp60), thus establishing precisely the degree of purity of the Huhsp60 preparation which was used for subsequent experiments. Accordingly, this preparation was used to stimulate PBMC from normal healthy donors. A median stimulation index of 4.2 (inter-quartile range 2.5–5.7, n = 12) was recorded on day 7 of culture. To characterize this response further, we performed split-well limiting dilution cultures using PBMC from a representative donor and measured responses to the recombinant Huhsp60 preparation on day 17 of culture. We obtained a total of 35 antigen-responsive T cell lines and estimated the frequency of antigen-responsive T cells in PBMC as 1:28,000 (95% confidence limits 1:21,000–1:37,000). T cells, from the seven T cell lines which showed the greatest proliferative responses to the Huhsp60 preparation, were then cloned at 0.3 cells/well; 28 wells (four from each of the seven lines) were randomly selected for further analysis.

Properties of T cell clones
All of the cells isolated by cloning at 0.3 cells/well were TCR{alpha}ß+, CD4+, CD8 and expressed either TCRBV6, TCRBV8 or TCRBV12, confirmed by both RT-PCR, with BV gene-specific primers and by staining with specific mAb. Of these, 9 (four TCRBV12+, three TCRBV6+ and two TCRBV8+) were shown to be clonal populations by TCRBV region analysis and were studied further. As shown in Fig. 1, the TCRBV6+ and TCRVB8+ clones each proliferated in response to the Huhsp60 preparation, but were much more responsive to E. coli hsp60, GroEL, with a 2–3 log difference in the dose–response curve; the responses were inhibited by a HLA-DP-specific mAb, but not by HLA-DR- or -DQ-specific mAb (data not shown). The TCRBV12+ clones showed similar responses to the Huhsp60 preparation, but did not respond to GroEL. However, subsequent experiments showed that the TCRBV12+ clones responded equally well to E. coli lysates which were not expressing Huhsp60, i.e. they recognize an unknown E. coli-derived contaminant of the HuHsp60 preparation (data not shown). Their properties will therefore not be described in further detail in this paper.



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 1. Proliferative responses of T cell clones expressing TCRBV8 (A) and TCRBV6 (B) to varying concentrations of purified recombinant hsp60 (black squares) and GroEL (grey squares) on day 3 of culture. Data represent the mean [3H]thymidine incorporation (c.p.m.) of duplicate cultures ± SD.

 
For the TCRBV6+ and TCRBV8+ T cell clones, the results were compatible either with the isolation of clones specific for Huhsp60, but strongly cross-reactive with GroEL, or alternatively with GroEL-specific clones generated by, and able to respond to, small quantities of GroEL in the recombinant preparation. To distinguish between these possibilities and because of the difficulties in absolutely excluding the presence of small quantities of GroEL in recombinant preparations, we elected to map the peptide recognized by the TCRBV6+ and TCRBV8+ clones.

As shown in Fig. 2(A), the use of recombinant GroEL constructs containing different deletions localized the epitope recognized by a TCRBV8+ clone to the N-terminal ~100 amino acids; similar results were obtained for a TCRBV6+ clone. Thereafter, synthetic peptides spanning this region were used to map the epitope; as shown in Fig. 2(B), the epitope recognized by both sets of clones was contained in amino acids 9–23 of the GroEL sequence. Subsequent experiments showed residues 11–23 of the GroEL sequence to be equally stimulatory. As noted above, all clones were found to be restricted by HLA-DP and the clones were derived from a DP4 homozygous donor. Thus, this peptide is presented to the T cell clones by HLA-DPA1*01/DPB1*0402.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. Proliferative responses of a TCRBV8+ T cell clone to: (A) full-length recombinant HuHsp60, GroEL and the indicated recombinant truncations of GroEL (all at 2 µg/ml), and (B) overlapping synthetic peptides spanning the first 120 amino acids of the GroEL sequence. Data represent the mean [3H]thymidine incorporation (c.p.m.) of triplicate cultures ± SD. (C) The sequence of the epitope recognized in GroEL (amino acids 11–23) is compared with the homologous sequence in HuHsp60 (amino acids 35–47).

 
Identification of residues in the 11–23 epitope critical for T cell recognition
The sequence of the epitope in GroEL is compared with the homologous region in Huhsp60 in Fig. 2(C); from this it is clear that the epitope which was mapped is located in a region where there is substantial conservation of sequence between the bacterial and human proteins with only five differing amino acids, so that cross-reactive recognition of the human peptide by the GroEL-reactive T cell clones might not be surprising. Furthermore, a recent paper (26) has analysed the amino acids required for binding to HLA-DP4, and both the GroEL peptide and the corresponding peptide from Huhsp60 retain favoured residues at the predicted P1, P4, P6 and P9 positions—three are identical in both peptides, whilst the fourth is K in GroEL and L in Huhsp60, both allowed amino acids. When synthetic peptides corresponding to the epitope region in HuHsp60 were tested, only relatively low levels of response to high concentrations of peptide were obtained, but the results were not unequivocally negative and varied from experiment to experiment. Therefore, to investigate the question of cross-reactivity definitively we determined the critical amino acids in the GroEL peptide for T cell recognition by synthesizing peptides in which each residue was substituted by alanine. As shown in Fig. 3, this allowed us to identify three residues which were absolutely required for recognition by the TCRBV6+ clone (R18, G19 and N21) and two for the TCRBV8+ clone (K15 and N21). Of these residues, only K15 (P4) is predicted to be involved in binding to DPB1*0402, so the other residues may be assumed to be those which contact the TCR. For each clone, substitution of these residues by alanine effectively abolished responses at all concentrations tested, whereas substitution of other positions altered the dose–response curve, but allowed maximal or near maximal responses to be achieved at optimal concentrations. Thus, only one residue, N21, was critical for recognition by both types of clone; of the other residues, substitution of R18 essentially abolished the response of the TCRBV6+ clone, but a response by the TCRBV8+ clone was still detectable at both 10 and 1 µg/ml. A reciprocal pattern was seen for K15 with abolition of the response by the TCRBV8+ clone and minimal effect on the response by the TCRBV6+ clone. Although K15 is predicted as an MHC-binding residue, the change from K15 to A15 may affect the ability of the TCRBV8+ clones to interact with critical TCR contact residues, whilst not affecting the residues contacted by the TCRBV6+ clones. Similarly, R18, a TCR contact residue, is predicted to interact with TCRBV6+ clones, but not TCRBV8+ clones. The other residue, G19, that affected recognition by the TCRBV6+ clone is not relevant to the question of recognition of HuHsp60, since it is conserved in the HuHsp60 sequence.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3. Proliferative responses of a TCRBV8+ (A) and TCRBV6+ (B) T cell clones to varying concentrations of a series of synthetic peptides encoding the 11–23 GroEL sequence with successive alanine substitutions at each position. Data represent the mean [3H]thymidine incorporation (c.p.m.) of triplicate cultures ± SD.

 
Testing the influence of amino acid differences between GroEL and Huhsp60 for T cell recognition
The critical asparagine (N) at position 21 in the GroEL sequence is replaced by aspartic acid (D) in Huhsp60. To test the importance of this difference we tested GroEL peptides with a single change from N21 to D21; this was sufficient to abolish recognition by either TCRBV6+ or TCRBV8+ clones, measured by both proliferation, as shown in Fig. 4, and IFN-{gamma} production (data not shown). Furthermore, as expected, this was also the case when the substitution was combined with an R18 to Q18 substitution. In contrast, the R18 to Q18 substitution alone abolished recognition only by the BV6+ clones, in keeping with the findings using alanine-substituted peptides. To test whether peptides with these substitutions might act as altered peptide ligands we also tested whether cytokines were produced in the absence of proliferative responses, but production of IFN-{gamma} exactly mirrored proliferative responses to amino acid-substituted peptides and we did not detect secretion of IL-4 in response to any peptide (data not shown).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4. Proliferative responses of TCRBV8+ (A) and TCRBV6+ (B) T cell clones to varying concentrations of a series of synthetic peptides encoding the 11–23 GroEL sequence with amino acid substitutions (as shown) at critical positions where the sequences of GroEL and HuHsp60 vary. Data represent the mean [3H]thymidine incorporation (c.p.m.) of triplicate cultures ± SD.

 
Effect of Huhsp60-derived peptides on responses to GroEL peptide
To determine whether the HuHsp60 peptide, whilst not recognized by the GroEL-reactive clones, might still be able to act as a competitor or antagonist of the response to GroEL, we tested the effects of the human peptide on responses to GroEL by a TCRBV8+ clone. When co-cultured with GroEL peptide, the human peptide failed to demonstrate significant competition even if a concentration of 50 µg/ml was employed (500 times that of the GroEL peptide) (Fig. 5A). Furthermore, no antagonistic effects were seen when antigen-presenting cells were pre-pulsed with suboptimal amounts of GroEL peptide and then co-cultured with T cells in the presence of varying concentrations of the human peptide (Fig. 5B). However, antagonistic properties were shown with the altered GroEL peptide containing the substitution N21 to D21. Neither the human peptide nor the altered GroEL peptide were able to stimulate significant proliferative responses from the TCRBV8+ clone (Fig. 4A and 5C) or the TCRBV6+ clone (Fig. 4B).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5. Effect of HuHsp60-derived peptide 35–50 on responses by TCRBV8+ T GroEL-specific T cell clones to the 11–23 GroEL peptide. (A) Competition assay: responses to antigen-presenting cells co-cultured with 0.1 µg/ml GroEL peptide (suboptimal concentration) and varying concentrations of either the HuHsp60-derived peptide 35–50 (filled diamonds) or 11–23 GroEL peptide containing an N21 to D21 substitution (open squares). The insert shows the response to varying concentrations of the 11–23 GroEL peptide. Note that the two competition experiments were performed on separate occasions. (B) Antagonism assay: responses to antigen-presenting cells pre-pulsed with 0.1 µg/ml GroEL peptide (suboptimal concentration), washed and co-cultured with varying concentrations of either the HuHsp60-derived peptide 35–50 (filled diamonds) or 11–23 GroEL peptide containing an N21 to D21 substitution (open squares). (C) Responses to antigen-presenting cells pre-pulsed with varying concentrations of the 11–23 GroEL peptide (filled triangles) and to antigen-presenting cells co-cultured with HuHsp60-derived peptide 35–50 (crosses) or 11–23 GroEL peptide containing an N21 to D21 substitution (open squares). Results shown are mean of triplicate cultures ± SD.

 
Thus, we concluded that the clones which we isolated were indeed GroEL-specific, and that, despite recognizing an epitope which is highly conserved in Huhsp60, they maintained self-tolerance primarily by distinguishing a single amino acid difference between the bacterial and self-epitopes (N and D at position 21). To extend these observations we stimulated PBMC from the same donor with GroEL and generated a series of T cell lines by stimulation with the 9–23 GroEL peptide. None of these lines showed any response to the homologous Huhsp60-derived peptide, suggesting that a lack of cross-reactivity was a general finding and not simply a property of the particular clones used to map the epitope (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In this paper we attempted to generate T cell clones specific for HuHsp60 by using a highly purified preparation of recombinant hsp60. When a number of the clones were found to preferentially recognize GroEL, we characterized these clones in detail in order to address definitely the question of whether they also recognize Huhsp60 and thus break self-tolerance. By mapping the epitope recognized and the role of particular amino acids in T cell recognition, we have shown conclusively that these clones are GroEL specific. Despite recognizing an epitope in a conserved portion of hsp60, they avoid cross-reactivity with self, primarily by an ability to distinguish between an asparagine residue in GroEL and aspartic acid in the self-protein. The experiments do not demonstrate whether the failure to recognize the HuHsp60-derived peptide is due to an effect of the N to D change on binding to MHC or on interactions with the TCR. However, the competition assay suggests that the binding of the HuHsp60-derived peptide to MHC is of relatively low affinity, since inhibition was not seen. However, the N21 to D21 change of itself cannot abolish binding to MHC since the GroEL peptide containing this single change was capable of antagonizing the response to GroEL and antagonism requires MHC binding. The importance of such single amino acid changes for T cell recognition has been highlighted in previous studies; asparagine is one of the amino acids which can undergo post-translational modification by deamidation to produce aspartic acid (27). This change has been shown to be critical in the recognition of gliadin by T cells from patients with coeliac disease and the transglutaminase, which carries out the deamidation, becomes the target of an autoantibody response in this disease (2830). However, in the present case, asparagine is the critical residue in GroEL; whilst this could be deamidated to abolish recognition of the GroEL epitope, aspartic acid in HuHsp60 cannot be modified to asparagine (i.e. amidation) to allow recognition by the GroEL-specific T cells.

This study does not demonstrate that the T cell repertoire cannot contain self-hsp60-reactive clones; indeed, polyclonal responses to HuHsp60 preparations have been previously reported by our laboratory and others (19,21,23,31). However, it is striking that, when stimulated with normal concentrations of HuHsp60, the T cells obtained turned out to be specific for a bacterial hsp60 present in very small quantities—the maximum concentration of GroEL which could have been present in the HuHsp60 preparation was certainly <40 ng/ml. Since we purified the Huhsp60 on the basis of size by preparative SDS–PAGE it is unlikely that it was contaminated by partial-length GroEL molecules which were no longer reactive with the GroEL-specific mAb used for immunoblotting, but we cannot exclude the possibility that a GroEL-derived peptide remained bound to HuHsp60 during the purification process. Peptides remaining bound to hsp during purification have been repeatedly demonstrated for hsp70 and the hsp90 family member, gp96 (3236). A similar transport mechanism could account for the TCRBV12+ clones which we isolated recognizing another, as yet unidentified, E. coli antigen. Antigenic peptides covalently linked to hsp60 have also been shown to be strongly immunogenic (37), albeit in producing responses by class I MHC-restricted CD8+ T cells rather than CD4+ T cells. It is also possible that trace amounts of GroEL peptide, in our system, are chaperoned by the HuHsp60, facilitating their uptake and presentation by class II MHC.

The question of self-tolerance towards hsp, particularly hsp60, has been discussed extensively. Originally, when hsp60 was found to be a frequent target of the immune response to a wide range of pathogens, and the conservation of sequence between bacterial and HuHsp60 was noted, it was attractive to postulate that bacterial infection might break self-tolerance to hsp60 and be an initiating factor in autoimmune disease (5,38). Examples of mycobacterial hsp60-specific clones with the ability to recognize peptides conserved in HuHsp60 were reported (38,39), but these responses were sometimes relatively weak and additional studies to confirm conservation of the critical amino acids for recognition in HuHsp60 were not undertaken, so that effects due to minor contaminants of the peptide preparations cannot be discounted. In addition, recognition of intact HuHsp60 was not demonstrated in many of these studies, although responses to heat-shocked autologous antigen-presenting cells were sometimes interpreted as indicating the ability to recognize self-hsp60 (40). Interestingly, many of these studies were carried out using patients with inflammatory disease (e.g. Yersinia-induced reactive arthritis or tuberculosis) and it remains a possibility that self-hsp60-reactive T cells with immunoregulatory properties are only present at sufficient frequency for isolation in vitro in subjects with active inflammation rather than the healthy donors used in our studies.

However, subsequent observations, particularly in the rat adjuvant arthritis model, raised the possibility that self-hsp60-reactive T cells might serve a regulatory role and explain the universal observation that immunization with bacterial hsp60 leads to protection from the induction of arthritis by a variety of stimuli. Indeed, Anderton et al. showed that immunization with mycobacterial hsp60 could give rise to T cells with the ability to respond to a peptide conserved in rat hsp60 and these T cells could transfer protection from susceptibility to adjuvant arthritis (17). Interestingly, such protection could not be generated by immunization with rat hsp60. Similar data have been presented with respect to hsp70 (41).

In human disease T cell responses to HuHsp60 have been recorded and associated with an improved prognosis in juvenile idiopathic arthritis (1921). Whilst this idea would be consistent with the data in rat adjuvant arthritis, implying a regulatory role for self-hsp60-specific T cells, these responses have yet to be characterized at a clonal level to determine whether the responses recorded in PBMC from such patients are genuinely directed towards self-hsp60 or to GroEL, or another immunogenic E. coli protein which could contaminate recombinant preparations of HuHsp60. Responses to GroEL are not surprising in human subjects since, although E. coli is not generally pathogenic, hsp60 from other gastrointestinal pathogens (such as Salmonella) are nearly identical in sequence. Our study highlights the need to characterize apparent responses to self-hsp60 in detail because of the immunogenicity of bacterial hsp and the possible role of hsp60 in enhancing responses to bacterial proteins present in trace amounts.


    Acknowledgements
 
We would like to thank the Wellcome Trust, the Arthritis and Rheumatism Council, and The Raymond and Beverley Sackler Trust for their support of this work.


    Abbreviations
 
HuHsp60—human hsp

hsp—heat shock protein

PBMC—peripheral blood mononuclear cell


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Shinnick, T. 1991. Heat shock proteins as antigens of bacterial and parasitic pathogens. Curr. Top. Microbiol. Immunol. 167:145.[Web of Science][Medline]
  2. Kaufmann, S., Schoel, B., Van, E. J., Koga, T., Wand-Wurttenberger, A., Munk, M. and Steinhoff, U. 1991. Heat shock protein 60: implications for pathogenesis of and protection against bacterial infections. Immunol. Rev. 121:67.[CrossRef][Web of Science][Medline]
  3. van Eden, W., Thole, J., van der Zee, R., Noordzij, A., van Embden, J., Hensen, E. and Cohen, I. 1988. Cloning of the mycobacterial epitope recognized by T lymphocytes in adjuvant arthritis. Nature 331:171.[CrossRef][Medline]
  4. Lamb, J., Bal, V., Mendez, S. P., Mehlert, A., So, A., Rothbard, J., Jindal, S., Young, R. and Young, D. 1989. Stress proteins may provide a link between the immune response to infection and autoimmunity. Int. Immunol. 1:191.[Abstract/Free Full Text]
  5. Munk, M., Schoel, B., Modrow, S., Karr, R., Young, R. and Kaufmann, S. 1989. T lymphocytes from healthy individuals with specificity to self epitopes shared by the mycobacterial and human 65 kilodalton heat shock protein. J. Immunol. 143:2844.[Abstract]
  6. Gaston, J. S. H., Life, P. F., Jenner, P. J., Colston, M. J. and Bacon, P. A. 1990. Recognition of a mycobacteria specific epitope in the 65 kD heat shock protein by synovial fluid derived T cell clones. J. Exp. Med. 171:831.[Abstract/Free Full Text]
  7. Gaston, J. 1991. Heat shock proteins and autoimmunity. Semin. Immunol. 3:35.[Medline]
  8. Res, P., Thole, J. and de Vries, R. 1991. Heat shock proteins and autoimmunity in humans. Semin. Immunopathol. 13:81.[CrossRef][Web of Science][Medline]
  9. van den Broek, M., Hogervorst, E., van Bruggen, M., van Eden, W., van der Zee, R. and van den Berg, W. 1989. Protection against streptococcal cell wall induced arthritis by pretreatment with the 65 kD mycobacterial heat shock protein. J. Exp. Med. 170:449.[Abstract/Free Full Text]
  10. Billingham, M., Carney, S., Butler, R. and Colston, M. 1990. A mycobacterial 65 kD heat shock protein induces antigen specific suppression of adjuvant arthritis, but is not itself arthritogenic. J. Exp. Med. 171:339.[Abstract/Free Full Text]
  11. Elias, D. and Cohen, I. R. 1995. Treatment of autoimmune diabetes and insulitis in NOD mice with heat shock protein 60 peptide p277. Diabetes 44:1132.[Abstract]
  12. Beech, J. T., Siew, L. K., Ghoraishian, M., Stasiuk, L. M., Elson, C. J. and Thompson, S. J. 1997. CD4+ Th2 cells specific for mycobacterial 65-kilodalton heat shock protein protect against pristane-induced arthritis. J. Immunol. 159:3692.[Abstract]
  13. Gaston, J. S. H. 1997. Heat shock proteins and arthritis—new readers start here. Autoimmunity 26:33.[Web of Science][Medline]
  14. Quintana, F. J., Carmi, P. and Cohen, I. R. 2002. DNA vaccination with heat shock protein 60 inhibits cyclophosphamide-accelerated diabetes. J. Immunol. 169:6030.[Abstract/Free Full Text]
  15. Anderton, S. M., van der Zee, R. and Goodacre, J. A. 1993. Inflammation activates self hsp60-specific T-cells. Eur. J. Immunol. 23:33.[Web of Science][Medline]
  16. Anderton, S. M., van der Zee, R., Noordzij, A. and van Eden, W. 1994. Differential mycobacterial 65-kDa heat shock protein T cell epitope recognition after adjuvant arthritis-inducing or protective immunization protocols. J. Immunol. 152:3656.[Abstract]
  17. Anderton, S. M., van der Zee, R., Prakken, B., Noordzij, A. and van Eden, W. 1995. Activation of T cells recognizing self 60-kD heat shock protein can protect against experimental arthritis. J. Exp. Med. 181:943.[Abstract/Free Full Text]
  18. Lopezguerrero, J. A., Ortiz, M. A., Paez, E., Bernabeu, C. and Lopezbote, J. P. 1994. Therapeutic effect of recombinant vaccinia virus expressing the 60-kd heat-shock protein on adjuvant arthritis. Arthritis Rheum. 37:1462.[Web of Science][Medline]
  19. de Graeff Meeder, E., van der Zee, R., Rijkers, G., Schuurman, H., Kuis, W., Bijlsma, J., Zegers, B. and van Eden, W. 1991. Recognition of human 60 kD heat shock protein by mononuclear cells from patients with juvenile chronic arthritis. Lancet 337:1368.[CrossRef][Web of Science][Medline]
  20. de Graeff Meeder, E. R., van Eden, W., Rijkers, G. T., Prakken, B. J., Kuis, W., Voorhorstogink, M. M., van der Zee, R., Schuurman, H. J., Helders, P. J. M. and Zegers, B. J. M. 1995. Juvenile chronic arthritis: T cell reactivity to human HSP60 in patients with a favorable course of arthritis. J. Clin. Invest. 95:934.[Web of Science][Medline]
  21. Prakken, A., van Eden, W., Rijkers, G., Kuis, W., Toebes, E., de Graff Meeder, E., van der Zee, R. and Zegers, B. 1996. Autoreactivity to human heat shock protein 60 predicts disease remission in oligoarticular juvenile rheumatoid arthritis. Arthritis Rheum. 39:1826.[Web of Science][Medline]
  22. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. M., Seidman, S. G., Smith, J. A. and Struhl, K. 1995. Current Protocols in Molecular Biology. Wiley, Boston, MA.
  23. Ramage, J. M., Young, J. L., Goodall, J. C. and Gaston, J. S. H. 1999. T cell responses to heat-shock protein 60: Differential responses by CD4+ T cell subsets according to their expression of CD45 isotypes. J. Immunol. 162:704.[Abstract/Free Full Text]
  24. De Magistris, M. T., Alexander, J., Coggeshall, M., Altman, A., Gaeta, F. C., Grey, H. M. and Sette, A. 1992. Antigen analog–major histocompatibility complexes act as antagonists of the T cell receptor. Cell 68:625.[CrossRef][Web of Science][Medline]
  25. Henwood, J., Goodall, J. C., Boylston, A. W. and Gaston, J. S. H. 1995. Identification of the epitope recognized by the human V beta 5-specific monoclonal antibody 42/1C1—potential implications for disease therapy. Hum. Immunol. 42:301.[CrossRef][Web of Science][Medline]
  26. Castelli, F. A., Buhot, C., Sanson, A., Zarour, H., Pouvelle Moratille, S., Nonn, C., Gahery Segard, H., Guillet, J. G., Menez, A., Georges, B. and Maillere, B. 2002. HLA-DP4, the most frequent HLA II molecule, defines a new supertype of peptide-binding specificity. J. Immunol. 169:6928.[Abstract/Free Full Text]
  27. McAdam, S. N., Fleckenstein, B., Rasmussen, I. B., Schmid, D. G., Sandlie, I., Bogen, B., Viner, N. J. and Sollid, L. M. 2001. T cell recognition of the dominant I-Ak-restricted hen egg lysozyme epitope: critical role for asparagine deamidation. J. Exp. Med. 193:1239.[Abstract/Free Full Text]
  28. Molberg, O., McAdam, S. N., Korner, R., Quarsten, H., Kristiansen, C., Madsen, L., Fugger, L., Scott, H., Noren, O., Roepstorff, P., Lundin, K. E. A., Sjostrom, H. and Sollid, L. M. 1998. Tissue transglutaminase selectively modifies gliadin peptides that are recognized by gut-derived T cells in celiac disease. Nat. Med. 4:713.[CrossRef][Web of Science][Medline]
  29. Arentzhansen, H., Korner, R., Molberg, O., Quarsten, H., Vader, W., Kooy, Y. M. C., Lundin, K. E. A., Koning, F., Roepstorff, P., Sollid, L. M. and McAdam, S. N. 2000. The intestinal T cell response to alpha-gliadin in adult celiac disease is focused on a single deamidated glutamine targeted by tissue transglutaminase. J. Exp. Med. 191:603.[Abstract/Free Full Text]
  30. Anderson, R. P., Degano, P., Godkin, A. J., Jewell, D. P. and Hill, A. V. S. 2000. In vivo antigen challenge in celiac disease identifies a single transglutaminase-modified peptide as the dominant A-gliadin T-cell epitope. Nat. Med. 6:337.[CrossRef][Web of Science][Medline]
  31. Macht, L. M., Elson, C. J., Kirwan, J. R., Gaston, J. S. H., Lamont, A. G., Thompson, J. M. and Thompson, S. J. 2000. Relationship between disease severity and responses by blood mononuclear cells from patients with rheumatoid arthritis to human heat-shock protein 60. Immunology 99:208.[CrossRef][Web of Science][Medline]
  32. Suto, R. and Srivastava, P. K. 1995. A mechanism for the specific immunogenicity of heat shock protein-chaperoned peptides. Science 269:1585.[Abstract/Free Full Text]
  33. Blachere, N. E., Li, Z. H., Chandawarkar, R. Y., Suto, R., Jaikaria, N. S., Basu, S., Udono, H. and Srivastava, P. K. 1997. Heat shock protein-peptide complexes, reconstituted in vitro, elicit peptide-specific cytotoxic T lymphocyte response and tumor immunity. J. Exp. Med. 186:1315.[Abstract/Free Full Text]
  34. Chandawarkar, R. Y., Wagh, M. S. and Srivastava, P. K. 1999. The dual nature of specific immunological activity of tumor-derived gp96 preparations. J. Exp. Med. 189:1437.[Abstract/Free Full Text]
  35. Srivastava, P. K., Menoret, A., Basu, S., Binder, R. J. and McQuade, K. L. 1998. Heat shock proteins come of age: primitive functions acquire new roles in an adaptive world. Immunity 8:657.[CrossRef][Web of Science][Medline]
  36. Huang, Q., Richmond, J. F. L., Suzue, K., Eisen, H. N. and Young, R. A. 2000. In vivo cytotoxic T lymphocyte elicitation by mycobacterial heat shock protein 70 fusion proteins maps to a discrete domain and is CD4+ T cell independent. J. Exp. Med. 191:403.[Abstract/Free Full Text]
  37. Cho, B. K., Palliser, D., Guillen, E., Wisniewski, J., Young, R. A., Chen, J. Z. and Eisen, H. N. 2000. A proposed mechanism for the induction of cytotoxic T lymphocyte production by heat shock fusion proteins. Immunity 12:263.[CrossRef][Web of Science][Medline]
  38. Lamb, J. and Young, D. 1990. T cell recognition of stress proteins. A link between infectious and autoimmune disease. Mol. Biol. Med. 7:311.[Web of Science][Medline]
  39. Quayle, A. J., Black, W. K., Li, S. G., Kjeldson-Kragh, J., Oftung, F., Sioud, M., Forre, O., Capra, D. and Natvig, J. B. 1992. Peptide recognition, T cell receptor usage and HLA restriction of human heat-shock protein 60 and mycobacterial 65-kDa hsp-reactive T cell clones from rheumatoid synovial fluid. Eur. J. Immunol. 22:1315.[Web of Science][Medline]
  40. Hermann, E., Lohse, A. W., van der Zee, R., van Eden, W., Mayet, W. J., Probst, P., Poralla, T., Meyer zum Buschenfelde, K. H. and Fleischer, B. 1991. Synovial fluid derived Yersinia reactive T cells responding to human 65 kDa heat shock protein and heat stressed antigen presenting cells. Eur J. Immunol. 21:2139.
  41. Wendling, U., Paul, L., Vanderzee, R., Prakken, B., Singh, M. and Vaneden, W. 2000. A conserved mycobacterial heat shock protein (HSP) 70 sequence prevents adjuvant arthritis upon nasal administration and induces IL-10-producing T cells that cross-react with the mammalian self-HSP70 homologue. J. Immunol. 164:2711.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lillicrap, M. S.
Right arrow Articles by Gaston, J. S. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lillicrap, M. S.
Right arrow Articles by Gaston, J. S. H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?