International Immunology Advance Access originally published online on October 25, 2004
International Immunology 2004 16(12):1741-1749; doi:10.1093/intimm/dxh175
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2004 The Japanese Society for Immunology
NF-
B elements associated with the Stat6 site in the germline
1 immunoglobulin promoter are not necessary for the transcriptional response to CD40 ligand
1 Department of Microbiology and Immunology, University of Texas Health Science Center at San Antonio, San Antonio, TX 78229-3900, USA
2 Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, MI 48109, USA
Corresponding author: M. T. Berton; Email: berton{at}uthscsa.edu
| Abstract |
|---|
|
|
|---|
Both germline transcription and switch recombination of heavy chain genes are likely to be regulated by cis elements binding transcription factors in the promoter regions of germline immunoglobulin genes. To identify cis-acting elements important in germline transcription of the murine
1 heavy chain gene, we have used a transgenic approach. Seventeen kb
1 immunoglobulin transgenes with mutations in three NF-
B sites in the
1 proximal promoter, a putative CD40 response element, are expressed well. Compared to wild-type transgenes, there is no deficiency in the expression of the transgenes with mutations of the three NF-
B sites after induction of splenic B cells with IL-4 alone, CD40L, or CD40L + IL-4. There may be a small reduction in the response of these mutant transgenes after induction with LPS + IL-4. We also prepared transgenes that were truncated at 150 (rather than 2100) and therefore included the wild-type Stat6 binding site at 123 and the three wild-type NF-
B sites. Nevertheless,
1 germline transcripts were not expressed from these transgenes. We conclude that the three proximal NF-
B sites are dispensable for expression of
1 germline transcripts under most conditions. However, cis-acting elements distal to 150 must be critical to this transcription.
Keywords: B lymphocyte, CD40 signaling, class switch recombination, germline transcription, NF-
B
| Introduction |
|---|
|
|
|---|
Class switch recombination is mediated by a DNA deletion between switch regions sequences upstream of each CH gene except C
(1,2). Transcription of an upstream exon (the I exon), the switch region, and the C region in their germline configuration precedes class switch recombination. Both germline transcription and switch recombination are regulated in a gene-specific manner by a combination of cytokines and B cell activators. It is generally accepted that the same DNA binding proteins that regulate the expression of germline transcription also regulate switch recombination either directly or via a mechanistic role for germline transcripts (1,2). Thus, an understanding of which factors regulate germline transcription, and the cis-acting elements to which they bind, is likely to illuminate the regulation, and perhaps mechanism, of class switch recombination.
Germline transcripts of the murine
1 CH gene are induced to a small extent by IL-4 alone or CD40L alone, and are induced substantially by the combination of LPS + IL-4 or CD40L + IL-4 (36). This induction has been studied extensively in vitro and by transient transfection/reporter gene assays. IL-4 regulates gene expression largely by the activation of Stat6, and the binding of Stat6 to a consensus Stat site at 123 bp (relative to the 5' most transcription start site) is known to play a critical role in IL-4-mediated activation of the germline
1 promoter in reporter gene assays (68).
The role of NF-
B family members in murine
1 germline transcription and switch recombination has been also intensely studied, but has yielded some apparently contradictory findings. Three NF-
B binding sites have been identified at 95, 71 and 53 bp relative to the 5' most start site for
1 germline transcripts (9,10). Ectopically expressed NF-
B activates transcription from reporter constructs that include the
1 promoter for germline transcripts (9). Mutation of these NF-
B sites eliminates responsiveness to CD40 ligation or to ectopic NF-
B by the same reporter constructs in some cell lines (9,11), but not in other cell lines (10). Mutation of these NF-
B sites can have an effect on the IL-4 responsiveness of
1 reporter constructs (10), consistent with interactions between NF-
B and Stat6 bound to closely linked sites (12,13).
The role of specific NF-
B members in transactivation of the
1 gene has been studied. Some forms of the NF-
B heterodimers or homodimers are better than other forms at activating the
1 germline promoter in reporter constructs (14). Likewise, deficiencies in various components of NF-
B have different effects on germline transcription of and switch recombination to the
1 gene (1519). In normal B cells, CD40 ligation induces different and longer lasting NF-
B forms than does LPS activation (14). These results are consistent with the expression of endogenous
1 germline transcripts after CD40 ligation, but not after LPS treatment.
To test the role of the NF-
B binding sites in the proximal germline
1 promoter, we chose to express mutant forms of a
1 transgene in mice. One advantage of this approach is that the mutations could be studied in the context of a large
1 gene, extending from 2100 bp through the I exon, S
1, C
1 and 2 kb 3' of C
1. Another advantage is that transcription of the mutated genes could be studied in normal, rather than transformed, B cells that are at the correct developmental stage for maximal induction of heavy chain genes. A third advantage is that the genes are chromosomally integrated in copies ranging from 1 to 30, rather than the thousands of copies of extrachromosomal genes typically found in a transient transfection assay. For these reasons, we hypothesized that the transcriptional activity we measured would be relevant to the endogenous genes in normal B cells.
| Methods |
|---|
|
|
|---|
Production of transgenic mice
All nucleotides are numbered relative to the 5'-most start site for germline transcripts (20), which is residue 1490 of GenBank accession no. M12389. Two new lines of transgenic mice with the wild-type 17 kb
1 transgene [in p
1/HE17, (21)] were prepared with a GATC insertion in the BglII site at +197 in I
1. The transgene in these two lines (589 and 601) as well as the 17 kb
1 transgene without the insertion in the BglII site (lines 45 and 46) are collectively designated wild type in this publication.
A KpnI/BglII fragment from pKB350lucM1-2-3 (10) that included the three mutated NF-
B sites from the proximal germline
1 promoter was joined to the HindIII (2100)/KpnI (150) fragment (lacking the BglII site at 1490), using a partial digest to avoid cutting at an upstream KpnI site (1200). The mutations in the three NF-
B binding sites (shown in Fig. 1 at 95, 71 and 53 bp relative to the 5'-most start site for
1 germline transcripts) were constructed previously by oligonucleotide-directed mutagenesis as described (10). Each NF-
B site was mutated at three consecutive nucleotide positions known to be critical for NF-
B heterodimer binding (22). The sequences of the three mutated sites are ttcCTCCCCC, AGAAAaaaCC and tttGAACCCT, respectively (10). EMSA demonstrated that these mutations completely abrogated binding of NF-
B heterodimers to these sites (data not shown). The resulting HindIII/BglII fragment was cloned into the HindIII and BglII sites of p
1/HE17. The BglII site at +197 was filled in, inserting GATC, and the transgene was designated NF-
B TM.
|
The transgene truncated at 150 was constructed by cloning the KpnI (150)/BglII (+197) fragment into pGEM. This fragment was extracted by HindIII and BglII digestion and cloned into the HindIII and BglII sites of p
1/HE17, effectively deleting the sequences from the HindIII site to the KpnI site at 150. The structure of the promoter region of this construct was verified by sequencing, and the BglII site at +197 was filled in, inserting GATC. This transgene was designated 150. For the production of the three types of transgenic mice, the 15 or 17 kb HindIII/EcoRI insert was purified and injected into C57BL/6xSJL (F2) fertilized eggs. To establish transgenic lines, transgene positive mice were bred to non-transgenic littermates or to C57BL/6 mice.
Copy number of transgenes was determined by Southern hybridization, using BamHI digestion and probes for S
1 [p
1/B.Y (23)] or C
1 (the 3.5 kb BamHI/EcoRI fragment with C
1). Hybridization to the endogenous genes was used to calibrate hybridization to the transgenes. A correction was made for blots with the S
1 probe, as it hybridizes 2.3-fold better to a allele (transgenic) fragments than b allele (endogenous) fragments.
Cell culture
Single cell suspensions of splenic B cells were purified as described (6). B cells (106/ml) were cultured in RPMI 1640 supplemented with 10% FBS (Hyclone) for 2472 h with Sf9 cells (2 x 105/ml) expressing mouse CD40 ligand (CD40L) (6,24), IL-4 (500 U/ml) and LPS (Escherichia coli; Sigma) (20 µg/ml) as indicated. All cultures were maintained in a 6% CO2 atmosphere at 37°C.
Assay for germline transcripts
RNA was prepared using the one-step method (25). Germline
1 transcripts were detected by RNase protection using a probe (WD252) that distinguishes the transcripts from the transgene and endogenous genes due to the four bp insertion in the transgene (21). Alternatively,
1 germline transcripts were amplified (1 min, 95°C; 1 min, 54°C; 1 min, 72°C; 30 cycles) in the presence of [32P]dATP from cDNA (5', I
1: GACGGCTGCTTTCACAGCTT and 3', C
1: TAGTTTGGGCAGCAGATC). The purified 440 bp product was digested with TaqI, which cuts products from the endogenous gene once, and cuts products from the transgene twice due to the GATC insertion in I
1. Single nucleotide primer extension (SNuPE) was also used to detect germline transcripts (21). All radioactive gels were imaged with a Typhoon PhosphorImager and the results were quantified with ImageQuant software (Amersham BioSciences, Piscataway, NJ). The levels of transgenic germline transcripts detected in each assay were expressed as a percentage of the total germline transcripts (transgenic plus endogenous) and were reported as percent transgene expression.
| Results |
|---|
|
|
|---|
The structure of the germline
1 transcripts and the wild-type and mutant transgene constructs generated in this study are shown in Fig. 1. The first major transcription start site lies 197 bp upstream of the 3' BglII site in the germline locus with additional start sites occurring over a 150 bp region downstream (20,26). The transgene constructs are shown aligned with the germline locus. Figure 1(A) also lists the founder numbers for each of the lines generated. Transgene copy number was estimated from Southern blots of tail DNA; examples are presented in Fig. 1(B).
Expression of
1 transgenes with mutations in the three germline
1 promoter NF-
B binding sites
As stated previously, three NF-
B binding sites have been identified at 95, 71 and 53 bp relative to the 5'-most start site for
1 germline transcripts (9,10). Ectopically expressed NF-
B activates transcription from reporter constructs that include the germline
1 promoter (9) and mutation of these NF-
B sites eliminates responsiveness to CD40 ligation or to ectopic NF-
B by the same reporter constructs in some cell lines (9,11), but not in others (10). We examined the role of these three sites in vivo by determining the expression of a germline
1 transgene (NF-
B TM) in which all three NF-
B sites have been mutated to prevent the binding of NF-
B heterodimers (9,10). We determined expression of germline
1 transcripts in splenic B cells from wild-type and NF-
B TM transgenes in multiple mouse lines by three different assays described in the Methods.
We employed a semi-quantitative assay, RNase protection, which measured the amount of transgenic and endogenous germline transcripts directly (Fig. 2A). Previous studies have shown that the 17 kb wild-type
1 transgenes are regulated similarly to endogenous
1 genes by LPS, CD40L and IL-4 (21,27). Transcripts from the NF-
B TM transgenes are readily detected by protection of a transgenic (252 bp) fragment, compared to no protection of this size using RNA from non-transgenic B cells (Fig. 2B, compare lanes 510 with 13). In parallel to the endogenous genes, almost no transgenic germline transcripts are expressed by B cells cultured in LPS alone (lanes 13 and 17). Small quantities of transgenic transcripts are induced by treatment with CD40L, and greater quantities are induced by CD40L ± IL-4 treatment (lanes 6 and 7, 9 and 10, 15 and 16, 19 and 20). Therefore, to a first approximation, the NF-
B TM transgenes, in spite of the mutations in the three proximal NF-
B sites, are induced by the same treatments that induce the endogenous
1 gene. Virtually identical results were obtained from RNase protection assays of lines 594 and 622 (not shown). We did observe, however, that smaller quantities of transgenic germline transcripts are induced by LPS ± IL-4 than by CD40L ± IL-4 in NF-
B TM B cells (lanes 5 and 7, 8 and 10, 14 and 16, 18 and 20). This is different from the endogenous genes, where approximately equal amounts of germline transcripts result from stimulation with LPS ± IL-4 and with CD40L ± IL-4 (lanes 1 and 3). Thus, relative to the endogenous genes, the NF-
B TM transgene is expressed less by induction with LPS ± IL-4 (for example, 30% transgene expression for line 592 cells) than by induction with CD40L ± IL-4 (57% transgene expression for line 592).
|
We also noted that the addition of many extra
1 genes as transgenes does not increase the total amount of germline transcripts by a significant amount. Relative to actin protection, the amount of transgenic plus endogenous germline transcripts induced by LPS and IL-4 or CD40L and IL-4 in line 592, with 30 to 50 extra
1 genes, ranges from only 1.2 to 3.8 times that in non-transgenic B cells (Fig. 2B, lanes 5 and 7 compared to lanes 1 and 3). This is consistent with our hypothesis that the total amount of germline transcripts, at least in cells treated with LPS + IL-4 or CD40L + IL-4, is limited by the availability of some transcription factor(s) (21).
We wanted to study transcripts in B cells treated with IL-4 only, and explore further transcripts of the NF-
B TM transgene in B cells treated with LPS ± IL-4. To do this, we turned to two PCR-based assays that are well-suited for comparing the relatively small quantities of endogenous and transgenic germline transcripts in B cells treated with IL-4 only, and, at the same time, can compare with some accuracy the relative quantity of endogenous and transgenic transcripts in B cells treated with LPS ± IL-4. The SNuPE assay takes advantage of a polymorphism between the endogenous genes (C57BL/6) and transgenes (BALB/c) in the I exon (see schematic in Fig. 3A). If the primer used hybridizes to a PCR product of endogenous germline transcripts, a radiolabeled T is added to it by Taq polymerase. If the primer hybridizes to a PCR product of transgenic transcripts, a radiolabeled A is incorporated. We use this assay to determine the amount of transgenic germline transcripts relative to the amount of endogenous germline transcripts. In all SNuPE assays, quantities of RTPCR product (determined in a preliminary experiment) were tested that would yield similar T incorporation for each sample. Therefore, we used larger amounts of cDNA for analysis of IL-4 only samples than for LPS ± IL-4 or CD40L ± IL-4 samples. By this experimental design, we normalized the transgene expression to the expression of the endogenous gene, and reported the results as percent transgene expression.
|
If the transgene expression parallels that of the well-characterized regulation of the endogenous
1 genes (36) (Fig. 2), then the percent transgene expression should be the same regardless of B cell treatment. This is approximately the case for two wild-type
1 transgenes (lines 45 and 46, Fig. 3B). If the
1 transgenes also paralleled the endogenous genes quantitatively, then the percent transgene expression should reflect the transgene copy number. For example, in line 45, 60% (three of five) of
1 genes in the B cells are transgenic and 5561% of the transcripts are from the transgene. This indicates that in the four treatments tested in Fig. 3(B), the transgenes in line 45 are expressed just like the endogenous
1 genes. Of the small quantity of
1 germline transcripts known to be induced by IL-4 alone (5), almost 60% come from the transgene. Much larger amounts of germline transcripts are induced by treatment with CD40L ± IL-4 (Fig. 2B) (6), but the transgene still contributes almost 60% of the total transcripts.
Like line 45, the percent transgene expression was consistent for other wild-type transgenes across all treatments (with some small reductions discussed below). However, line 45 was unique in that each copy of the transgene expressed transcripts as well as an endogenous gene. For all other lines, expression per gene was 1020% the amount of the endogenous gene (e. g. line 46 in Fig. 3B). The expression of transcripts from the transgene does increase, however, with transgenic copy number. Since the NF-
B TM transgenic mice that we obtained tended to have more transgene copies (750 copies), the percent transgenic expression was also greater (lines 619 and 305, Fig. 3B). One exception to this 4389% expression by the NF-
B TM transgene was B cells treated with LPS ± IL-4, in which the transgenic expression was consistently lower, 30 and 27% in Fig. 3(B).
These results were verified in a third assay in which
1 germline transcripts were amplified by RTPCR. PCR products derived from transgenic and endogenous transcripts were distinguished by digestion with TaqI (Fig. 3C). The RTPCR/TaqI digestion assay is very similar to the SNuPE assay, the only difference being in how the two types of transcripts are distinguished in the final step. We have used 30 cycles for the amplification step, which is a compromise. The small amounts of
1 germline transcripts in B cells treated with LPS, and even those in B cells treated with IL-4 only, are amplified to modest amounts of product for analysis. On the other hand, the relatively abundant
1 germline transcripts in B cells treated with LPS ± IL-4 or CD40L ± IL-4 are amplified to saturation. Because amplification is outside the semi-quantitative range, the absolute amount of the transgenic product detected in B cells under one culture condition cannot be compared to the absolute amount of product detected under another culture condition. However, because the transgenic and endogenous transcripts, which differ by only a few bp, are amplified in proportion to their initial concentration, even if the PCR goes to saturation (21), it is informative to compare the percent transgene expression among various treatments.
Consistent with the established regulation of the endogenous
1 gene, it was difficult to amplify
1 germline transcripts from non-transgenic, line 589, or line 619 B cells that were lysed immediately after purification (ex vivo) or that were cultured in LPS only (Fig. 3C, lanes 1, 3, 7, 9, 13 and 15). The small quantity of
1 germline transcripts in B cells treated with IL-4 was easier to amplify (lanes 2, 8 and 14). Since the percent transgene expression is almost identical in ex vivo B cells, in B cells cultured in LPS, and in B cells cultured in IL-4, the results support the data from the RNase protection assay (Fig. 2B) and demonstrate that the transgenes are poorly transcribed in unstimulated B cells and are induced, in parallel to the endogenous genes, by IL-4. Also consistent with the results of the RNase protection assays and the SNuPE assays, line 619 with 15 to 25 copies of the NF-
B TM (e.g. line 619 in Fig. 3C) had greater percent transgene expression in B cells treated with LPS ± IL-4, CD40L alone, or CD40L ± IL-4 than did line 589 with 712 copies of the wild-type transgene. However, the expression in NF-
B TM B cells treated with LPS ± IL-4 (41%) was consistently less than that in B cells treated with IL-4, CD40L, or CD40L ± IL-4 (6988%).
To summarize all the expression data with the NF-
B TM transgenes, we pooled data from all three assays and several experiments (Fig. 4). With all treatments, the transgenes with the mutations in each of the three proximal NF-
B binding sites are expressed well. Consistent with previous observations (21), there is a correlation between transgenic copy number and percent transgene expression for lines 46, 601, 589, 305, 619, 622 and 592 induced by IL-4 alonethe more copies of the transgene, the greater the transgene expression (Fig. 4A). Superimposed on this copy number dependence is some contribution by the insertion site of the transgenes, as demonstrated by line 45. B cells from line 45 routinely express more transcripts per copy than do other lines.
|
To control for both transgene copy number and any insertion site effects, we chose to normalize transgene expression using the IL-4 only-induced expression (Fig. 4B). The percent transgene expression values (Fig. 4A) do not indicate an effect of the three NF-
B site mutations on IL-4-induced expression of the transgene. Hence, we assumed that the quantity of IL-4-only transgene expression reflected both the copy number and any insertion site effects, without an influence of the NF-
B mutations. By dividing expression values for LPS + IL-4, CD40L and CD40L + IL-4 by the value for IL-4 only, we would be able to normalize the eight different lines of transgenic mice for copy number and insertion site effects, and thus isolate the effect of the NF-
B mutations. When normalized to IL-4 only expression, expression of WT and TM transgenes in CD40L-induced or CD40L + IL-4-induced B cells is reduced somewhat, consistent with the hypothesis that
1 transgene expression is limited by the availability of necessary transcription factors (see above, and Discussion). Importantly, the normalized transgene expression, on average, is virtually identical for the wild-type and NF-
B TM transgenes. This implies that there is no effect of the NF-
B site mutations on induction of the
1 gene by CD40 ligation. On the other hand, the normalized expression by NF-
B TM B cells cultured in LPS + IL-4 is reduced somewhat compared to wild-type transgenes (average for the four wild-type lines, 0.75 ± 0.35, compared to the average for the four NF-
B TM lines, 0.35 ± 0.10, P < 0.066). Although
1 transgenes with mutations in the three proximal NF-
B sites are expressed well after culture with LPS + IL-4, the inability of NF-
B to bind these sites does reduce that expression by a small increment that does not quite reach statistical significance.
Expression of
1 transgenes truncated at 150
We tested the possibility that the proximal promoter region sequences including the Stat6 binding site and the NF-
B binding sites were sufficient for the expression of transgenic
1 germline transcripts. In transient transfection assays, constructs truncated at 150 are induced by both IL-4 and CD40L (6,7,9). We prepared lines of transgenic mice that included the entire I
1, S
1 and C
1 regions used in our other constructs, but were truncated at the KpnI site at 150, and hence deleted
2000 bp of promoter region sequence. B cells from these transgenic mice did not express germline transcripts from the transgene, regardless of the activators and cytokines used in vitro. For example, B cells from lines 834 and 994 (with 1014 copies of the 150 transgene) did not express transgenic germline transcripts after culture in CD40L alone, CD40L + IL-4, or LPS + IL-4 (Fig. 5A; see also Fig. 2B, lane 4). Controlling for the viability of the B cells, induction by CD40L or IL-4, RNA preparation, etc., B cells from the same transgenic lines did express germline transcripts from the endogenous
1 gene (see the T panel). A summary of expression data from four lines with the 150
1 transgene is presented in Fig. 5(B). Even though mice with the 150 transgene had copy numbers of 714, their expression of
1 germline transcripts was between 15%, and was not significantly different than the expression from non-transgenic mice. The results of these experiments strongly indicate a role for sequences upstream of 150 in the induced transcription of the germline
1 gene.
|
| Discussion |
|---|
|
|
|---|
Proximal elements and
1 germline transcriptionWe draw three conclusions from this study. The first is that mutation of the three proximal NF-
B binding sites has little effect on
1 transgene expression. Comparing expression of the wild-type and NF-
B TM transgenic mice, loss of NF-
B binding at these three sites had no measurable effect on
1 germline transcription induced by IL-4 alone (Fig. 4A), by CD40L alone, or by CD40L + IL-4 (Fig. 4B). There was a small effect on induction by LPS + IL-4 (Fig. 4B). The lack of a dramatic effect on transcription is surprising, given the location of the NF-
B sites and the effects observed in transient transfection/reporter gene assays (911). There are three differences between our study of transgenes and those of reporter constructs that may contribute to these discrepant results. (i) The transgenes described in this study are expressed in normal B cells that may express a qualitatively or quantitatively different array of transcription factors compared to specific B cell lines used for reporter gene assays. (ii) The transgenes are integrated into chromatin, as opposed to extrachromosomal reporter constructs. This is likely to change the requirements for factor binding and activation. (iii) The mutations of the NF-
B sites we test here, in the context of the entire
1 gene may be compensated by the binding of NF-
B, or other transcription factors, to sites elsewhere in the gene. Previously described reporter constructs (9,10) which extend from 954 (or 150) to +202 may lack some of these compensating sites.
Snapper and colleagues have shown that activation of the
1 gene by LPS + IL-4 requires binding of specific NF-
B members to NF-
B sites (17,18). The data in Figs 25![]()
![]()
would suggest that some of those NF-
B binding sites are outside the proximal promoter, since mutation of those in the proximal promoter resulted in only a partial reduction in germline transcripts induced by LPS + IL-4.
A second conclusion is that sequences distal to 150 are indispensable for expression of
1 germline transcripts. Some of the compensating NF-
B binding sites might lie distal to 150. The compensating sites may also bind other transcription factors, for example ATF2, which is induced in B cells by CD40 ligation (11).
An upper limit for
1 germline transcription
Thirdly, with this study, we also extended the conclusion that the amount of total
1 germline transcripts has an upper limit, at least in cells treated with LPS + IL-4 or CD40L + IL-4 (21). We studied two new wild-type transgenes (589 and 601) and four NF-
B TM transgenes with high copy numbers and good expression. Despite the increase in total
1 genes per cell to 712 (line 589) or 3050 (line 592), the amount of total
1 germline transcripts did not increase by 5-fold or 20-fold. In fact, the amount of
1 germline transcripts did not increase at all, or at most by
4-fold. Thus, it appears that the
1 genes in a B cell compete for limiting amounts of one or more transcription factors. In B cells treated with IL-4 alone, the transgenes compete reasonably well for the limiting factors, probably because the amount of transcription from the endogenous genes is small. For copy numbers in excess of 15, the majority of the germline transcripts come from the transgene, and can reach as high as 90% of the total transcripts in IL-4-induced B cells (Fig. 4A). On the other hand, in B cells treated with LPS + IL-4 or with CD40L + IL-4, transcription of the endogenous genes is increased several-fold, and the transgenes do not compete as well. The percent transgene expression drops below 40% for lower copy number mice, and to
50% for the high copy number mice. The single exception is line 45, which may be in a particularly favorable insertion site. It is expressed at levels consistent with its copy number, and competes favorably with the endogenous
1 genes in B cells treated with LPS ± IL-4 or CD40L ± IL-4 (Figs 3 and 4). Thus, sequences that lie outside the 17 kb
1 transgene but that are found in the endogenous locus apparently help the endogenous gene to compete for limiting transcription factors during high level transcription. Consistent with this interpretation, we have found that the
1 gene, within a 230 kb transgene of the entire constant region locus, expresses germline transcripts almost equal to that of the endogenous locus on a per gene basis (Dunnick et al., submitted).
| Acknowledgements |
|---|
We thank Jian Shi, David Tyson and Tracy Sturm for technical assistance, and Maggie Van Keuren, Wanda Filipiak and Mark Berard for assistance in preparing transgenic mice. This work was supported by National Institutes of Health grants AI36310 and A150850 to M.T.B. and by grants from the National Cancer Institute, CA39068 to W.A.D. and CA46952 in support of the University of Michigan Transgenic Animal Model Core.
| Notes |
|---|
Transmitting editor: P. Kincade
Received 5 May 2004, accepted 22 September 2004.
| References |
|---|
|
|
|---|
- Stavnezer, J. 2000. Molecular processes that regulate class switching. Curr. Top. Microbiol. Immunol. 245:127.[Web of Science][Medline]
- Manis, J. P., Tian, M. and Alt, F. W. 2002. Mechanism and control of class-switch recombination. Trends Immunol. 23:31.[CrossRef][Web of Science][Medline]
- Stavnezer, J., Radcliffe, G., Lin, Y. C., Nietupski, J., Berggren, L., Sitia, R. and Severinson, E. 1988. Immunoglobulin heavy-chain switching may be directed by prior induction of transcripts from constant-region genes. Proc. Natl Acad. Sci. USA 85:7704.
[Abstract/Free Full Text] - Esser, C. and Radbruch, A. 1989. Rapid induction of transcription of unrearranged S
1 switch regions in activated murine B cells by interleukin 4. EMBO J. 8:483.[Web of Science][Medline]
- Berton, M. T., Uhr, J. W. and Vitetta, E. S. 1989. Synthesis of germ-line
1 immunoglobulin heavy-chain transcripts in resting B cells: induction by interleukin 4 and inhibition by interferon
. Proc. Natl Acad. Sci. USA 86:2829.[Abstract/Free Full Text] - Warren, W. D. and Berton, M. T. 1995. Induction of germ-line
1 and
Ig gene expression in murine B cells: IL-4 and the CD40 ligand-CD40 interaction provide distinct but synergistic signals. J. Immunol. 155:5637.[Abstract]
- Xu, M. Z. and Stavnezer, J. 1992. Regulation of transcription of immunoglobulin germ-line
1 RNA: analysis of the promoter/enhancer. EMBO J. 11:145.[Web of Science][Medline]
- Kotanides, H. and Reich, N. C. 1993. Requirement of tyrosine phosphorylation for rapid activation of a DNA binding factor by IL-4. Science 262:1265.
[Abstract/Free Full Text] - Lin, S. C. and Stavnezer, J. 1996. Activation of NF-
B/Rel by CD40 engagement induces the mouse germ line immunoglobulin C
1 promoter. Mol. Cell. Biol. 16:4591.[Abstract]
- Warren, W. D., Roberts, K. L., Linehan, L. A. and Berton, M. T. 1999. Regulation of the germline immunoglobulin C
1 promoter by CD40 ligand and IL-4: dual role for tandem NF-
B binding sites. Mol. Immunol. 36:31.[CrossRef][Web of Science][Medline]
- Mao, C. S. and Stavnezer, J. 2001. Differential regulation of mouse germline Ig gamma 1 and epsilon promoters by IL-4 and CD40. J. Immunol. 167:1522.
[Abstract/Free Full Text] - Stutz, A. M. and Woisetschlager, M. 1999. Functional synergism of STAT6 with either NF-kappa B or PU.1 to mediate IL-4-induced activation of IgE germline gene transcription. J. Immunol. 163:4383.
[Abstract/Free Full Text] - Shen, C. H. and Stavnezer, J. 1998. Interaction of Stat6 and NF-
B: direct association and synergistic activation of interleukin-4-induced transcription. Mol. Cell. Biol. 18:3395.[Abstract/Free Full Text] - Lin, S. C., Wortis, H. H. and Stavnezer, J. 1998. The ability of CD40L, but not lipopolysaccharide, to initiate immunoglobulin switching to immunoglobulin G1 is explained by differential induction of NF-kappaB/Rel proteins. Mol. Cell. Biol. 18:5523.
[Abstract/Free Full Text] - Doi, T. S., Takahashi, T., Taguchi, O., Azuma, T. and Obata, Y. 1997. NF-kappa B RelA-deficient lymphocytes: normal development of T cells and B cells, impaired production of IgA and IgG1 and reduced proliferative responses. J. Exp. Med. 185:953.[CrossRef][Medline]
- Snapper, C. M., Rosas, F. R., Zelazowski, P., Moorman, M. A., Kehry, M. R., Bravo, R. and Weih, F. 1996. B cells lacking RelB are defective in proliferative responses, but undergo normal B cell maturation to Ig secretion and Ig class switching. J. Exp. Med. 184:1537.
[Abstract/Free Full Text] - Snapper, C. M., Zelazowski, P., Rosas, F. R., Kehry, M. R., Tian, M., Baltimore, D. and Sha, W. C. 1996. B cells from p50/NF-kappa B knockout mice have selective defects in proliferation, differentiation, germ-line CH transcription and Ig class switching. J. Immunol. 156:183.[Abstract]
- Zelazowski, P., Carrasco, D., Rosas, F. R., Moorman, M. A., Bravo, R. and Snapper, C. M. 1997. B cells genetically deficient in the c-Rel transactivation domain have selective defects in germline CH transcription and Ig class switching. J. Immunol. 159:3133.[Abstract]
- Horwitz, B. H., Zelazowski, P., Shen, Y., Wolcott, K. M., Scott, M. L., Baltimore, D. and Snapper, C. M. 1999. The p65 subunit of NF-kappa B is redundant with p50 during B cell proliferative responses and is required for germline CH transcription and class switching to IgG3. J. Immunol. 162:1941.
[Abstract/Free Full Text] - Xu, M. and Stavnezer, J. 1990. Structure of germline immunoglobulin heavy-chain
1 transcripts in interleukin 4 treated mouse spleen cells. Dev. Immunol. 1:11.[Medline]
- Elenich, L. A., Ford, C. S. and Dunnick, W. A. 1996. The gamma 1 heavy chain gene includes all of the cis-acting elements necessary for expression of properly regulated germ-line transcripts. J. Immunol. 157:176.[Abstract]
- Kunsch, C., Ruben, S. M. and Rosen, C. A. 1992. Selection of optimal
B/Rel DNA-binding motifs: interaction of both subunits of NF-
B with DNA is required for transcriptional activation. Mol. Cell. Biol. 12:4412.[Abstract/Free Full Text] - Mowatt, M. R. and Dunnick, W. A. 1986. DNA sequence of the murine
1 switch segment reveals novel structural elements. J. Immunol. 136:2674.[Abstract]
- Bishop, G. A., Warren, W. D. and Berton, M. T. 1995. Signaling via major histocompatibility complex class II molecules and antigen receptors enhances the B cell response to gp39/CD40 ligand. Eur. J. Immunol. 25:1230.[Web of Science][Medline]
- Chomczynski, P. and Sacchi, N. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanatephenolchloroform extraction. Anal. Biochem. 162:156.[Web of Science][Medline]
- Berton, M. T. and Vitetta, E. S. 1992. IL-4-induced expression of germline
1 transcripts in B cells following cognate interactions with T helper cells. Int. Immunol. 4:387.[Abstract/Free Full Text] - Elenich, L. A., Ford, C. S., Collins, J. T. and Dunnick, W. A. 1997. gamma1 heavy chain transgenes are responsive to IFN-gamma repression and CD40 ligation. J. Immunol. 158:4564.[Abstract]
This article has been cited by other articles:
![]() |
F. L. Sinquett, R. L. Dryer, V. Marcelli, A. Batheja, and L. R. Covey Single Nucleotide Changes in the Human I{gamma}1 and I{gamma}4 Promoters Underlie Different Transcriptional Responses to CD40 J. Immunol., February 15, 2009; 182(4): 2185 - 2193. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. T. Thieu, E. T. Nguyen, B. P. McCarthy, H. A. Bruns, R. Kapur, C.-H. Chang, and M. H. Kaplan IL-4-stimulated NF-{kappa}B activity is required for Stat6 DNA binding J. Leukoc. Biol., August 1, 2007; 82(2): 370 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Dryer and L. R. Covey A Novel NF-{kappa}B-Regulated Site within the Human I{gamma}1 Promoter Requires p300 for Optimal Transcriptional Activity J. Immunol., October 1, 2005; 175(7): 4499 - 4507. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






