Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Illés, Z.
Right arrow Articles by Yamamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Illés, Z.
Right arrow Articles by Yamamura, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 16, No. 2, pp. 223-230, February 2004
© 2004 Japanese Society for Immunology

Accumulation of V{alpha}7.2–J{alpha}33 invariant T cells in human autoimmune inflammatory lesions in the nervous system

Zsolt Illés1, Michio Shimamura2, Jia Newcombe3, Nobuyuki Oka4 and Takashi Yamamura1

1 Department of Immunology, National Institute of Neuroscience, National Center of Neurology and Psychiatry, 4-1-1 Ogawahigashi, Kodaira, Tokyo 187-8502, Japan 2 Laboratory of Developmental Immunology, Mitsubishi Kagaku Institute of Life Sciences, Tokyo 194-8511, Japan 3 NeuroResource, Institute of Neurology, London WC1N 1PJ, UK 4 Department of Neurology, Faculty of Medicine, Kyoto University, Kyoto 606-8507, Japan

Correspondence to: T. Yamamura; E-mail: yamamura{at}ncnp.go.jp
Transmitting editor: L. Steinman


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
T cells expressing an invariant TCR {alpha} chain and NK cell markers are expected to exhibit unique functions. Whereas much attention has been paid to CD1d-restricted NKT cells, a second NKT cell population bearing an invariant AV19–AJ33 TCR has recently been identified in mice and humans. Selection and/or expansion of this population require B cells, and would involve a non-classical class I-related molecule MR1. Although their preferential distribution in the gut mucosa indicates their role in the host response at the site of pathogen entry, it remains unknown whether they play an alternative role at different sites or in immunological disorders. Using single-strand conformation polymorphism clonotype analysis, we investigated the presence of the human AV19–AJ33 T cells (V{alpha}7.2–J{alpha}33 T cells) in autopsy samples from multiple sclerosis (MS) patients as well as in nerve biopsy samples from chronic inflammatory demyelinating polyneuropathy (CIDP) patients. Here we report that the V{alpha}7.2–J{alpha}33 T cells are accumulated in some of the central nervous system lesions of MS and in the majority of the peripheral nerve samples from CIDP. We have previously revealed that CD1d-restricted, V{alpha}24–J{alpha}Q NKT cells are remarkably reduced in the peripheral blood from MS. However, V{alpha}7.2–J{alpha}33 T cells are not reduced in the peripheral blood from MS and could be detected in a large majority of the cerebrospinal fluid samples obtained during relapse of MS. The present results indicate that the V{alpha}7.2–J{alpha}33 T cells are involved in the autoimmune inflammatory lesions.

Keywords: chronic inflammatory demyelinating polyneuropathy, invariant V{alpha}7.2–J{alpha}33 T cell, multiple sclerosis, NKT cell, single-strand conformation polymorphism


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Conventional T cells display a wide and diverse repertoire with regard to TCR that are made by random recombination of V, D and J segments as well as junctional deletion and insertion of nucleotides. In addition to these mainstream T cells that have undergone thymic selection for cognate peptides bound to MHC molecules, there also exist discrete ‘invariant’ lymphocyte populations, characterized by limited repertoire diversity due to their expression of an invariant receptor chain (1). The most well-characterized ‘invariant’ T cells are CD1d-rectricted NKT cells, which constitute a major component of lymphocyte populations expressing TCR and NK cell markers. The NKT cells are reactive to glycolipid presented by CD1d molecules and express an invariant TCR {alpha} chain paired with particular Vß segments [V{alpha}24–J{alpha}Q {alpha} chain paired with Vß11 in humans; V{alpha}14–J{alpha}281 with Vß8.2 and 7 in rodents] (24). Although the natural ligand for the CD1d-restricted NKT cells still remains unknown, they could produce large amounts of cytokines shortly after TCR ligation, allowing us to speculate that they play a critical role in regulation of various immune responses that would maintain the state of health or cause damage to self-tissues.

Several lines of evidence indicate that the T cell repertoire in humans contains ‘invariant’ T cells distinct from CD1d-restricted NKT cells (2,57). It has recently been proposed that T cells expressing an invariant AV19–AJ33 TCR (the canonical hV{alpha}7.2–J{alpha}33 or mV{alpha}19–J{alpha}33 TCR rearrangement) represent a second ‘invariant’ T cell subset that would develop in the absence of CD1d (811). Independent studies by Lantz et al. (8,11) and Shimamura et al. (9,10) have shown that the V{alpha}19–J{alpha}33 T cells do not require CD1d for their development and expansion in vivo. They are present in TAP-1 knockout mice (8), but are absent in ß2-microglobulin-deficient mice (8,9), suggesting that they probably recognize a non-peptide antigen associated with a non-classical MHC class Ib molecule other than CD1d. Although surface phenotypes of the invariant T cells remain to be fully characterized, the V{alpha}19–J{alpha}33 T cells were enriched in the NK1.1+CD3+ population isolated from CD1d-deficient mice (9), allowing us to refer to the ‘invariant’ T cells as a second type of NKT cells. Very recently, Lantz et al. (11) have reported that the ‘invariant’ T cells are enriched in the gut lamina propria, and that their selection and/or expansion require B cells and commensal flora. The distribution of the cell population would indicate that the novel ‘invariant’ T cells are possibly involved in the host response at the site of pathogen entry. Finally, MR1, a non-classical class I-related molecule (12), has been identified as a restriction element involved in the selection of the V{alpha}19–J{alpha}33 T cells.

It is of note that the novel MR1-restricted NKT cells share several characteristics with CD1d-resticted NKT cells. For example, both of the ‘invariant’ populations can be detected in unrelated individuals with different ethnic backgrounds and a majority of the cells resides in the CD4CD8 T cell population (7,8). As noted, the TCR {alpha} chain represents the canonical V{alpha}–J{alpha} rearrangement, whereas the ß chain sequence is restricted by the use of particular Vß segments (hVß11 for CD1d-restricted NKT cells and hVß2 and 13 for MR1-restricted T cells). Both of the ‘invariant’ populations have a ‘natural’ memory phenotype (CD44high). Furthermore, the invariant TCR sequences as well as their restriction elements (CD1d and MR1) are highly conserved across the species. These characteristics are consistent with the idea that the ‘invariant’ lymphocyte populations might exert an immediate response against phylogenetically conserved antigens at the frontier between innate and adaptive immunity (1). In accordance with this idea, CD1d-restricted NKT cells produce large amounts of IL-4 and IFN-{gamma} within hours of TCR engagement (3,1315). Through the explosive release of cytokines and chemokines, they are capable of initiating a cascade of immunological events involved in regulation of autoimmunity and vital defense against microbial agents or tumor cells (1). In contrast, very little is known about the function of the MR1-resricted T cells. Although accumulating data indicate that they may promptly respond to antigen by producing IL-4 (Shimamura et al., unpublished observations), their ability to produce cytokines and chemokines needs to be systematically analyzed in the coming years.

A numerical reduction or functional alterations in CD1d-rectricted NKT cells bearing the V{alpha}24–J{alpha}Q invariant chain have been documented in various human autoimmune diseases (3,4). Using three different approaches, the RT-PCR single-strand conformation polymorphism (SSCP) clonotype method (16), anti-V{alpha}24 and anti-Vß11 antibodies, and glycolipid-loaded CD1d tetramers (17), we have recently revealed that the V{alpha}24–J{alpha}Q NKT cells are greatly reduced in number in the peripheral blood of multiple sclerosis (MS), a putative autoimmune disease mediated by Th1 autoimmune T cells (18,19). We also examined the distribution of the V{alpha}24–J{alpha}Q NKT cells in the central nervous system (CNS) lesions from patients with MS as well as in the peripheral nerve biopsy samples derived from chronic inflammatory demyelinating polyneuropathy (CIDP) patients (16). Although expression of non-invariant V{alpha}24 rearrangement was ubiquitous in the CNS samples of MS, the V{alpha}24–J{alpha}Q clonotype specific for the NKT cells appeared to be missing in most of the CNS lesions. In contrast, the NKT cell clonotype could be readily detected in a large majority of the biopsy samples of CIDP, which is a chronic demyelinating disease of the peripheral nervous system (PNS) with a presumed autoimmune origin (20).

Using the same samples previously analyzed for the V{alpha}24–J{alpha}Q NKT cells (16), we conducted experiments to address the following questions. (i) Are the invariant V{alpha}7.2–J{alpha}33 T cells reduced in the peripheral blood of MS? (ii) Are they involved in the inflammatory lesions of MS and CIDP or could they be missing from the lesions? (iii) Are they present in the cerebrospinal fluid (CSF) derived from MS? Here, we report that unlike the V{alpha}24–J{alpha}Q NKT cells, the V{alpha}7.2–J{alpha}33 T cells are not reduced in the peripheral blood of MS. More strikingly, they were detected in some of the pathological samples obtained from MS and in the majority of nerve biopsy samples from CIDP, and could be detected in the CSF samples from MS. Comparison with other T cell populations indicated a selective accumulation of the V{alpha}7.2–J{alpha}33 T cells in the inflammatory lesions. We propose that the invariant V{alpha}7.2–J{alpha}33 T cells do not only play a role in protection against pathogen entry in the gut (11), but also in the regulation of autoimmune tissue inflammation.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Selection of patients with MS or CIDP
We obtained peripheral blood and CSF from patients with ‘definite MS’ according to the diagnostic criteria proposed by Poser et al. (21). The diagnosis of MS was further assisted by magnetic resonance imaging and evoked responses. All patients had remitting-relapsing MS and did not receive immunosuppressive agents at the time of investigation. Diagnosis of CIDP was based on the criteria of the American Academy of Neurology (22).

Peripheral blood mononuclear cells (PBMC), CSF, CNS and PNS samples
Heparinized blood (20 ml) was taken and PBMC were isolated by Ficoll density gradient centrifugation. CSF samples were obtained within 1 week after the onset of exacerbation. The sural nerve biopsy samples were taken for other diagnostic purposes with standard procedure (23). Samples were snap-frozen and were stored at –70°C along with frozen brain samples until analysis had been performed. The histopathological characterization of the MS plaques was performed as described previously (24).

Isolation of mRNA and synthesis of cDNA
mRNAs were isolated from 107 PBMC and from CSF sediment using the QuickPrep Micro mRNA purification kit (Amersham-Pharmacia Biotech, Uppsala, Sweden). The air-dried pellet was resuspended in 20 µl of RNase-Free Water and used for cDNA synthesis by the First-Strand cDNA synthesis kit (Amersham-Pharmacia Biotech, Uppsala, Sweden) using oligo-dT as primer. The mRNAs previously isolated from autopsy CNS samples and sural nerve biopsy samples (16) were also converted to cDNA by the same approach.

SSCP analysis
We conducted RT-PCR SSCP following amplification with V{alpha} and C{alpha} primers as described previously (16,25). Primers and probes were designed based on the previously published sequences (2,3,5,8,26). To detect the V{alpha}7.2–J{alpha}33 invariant chain, 1 µl of the diluted cDNA was used for each PCR reaction with V{alpha}7.2-specific sense primer (GTCGGTCTAAAGGGTA CAGT) and anti-sense C{alpha}-specific primer (CAGCTGAGAG ACTCTAAAT). cDNAs obtained from PBMC samples were amplified by PCR for 39 cycles, while cDNAs from autopsy/biopsy samples and CSF were amplified for 40 cycles. Quantities of 0.2 µg of sense and 0.2 µg of anti-sense primers (30 pmol) were added to 50-µl reactions containing 5 µl of 10 x ExTaqBuffer, dNTPs and 2.5 U of ExTaq DNA polymerase (Takara, Tokyo, Japan). Amplified DNAs were diluted (1:3) and heat-denatured. Aliquots of 4 µl of the diluted samples were electrophoresed in non-denaturing 4% polyacrylamide gel. DNAs were transferred to Immobilon-S (Millipore Intertech, Bedford, MA) and hybridized with biotinylated C{alpha}-specific (AAATATCCAGAACCCTGACCCTGCCGTGTACC), J{alpha}33-specific (TATCAGTTAATCTGGGGCGCTGGGACCAA GCT) or invariant V{alpha}7.2–J{alpha}33-specific internal probe (TGTGC TGTGAGAGATAGCAACTATCAGTTAATCTG). To detect the V{alpha}24–J{alpha}Q invariant chain, cDNAs were PCR amplified with V{alpha}24-specific sense primer (ACACAAAGTCGAACGGAAG) and C{alpha}-specific anti-sense primer (GATTTAGAGTCTCTCA GCTG), and then hybridized with a probe specific for the invariant V{alpha}24–J{alpha}Q sequence (TGTGTGGTGAGCGACAGAG GCTCAACCCTG) as previously described (16).

SSCP clonotypes were visualized by incubation with streptavidin, biotinylated alkaline phosphatase and a chemiluminescent substrate system (Phototope; New England Biolabs, Bedford, MA). cDNAs for human IL-4 and IFN-{gamma} were amplified by RT-PCR as described previously (16).

Real-time V{alpha}7.2 clonotypic RT-PCR
Quantitative RT-PCR (LightCycler; Roche Molecular Bio chemicals, Mannheim, Germany) was performed with the V{alpha}7.2 sense primer and with an anti-sense primer matching the CDR3{alpha} region of the V{alpha}7.2–J{alpha}33 T cells (TGATAGTTG CTATCTCTCAC). An aliquot of 1 µl of the cDNA was amplified by PCR for 40 cycles using quantification with a commercial kit (LightCycler DNA Master SYBR Green I; Roche Molecular Biochemicals). Quantities of 0.2 µg of sense and 0.2 µg of anti-sense primers (30 pmol) were added to 50-µl reactions containing 5 µl of 10 x ExTaqBuffer, dNTPs and 2.5 U of ExTaq DNA polymerase (Takara). All PCR reactions were controlled by ß-actin expression (sense primer: AGAGA TGGCCACGGCTGCTT; anti-sense primer: ATTTGCGGTGG ACGATGGAG) (27). Based on the standard values of control samples, the relative expression for each sample was determined with the LightCycler software.

TCR DNA sequencing
In brief, small areas of the SSCP gel corresponding to the clonotypes of interest were cut out and DNAs were eluted as described previously (25). A second PCR was performed with the corresponding V{alpha}-specific and C{alpha}-specific primers using the eluted DNAs as template. The PCR products were cloned into pCR 2.1-TOPO Vector using TOPO TA cloning kit (Invitrogen, Carlsbad, CA) and recombinants were sequenced using an ABI 377 DNA sequencer (Applied Biosystems, Foster City, CA).


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Invariant V{alpha}7.2–J{alpha}33 T cells represent a dominant V{alpha}7.2+ subset in the peripheral blood of healthy subjects (HS)
First, we examined if the RT-PCR SSCP clonotype method (16,25,28,29) could be used to detect the invariant V{alpha}7.2–J{alpha}33 sequence in peripheral blood derived from HS. Following mRNA isolation from nine PBMC samples, the TCR {alpha} chain sequences encompassing the {alpha}CDR3 region were RT-PCR amplified with a set of V{alpha}7.2 and C{alpha} primers. The amplified cDNAs were denatured and electrophoresed on the SSCP gel, and hybridized with C{alpha}-, J{alpha}33- or invariant V{alpha}7.2–J{alpha}33-specific probe. Hybridization with the C{alpha} probe has revealed several bands in the smear background on the gel, indicating that T cells using the V{alpha}7.2 segment are restricted, but heterogeneous (Fig. 1, upper panel). However, hybridizing with the J{alpha}33 probe revealed a solitary band in each sample at a same position (Fig. 1, middle panel), indicating that a single clonotype may dominate the TCR V{alpha}7.2 and J{alpha}33 rearrangements found in the peripheral blood. Given that the invariant V{alpha}7.2–J{alpha}33 clonotype was identified as an expanded clonotype in prior studies (7,8), we speculated that the solitary band that hybridized with the J{alpha}33-specific probe might correspond to the invariant V{alpha}7.2–J{alpha}33 sequence. Consistent with this speculation, the invariant V{alpha}7.2–J{alpha}33-specific probe detected a distinct band at the same position where the J{alpha}33-specific probe hybridized (Fig. 1, lower panel).



View larger version (86K):
[in this window]
[in a new window]
 
Fig. 1. Detection of the invariant V{alpha}7.2–J{alpha}33 TCR in the peripheral blood of HS. The V{alpha}7.2+ T cell repertoire in the peripheral blood was analyzed with the SSCP technique. The V{alpha}7.2+ TCR amplified from nine HS were hybridized with the C{alpha}-specific probe (upper panel), the J{alpha}33-specific probe (middle panel) or the invariant V{alpha}7.2–J{alpha}33 clonotype-specific probe (lower panel). Arrows indicate the position for the invariant V{alpha}7.2–J{alpha}33 clonotype. The numerical code corresponds to each subject.

 
To confirm if the clonotype hybridized with the J{alpha}33-specific probe represents the invariant V{alpha}7.2–J{alpha}33, we eluted DNA from the sites of the gel corresponding to the band, and amplified the DNA by a second PCR with V{alpha}7.2 and C{alpha} primers. The amplified cDNAs were cloned and 10–15 clones from each individual were sequenced. Analysis of four randomly selected HS has shown that 70–90% of the clones from each subject possess the V{alpha}7.2–J{alpha}33 invariant sequence (GTG AGA) in the CDR3 region. Another CDR3 DNA sequence (GTG ATG combined with J{alpha}33) was detected repeatedly in two of the four individuals. However, all the other sequences differed from each other and were not shared by different individuals. This analysis assured that the solitary band of our interest corresponds to the clonotype expressed by the MR1-restricted T cells.

Invariant V{alpha}7.2–J{alpha}33 T cells do not expand in response to {alpha}-galactosylceramide ({alpha}-GalCer)
V{alpha}24–V{alpha}11 NKT cells are known to proliferate in response to {alpha}-GalCer, which is a prototype ligand for the NKT cells (4,17). Additionally, we examined if the invariant V{alpha}7.2–J{alpha}33 T cells respond to {alpha}-GalCer. In brief, PBMC from healthy individuals were stimulated with {alpha}-GalCer as previously described (17) and the {alpha}-GalCer-stimulated PBMC cultures were harvested at different time points for SSCP analysis. We observed that the invariant V{alpha}7.2–J{alpha}33 clonotype would gradually diminish, while the V{alpha}24–V{alpha}11 clonotype remarkably expanded shortly after stimulation with {alpha}-GalCer (data not shown). This result confirms that {alpha}-GalCer is not a stimulatory ligand for the invariant V{alpha}7.2–J{alpha}33 T cells.

Invariant V{alpha}7.2–J{alpha}33 T cells are not reduced in the peripheral blood of MS
In previous studies, we have demonstrated that the V{alpha}24–J{alpha}Q NKT cells are remarkably reduced in the peripheral blood of MS, particularly in the remission phase (16,17). In fact, SSCP analysis for the V{alpha}24–J{alpha}Q clonotype detected the NKT cell clonotype in all the HS (18 of 18, 100%) (16), but the clonotype was not found in any of the MS patients in remission (Table 1). Given the notable similarities between CD1d-restricted NKT cells and MR1-resricted T cells, we speculated that the invariant V{alpha}7.2–J{alpha}33 clonotype might also be reduced in the peripheral blood of MS. However, the invariant clonotype could be readily detected by the SSCP method in 13 of 15 peripheral blood samples from MS patients in remission (Fig. 2 and Table 1). To further evaluate the frequency of the V{alpha}7.2–J{alpha}33 T cells in PBMC of MS, we applied a real-time RT-PCR with V{alpha}7.2- and V{alpha}7.2–J{alpha}33 clonotype-specific primers for quantitative analysis. Using this assay, we measured relative expression of the invariant V{alpha}7.2–J{alpha}33 mRNA in the PBMC derived from five MS in remission and from five HS. As shown in Fig. 3, there was no significant difference between HS and the patients with MS. Taken together, we conclude that MR1-restricted T cells are conserved in number in the patients with MS.


View this table:
[in this window]
[in a new window]
 
Table 1. Detection frequency of the invariant V{alpha}7.2–J{alpha}33 TCR versus invariant V{alpha}24–J{alpha}Q TCR in various samples
 


View larger version (97K):
[in this window]
[in a new window]
 
Fig. 2. Detection of the invariant V{alpha}7.2–J{alpha}33 TCR in the peripheral blood of MS. The V{alpha}7.2+ TCR amplified from the peripheral blood of 15 MS patients were analyzed by SSCP followed by hybridization with a C{alpha} (upper panel)- or J{alpha}33 (lower panel)-specific probe. Thirteen out of the 15 samples displayed the invariant clonotype (arrow). The presence of clonotypes distinct from the invariant V{alpha}7.2–J{alpha}33 clonotype indicates expansion of conventional V{alpha}7.2+ T cells. See also Table 1 summarizing the pooled data.

 


View larger version (7K):
[in this window]
[in a new window]
 
Fig. 3. Real-time RT-PCR assay for the invariant V{alpha}7.2–J{alpha}33 TCR. Expression of the invariant V{alpha}7.2–J{alpha}33 mRNA in the peripheral blood was quantitatively analyzed by applying quantitative RT-PCR (LightCycler). The PBMC from five HS and five MS were examined, and expression of the invariant V{alpha}7.2–J{alpha}33 TCR was quantified in comparison to that of ß-actin. The values represent relative expression of the invariant TCR in each sample, where the lowest value is indicated as 1. The horizontal lines show the mean (HS 1.726 ± 0.44, MS 1.416 ± 0. 48).

 
Infiltration of the invariant V{alpha}7.2–J{alpha}33 T cells in the CIDP lesions
We could previously demonstrate an expression of the invariant V{alpha}24–J{alpha}Q TCR in 60% of the peripheral nerve biopsy samples from CIDP (16). A possible interpretation was that the NKT cells may be recruited to the lesions like inflammatory cells (3032). It is very interesting to know if MR1-restricted T cells are also recruited to the CIDP lesions. Here we examined the CIDP samples for their expression of the V{alpha}7.2–J{alpha}33 invariant sequence. We were able to amplify V{alpha}7.2+ TCR messages from all the 10 samples. Hybridization with the C{alpha}-specific probe (Fig. 4A) revealed a number of bands in every lesion, suggesting that not only the invariant V{alpha}7.2–J{alpha}33, but conventional V{alpha}7.2+, T cells may also be present in the lesions. Hybridization with J{alpha}33- or invariant V{alpha}7.2–J{alpha}33-specific probe displayed the invariant clonotype in eight out of the 10 samples (Fig. 4A, and Tables 1 and 2). We also examined 11 nerve biopsy samples from other neurological diseases (OND) as controls. A faint single band was found in four of the 11 OND samples after hybridization with the C{alpha}-specific probe (Fig. 4B). However, none of the samples hybridized with the J{alpha}33-specific probe, excluding the presence of the invariant V{alpha}7.2–J{alpha}33 T cells in the control PNS lesions. These results demonstrate that not only the V{alpha}24–J{alpha}Q NKT cells, but also V{alpha}7.2–J{alpha}33 T cells, would preferentially accumulate in the inflammatory lesions of CIDP.



View larger version (67K):
[in this window]
[in a new window]
 
Fig. 4. Demonstration of the V{alpha}7.2+ TCR rearrangements and the invariant V{alpha}7.2–J{alpha}33 TCR in nerve biopsy samples. (A) Sural nerve biopsy samples from 10 CIDP patients were examined by SSCP. Amplified V{alpha}7.2+ TCR were hybridized with C{alpha}- and J{alpha}33-specific probes. HS indicates a lane for PBMC from HS, illustrating the position of the invariant V{alpha}7.2–J{alpha}33 clonotype (arrow). The numerical code corresponds to each biopsy sample. The same sample codes are used here and in Table 2. (B) Sural nerve biopsy samples from patients with OND were examined by SSCP. C{alpha}-specific hybridization detected bands in four samples as shown here. However, the J{alpha}33-specific probe did not detect any band (not shown). The OND include hereditary motor and sensory neuropathy, alcoholic polyneuropathy, acute demyelinating polyneuropathy, Churg–Strauss syndrome, POEMS syndrome, diabetic polyneuro pathy, and Krabbe disease.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Classification of the CIDP lesions based on the expression pattern of the invariant TCR
 
We classified the CIDP biopsy samples into four groups, based on the expression pattern of the V{alpha}7.2–J{alpha}33 and V{alpha}24–J{alpha}Q invariant sequences (Table 2). Eight of the 10 samples belonged to Group I (V{alpha}7.2–J{alpha}33+/V{alpha}24–J{alpha}Q+) or Group II (V{alpha}7.2–J{alpha}33+/V{alpha}24–J{alpha}Q), as reflected by the frequent detection of the V{alpha}7.2–J{alpha}33 clonotype. We could consistently detect IL-4 mRNA in all the samples from Groups I and II. More interestingly, IFN-{gamma} was detected in four of five samples from Group I, but detected in only one of three samples from Group II. Although the number of samples was not large enough to draw any conclusion, this may indicate a possible difference between Groups I and II with regard to the cytokine milieu.

Accumulation of the invariant V{alpha}7.2–J{alpha}33 T cells in the autopsy CNS lesions of MS
Next we asked if the V{alpha}7.2–J{alpha}33 T cells may infiltrate into the autopsy CNS lesions of MS. Using the SSCP clonotype method, we analyzed 14 CNS lesions obtained from five autopsied cases with MS, including seven acute plaques, six subacute plaques and one chronic plaque. V{alpha}7.2+ TCR could be amplified by RT-PCR from seven out of the 14 lesions, although they were detected only in one of the six control CNS samples (Table 1). We found that all the V{alpha}7.2+ plaques (four acute plaques, two subacute plaques and a single chronic plaque) expressed the message for the invariant V{alpha}7.2–J{alpha}33 sequence (Fig. 5, upper panel and Table 1). In contrast, as reported previously (16), whereas V{alpha}24+ TCR could be amplified from eight of the 14 MS autopsy lesions, only a single subacute plaque expressed the V{alpha}24–J{alpha}Q clonotype, i. e. the invasion of V{alpha}24–J{alpha}Q NKT cells was mainly restricted to the CIDP lesions, whereas the V{alpha}7.2–J{alpha}33 T cells were also found in some CNS lesions from MS. To verify the postulate that the V{alpha}7.2–J{alpha}33 T cells are involved in the pathology of MS, we also analyzed CSF samples obtained at an acute stage of MS. We were able to detect the V{alpha}7.2–J{alpha}33 invariant sequence in 73% of the samples examined (Fig. 5, lower panel and Table 1), supporting that the invariant V{alpha}7.2–J{alpha}33 T cells are a component of the CNS infiltrates in MS.



View larger version (73K):
[in this window]
[in a new window]
 
Fig. 5. Demonstration of the invariant V{alpha}7.2–J{alpha}33 TCR in autopsy CNS samples and CSF from MS. Fourteen CNS autopsy samples and 11 CSF samples from MS were analyzed in these experiments. The V{alpha}7.2+ samples were hybridized with a C{alpha}-specific probe and re-hybridized with the invariant V{alpha}7.2–J{alpha}33-specific probe. HS indicates a lane for PBMC from a HS, illustrating the position of the invariant V{alpha}7.2–J{alpha}33 clonotype (arrow).

 
In parallel to V{alpha}7.2+ TCR and V{alpha}24+ TCR, we examined the V{alpha}19+ TCR repertoire with the SSCP method. With the C{alpha}-specific probe, we could detect a number of V{alpha}19+ clonotypes in all the PBMC samples obtained from HS and MS (Table 3). However, V{alpha}19+ TCR was not detected in any of the CNS samples from MS or PNS samples from CIDP. This result indicates that the presence of a particular clonotype in the MS lesions does not simply reflect that this population is present in the peripheral circulation. In other words, it implies that the presence of the V{alpha}7.2–J{alpha}33 clonotype may indicate the ‘lesiophilic’ nature of the MR1-restricted T cells.


View this table:
[in this window]
[in a new window]
 
Table 3. Detection frequency of V{alpha}19+ TCR clonotypes in various samples
 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
It has been demonstrated repeatedly that CD4CD8 T cells in the human peripheral blood contain clonally expanded T cell populations (58). For example, CDR3 spectratyping analysis for the peripheral CD4CD8 T cells in healthy individuals has previously indicated clonal expansion of T cells bearing invariant V{alpha}7.2–J{alpha}33, V{alpha}4–J{alpha}29 or V{alpha}19–J{alpha}48 in addition to those expressing the V{alpha}24–J{alpha}Q NKT cell clonotype (7). After knowing that biopsy samples of CIDP are often infiltrated with the V{alpha}24–J{alpha}Q NKT cells (16), we attempted to analyze the expression of the V{alpha}7.2–J{alpha}33, V{alpha}4–J{alpha}29 and V{alpha}19–J{alpha}48 invariant sequences in the lesions of MS and CIDP. However, the invariant V{alpha}4–J{alpha}29 and V{alpha}19–J{alpha}48 sequences were not detected in any of the samples (data not shown). Accordingly, we focused our efforts on analysis of the V{alpha}7.2–J{alpha}33 T cells. In order to shed light on the difference and similarity between the V{alpha}7.2–J{alpha}33 and V{alpha}24–J{alpha}Q NKT cells, we examined the autopsy and biopsy samples as well as PBMC and CSF samples previously analyzed for the expression of the V{alpha}24–J{alpha}Q TCR (16).

Here, we documented that the autopsy CNS lesions from MS as well as the biopsy PNS lesions from CIDP are infiltrated with the invariant V{alpha}7.2–J{alpha}33 T cells. We also showed that the invariant V{alpha}7.2–J{alpha}33 T cells are present in a large majority of the CSF samples obtained at relapse phases of MS. In contrast, V{alpha}19+ TCR could not be detected in any of the affected tissues from MS or CIDP after PCR amplification, although they can be detected in all the PBMC samples. Although the function of the invariant V{alpha}7.2–J{alpha}33 T cells remains elusive, the present results demonstrated for the first time to our knowledge that the novel invariant T cells (811) are present in autoimmune inflammation affecting the nervous system.

In a very recent report (11), Lantz et al. showed that the MR1-restricted invariant T cells are preferentially located in the gut mucosa and therefore proposed to name the population as mucosal-associated invariant T cells (MAIT). In support of the special role of this cell population in the mucosa, the number of the cells in the gut mucosa was greatly reduced in germ-free mice. This observation indicated the role of commensal flora for selection of the invariant T cells. Although an interpretation for this could be that the MR1-resricted T cells would recognize the exogenous antigen bound to MR1, analysis of the T–T hybridomas showed that they could recognize MR1 directly in the absence of bound ligand (11). If this is indeed the case, the MAIT cells could be autoreactive to MR1. To accommodate the autoreactivity with the requirement for commensal flora, it could be speculated that MR1 expression may require some ligand derived from or induced by commensal flora. An alternative possibility is that microbial products may facilitate translocation of MR1 to the cell membrane.

Provided that the invariant V{alpha}7.2–J{alpha}33 T cells are generated or expanded in the mucosa, how would they accumulate into the inflammatory lesions of MS and CIDP? Although this remains a conundrum, we would speculate that inflammation-associated signals such as chemokines play a role in the initial step. In fact, CD1d-restricted NKT cells would behave like inflammatory cells and rapidly accumulate into certain granuloma lesions (30), and they could be detected in non-autoimmune inflammatory lesions (31,32). Given a number of similarities between V{alpha}7.2–J{alpha}33 and V{alpha}24–J{alpha}Q NKT cells, we would postulate that the V{alpha}7.2–J{alpha}33 T cells also might be preferentially recruited to the inflammatory sites. To support this idea, non-autoimmune inflammatory lesions are reported to express the invariant V{alpha}7.2–J{alpha}33 TCR (32).

The second critical step may be the interaction of the invariant T cells with B cells expressing MR1 in the site of lesions, given that the vast majority of the inflammatory lesions are infiltrated with B cells. We could expect the V{alpha}7.2–J{alpha}33 T cells to regulate local immune responses by producing cytokines. If IL-4 is the major cytokine produced by the novel invariant T cells, their interaction with B cells may lead to augmentation of antibody production. Even though the encephalitogenic Th1 autoreactive T cells are down-regulated by IL-4, the direct interaction between B cells and the V{alpha}7.2–J{alpha}33 T cells may substantially augment the tissue damage or alter the type of lesions. However, if suppressive cytokines such as transforming growth factor-ß are the major products of the V{alpha}7.2–J{alpha}33 T cells in vivo, they may down-regulate the B cells as well as inflammatory cells in the vicinity. Although we can only speculate about how they would deal with autoimmunity, it is possible that they would play an active role in the regulation of autoimmune inflammation. To verify this hypothesis, we need to systematically analyze the functions of the V{alpha}7.2–J{alpha}33 T cells with regard to ligand recognition and cytokine production. It is also important to know if the presence or absence of the invariant T cells may correlate with the type of pathology. The present data indicate that it is indeed a rewarding attempt.


    Acknowledgements
 
We thank Bernhard Greve and Joel Stern for comments on the manuscript and for discussion. This work was supported by the Organization for Pharmaceutical Safety and Research (OPSR/Kiko).


    Abbreviations
 
{alpha}-GalCer—{alpha}-galactosylceramide

CIDP—chronic inflammatory demyelinating polyneuropathy

CNS—central nervous system

CSF—cerebrospinal fluid

HS—healthy subject

MAIT—mucosal-associated invariant T cell

MS—multiple sclerosis

OND—other neurological disease

PBMC—peripheral blood mononuclear cell

PNS—peripheral nervous system

SSCP—single-strand conformation polymorphism


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Bendelac, A., Bonneville, M. and Kearney, J. F. 2001. Autoreactivity by design: innate B and T lymphocytes. Nat. Rev. Immunol. 1:177.[CrossRef][Medline]
  2. Porcelli, S., Yockey, C. E., Brenner, M. B. and Balk, S. P. 1993. Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD4CD8 {alpha}/ßT cells demonstrates preferential use of several V{alpha} genes and an invariant TCR{alpha} chain. J. Exp. Med. 178:1.[Abstract/Free Full Text]
  3. Wilson, S. B. and Delovitch, T. L. 2003. Janus-like role of regulatory iNKT cells in autoimmune disease and tumour immunity. Nat. Rev. Immunol. 3:211.[CrossRef][Web of Science][Medline]
  4. Taniguchi, M., Harada, M., Kojo, S., Nakayama, T. and Wakao, H. 2003. The regulatory role of V{alpha}14 NKT cells in innate and acquired immune response. Annu. Rev. Immunol. 21:483.[CrossRef][Web of Science][Medline]
  5. Dellabona, P., Padovan, E., Casorati, G., Brockhaus, M. and Lanzavecchia, A. 1994. An invariant V{alpha}24–J{alpha}Q/Vß11 T cell receptor is expressed in all individuals by clonally expanded CD4CD8 T cells. J. Exp. Med. 180:1171.[Abstract/Free Full Text]
  6. Lantz, O. and Bendelac, A. 1994. An invariant T cell receptor {alpha} chain is used by a unique subset of MHC class I-specific CD4+ and CD48 T cells in mice and humans. J. Exp. Med. 180:1097.[Abstract/Free Full Text]
  7. Han, M., Harrison, L., Kehn, P., Stevenson, K., Currier, J. and Robinson, M. A. 1999. Invariant or highly conserved TCR {alpha} are expressed on double-negative (CD3+CD4CD8) and CD8+ T cells. J. Immunol. 163:301.[Abstract/Free Full Text]
  8. Tilloy, F., Treiner, E., Park, S. H., Garcia, C., Lemonnier, F., de la Salle, H., Bendelac, A., Bonneville, M. and Lantz, O. 1999. An invariant T cell receptor {alpha} chain defines a novel TAP-independent major histocompatibility complex class 1b-restricted {alpha}/ßT cell subpopulation in mammals. J. Exp. Med. 189:1907.[Abstract/Free Full Text]
  9. Shimamura, M. and Huang, Y. Y. 2002. Presence of a novel subset of NKT cell bearing an invariant V{alpha}19. 1–J{alpha}26 TCR alpha chain. FEBS Lett. 516:97.[CrossRef][Web of Science][Medline]
  10. Shimamura, M., Huang, Y. Y., Kobayashi, K., Okamoto, N., Goji, H. and Kobayashi, M. 2002. Characterization of a novel NKT cell repertoire expressing an invariant V{alpha}19–J{alpha}26 TCR {alpha} chain using the invariant TCR transgenic mice. Presented at 2nd Int. Workshop on CD1 Antigen Presentation and NKT Cells, abstr. 4. Woods Hole, MA.
  11. Treiner, E., Duban, L., Bahram, S., Radosavljevic, M., Wanner, V., Tilloy, F., Affaticati, P., Gilfillan, S. and Lantz, O. 2003. Selection of evolutionarily conserved mucosal-associated invariant T cells by MR1. Nature 422:164.[CrossRef][Medline]
  12. Hashimoto, K., Hirai, M. and Kurosawa, Y. 1995. A gene outside the human MHC class I-like molecule in T cell activation. Science 269:693.[Abstract/Free Full Text]
  13. Yoshimoto, T. and Paul, W. E. 1994. CD4pos, NK1.1pos T cells promptly produce interleukin 4 in response to in vivo challenge with anti-CD3. J. Exp. Med. 179:1285.[Abstract/Free Full Text]
  14. Chen, H. and Paul, W. E. 1997. Cultured NK1.1+CD4+ T cells produce large amounts of IL-4 and IFN-{gamma} upon activation by anti-CD3 or CD1. J. Immunol. 159:2240.[Abstract/Free Full Text]
  15. Miyamoto, K., Miyake, S. and Yamamura, T. 2001. A synthetic glycolipid prevents autoimmune encephalomyelitis by inducing Th2 bias of natural killer cells. Nature 413:531.[CrossRef][Medline]
  16. Illés, Z., Kondo, T., Newcombe, J., Oka, N., Tabira, T. and Yamamura, T. 2000. Differential expression of NK T cell V{alpha}24J{alpha}Q invariant TCR chain in the lesions of multiple sclerosis and chronic inflammatory demyelinating polyneuropathy. J. Immunol. 164:4375.[Abstract/Free Full Text]
  17. Araki, M., Kondo, T., Gumperz, J. E., Brenner, M. B., Miyake, S. and Yamamura, T. 2003. Th2 bias of CD4+ NKT cells derived from multiple sclerosis in remission. Int. Immunol. 15:279.[Abstract/Free Full Text]
  18. Martin, R., Ruddle, N. H., Reingold, S. and Hafler, D. A. 1998. T helper cell differentiation in multiple sclerosis and autoimmunity. Immunol. Today 19:495.[CrossRef][Web of Science][Medline]
  19. Steinman, L. 2001. Multiple sclerosis: a two-stage disease. Nat. Immunol. 2:762.[CrossRef][Web of Science][Medline]
  20. Kieseier, B. C., Dalakas, M. C. and Hartung, H. P. 2002. Immune mechanisms in chronic inflammatory demyelinating neuropathy. Neurology 59:S7.
  21. Poser, C. M., Paty, D. W., Scheinberg, L., MacDonald, W. I., Davis, F. A., Ebers, G. C., Johnson, K. P., Sibley, W. A., Silberberg, D. H. and Tourtellotte, W. W. 1983. New diagnostic criteria for multiple sclerosis: guidelines for research protocols. Ann. Neurol. 13:227.[CrossRef][Web of Science][Medline]
  22. Ad Hoc Subcommittee of the American Academy of Neurology AIDS Task Force. 1991. Research criteria for diagnosis of chronic inflammatory demyelinating polyneuropathy (CIDP). Neurology 41:617.[Web of Science][Medline]
  23. Dyck, P. J., Thomas P. K. and Griffin J. W., eds. 1993. Peripheral Neuropathy, 3rd edn. Saunders, Philadelphia, PA.
  24. Li, H., Newcombe, J., Groome, N. and Cuzner, M. L. 1993. Characterization and distribution of phagocytic macrophages in multiple sclerosis plaques. Neuropathol. Appl. Neurobiol. 19:214.[Web of Science][Medline]
  25. Illés, Z., Kondo, T., Yokoyama, K., Ohashi, T., Tabira, T. and Yamamura, T. 1999. Identification of autoimmune T cells among in vivo expanded CD25+ T cells in multiple sclerosis. J. Immunol. 162:1811.[Abstract/Free Full Text]
  26. Arden, B., Clark, S., Kabelitz, D. and Mak, T. W. 1995. Human T cell receptor variable gene segment families. Immunogenetics 42:455.[Medline]
  27. Takahashi, K., Miyake, S., Kondo, T., Terao, K., Hatakenaka, M., Hashimoto, S. and Yamamura, T. 2001. Natural killer type 2 bias in remission of multiple sclerosis. J. Clin. Invest. 107:23.[Web of Science][Medline]
  28. Yamamoto, K., Masuko-Hongo, K., Tanaka, A., Kurokawa, M., Hoeger, T., Nishioka, K. and Kato, T. 1996. Establishment and application of a novel T cell clonality analysis using single-strand conformation polymorphism of T cell receptor messenger signals. Hum. Immunol. 48:23.[CrossRef][Web of Science][Medline]
  29. Nam, K. H., Illés, Z., Terao, K., Yoshikawa, Y. and Yamamura, T. 2000. Characterization of expanded T cell clones in healthy macaques: ontogeny, distribution and stability. Dev. Comp. Immunol. 24:703.[CrossRef][Web of Science][Medline]
  30. Mempel, M., Ronet, C., Suarez, F., Gilleron, M., Puzo, G., Van Kaer, L., Lehuen, A., Kourilsky, P. and Gachelin, G. 2002. Natural killer T cells restricted by the monomorphic MHC class 1b CD1d1 molecules behave like inflammatory cells. J. Immunol. 168:365.[Abstract/Free Full Text]
  31. Yamazaki, K., Ohsawa, Y. and Yoshie, H. 2001. Elevated proportion of natural killer T cells in periodontitis lesions. Am. J. Pathol. 158:1391.[Abstract/Free Full Text]
  32. Mempel, M., Flageul, B., Suarez, F., Ronet, C., Dubertret, L., Kourilsky, P., Gachelin, G. and Musette, P. 2000. Comparison of the T cell patterns in leprous and cutaneous sarcoid granulamas. Presence of V{alpha}24-invariant natural killer T cells in T-cell-reactive leprosy together with a highly biased T cell receptor V{alpha} repertoire. Am. J. Pathol. 157:509.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Therapeutic Advances in Neurological DisordersHome page
H. C. Lehmann, G. Meyer zu Horste, B. C. Kieseier, and H.-P. Hartung
Review: Pathogenesis and treatment of immune-mediated neuropathies
Therapeutic Advances in Neurological Disorders, July 1, 2009; 2(4): 261 - 281.
[Abstract] [PDF]


Home page
Int ImmunolHome page
M. Shimamura, Y.-Y. Huang, M. Kobayashi, and H. Goji
Altered production of immunoregulatory cytokines by invariant V{alpha}19 TCR-bearing cells dependent on the duration and intensity of TCR engagement
Int. Immunol., February 1, 2009; 21(2): 179 - 185.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
G. Wingender and M. Kronenberg
Role of NKT cells in the digestive system. IV. The role of canonical natural killer T cells in mucosal immunity and inflammation
Am J Physiol Gastrointest Liver Physiol, January 1, 2008; 294(1): G1 - G8.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. Kawachi, J. Maldonado, C. Strader, and S. Gilfillan
MR1-Restricted V{alpha}19i Mucosal-Associated Invariant T Cells Are Innate T Cells in the Gut Lamina Propria That Provide a Rapid and Diverse Cytokine Response
J. Immunol., February 1, 2006; 176(3): 1618 - 1627.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
H. Koller, B. C. Kieseier, S. Jander, and H.-P. Hartung
Chronic Inflammatory Demyelinating Polyneuropathy
N. Engl. J. Med., March 31, 2005; 352(13): 1343 - 1356.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Illés, Z.
Right arrow Articles by Yamamura, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Illés, Z.
Right arrow Articles by Yamamura, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?