International Immunology, Vol. 15, No. 2, pp. 167-175,
February 2003
© 2003 Japanese Society for Immunology
CD80 and CD86 C domains play an important role in receptor binding and co-stimulatory properties
Departments of 1 Surgery, and 2 Microbiology and Immunology, University of Illinois at Chicago, Chicago, IL 60612, USA
Correspondence to: M. J. Holterman; E-mail: rmasjet{at}uic.edu
Transmitting editor: W. M. Yokoyama
| Abstract |
|---|
|
|
|---|
CD80 and CD86 expressed on the surface of antigen-presenting cells interact with cytotoxic T lymphocyte antigen-4 [CTLA-4 (CD152)] expressed on activated T cells and mediate critical T cell inhibitory signals. CD80 and CD86 are type I glycoproteins, and are made up of two extracellular (EC) Ig-like domainsa transmembrane region and a cytoplasmic tail. The N-terminal (V domain) and membrane-proximal (C) domains share homology with the variable region (V) and the constant region (C) of Ig respectively. Co-crystallographic structures of both CD80 and CD86 bound to CTLA-4 indicate that there is no direct interaction of the C domain of either CD80 or CD86 with the CTLA-4. In contrast, previous mutagenesis studies have identified specific amino acids within the C domain of CD80 that are critical for CTLA-4 binding. To further understand the importance of C domains in the functioning of CD80 and CD86, we constructed chimeric human CD80 and CD86 molecules by swapping their respective C domains, and tested their ability to stimulate T cells. A Chinese hamster ovary (CHO) cell line expressing CD86 activated murine T cells. In contrast, CHO cells expressing either CD80 or a chimeric construct of the CD86 V domain and the CD80 C domain showed a significantly reduced activation. Our studies further demonstrated that the decreased activation by cells expressing the CD80 or a chimera containing CD80 C domain is most likely due to enhanced CTLA-4 binding. From these results we conclude that C domains play a critical, albeit indirect, role in determining CTLA-4 binding affinities and co-stimulatory properties.
Keywords: cellular activation, co-stimulation, T lymphocyte
| Introduction |
|---|
|
|
|---|
The T cell immune response requires co-stimulatory signals delivered through one or more receptors on the surface of T cells. One of the most important T cell co-stimulatory pathways is initiated when the CD28 binds to the B7 ligands, B7-1 (CD80) and B7-2 (CD86), on the antigen-presenting cells (14). B7 molecules also bind to cytotoxic T lymphocyte (CTL) antigen-4 (CTLA-4), a protein homologous to CD28, but with a much higher avidity than to CD28 (5,6). CTLA-4, unlike CD28, is not expressed constitutively and its expression is up-regulated upon T cell activation. B7 molecules have higher affinity, and, therefore, readily bind to CTLA-4 and down-modulate T cell activity. Thus, CD28B7 ligation enhances T cell proliferation and B7CTLA-4 interaction inhibits the T cell responses.
CD80 and CD86 are members of the Ig gene superfamily, and are comprised of two extracellular Ig-like domains (ECD) linked to a transmembrane domain and a cytoplasmic tail. The N-terminal domain has sequence homology with the Ig variable domain (V domain), whereas the membrane proximal ECD has more homology with the Ig-constant region (C domain) (7,8). CTLA-4 and CD28 are also structurally related, and are expressed at the cell surface as homodimers of single V-like domains (9).
There are conflicting reports on functional differences between CD80 and CD86. While some investigators have suggested that CD80 and CD86 provide similar co-stimulatory signals for T cell proliferation, cytokine production and generation of CTL (10,11), others demonstrated that they produce contrasting effects (1214). DNA vaccination studies suggest that only CD86, but not CD80, supports an HIV peptide-specific CTL response (15,16). Other studies indicated that CD80 could negatively regulate T cell activation induced by either mitogens or specific antigens, while CD86 can positively regulate T cell activation through CD28-mediated signals (1719).
Experiments using CD80 and CD86 knockout animals demonstrated that although either molecule can support DNA vaccine-elicited responses, they may differ in their role depending on the type of antigen and adjuvant used (2022). Mice lacking CD86 were unable to generate a CTL response to an HIV peptide in a DNA vaccination experiment, but this could be reconstituted by administering plasmid expressing either CD80 or CD86 (21,22). Further, it has also been shown that absence of CD86, but not CD80, greatly reduced the CTL response of purified CD8+ cells to allogeneic cells (23). Although the reasons for the conflicting results are not clear, it could be due to differences in the experimental approaches, including the use of ligands and receptors from different species. However, earlier studies have shown that CD80 and CD86 interact similarly with their receptors from other species and produce similar effects (15,2426). Therefore, the reasons for the differences seen in co-stimulatory signals initiated by CD80 and CD86 are not fully known. One critical determinant could be the differences in the peak expression of CD80/CD86/CD28/CTLA-4. Both CD86 and CD28 are constitutively expressed at high levels (1,4), whereas CD80 and CTLA-4 expression is induced, and their surface expression peaks 2448 h after the induction (1,4). Another important difference may be in the binding kinetics, since CD86 shows faster dissociation kinetics from CTLA-4 than does CD80 (5).
Mutational and structural studies have been used to understand the importance of various domains, within CD80/CD86, for interaction with their receptors. Results from these studies showed that amino acids within both the V and C domains of CD80 and the V domain of CD86 can significantly affect CD28-induced co-stimulation and CTLA-4Ig binding affinities (27). Furthermore, C domain deletion mutants of CD80 decreased CTLA-4 binding affinities, and insertion of two additional amino acids between the V and the C domain of CD80, but not CD86, abrogated CTLA-4 binding (28). These studies showed that addition or deletion of certain amino acids could significantly alter the function of the protein. In contrast to these mutational studies, the crystal structure of the CTLA-4CD80 complex shows that there is no direct interaction between the CD80 C domain and CTLA-4 (29). The co-crystal structure of CTLA-4 and the isolated V domain of CD86 show similar binding interactions (30). Collectively, these results show that the V domain, not the C domain, of CD86 and CD80 directly interacts with CD28 and CTLA-4, and that the V domains of CD80 and CD86 alone are capable of providing effective co-stimulation through the CD28 receptor (31).
Therefore, in this study, in order to understand the role of C domains of CD80 and CD86, we prepared chimeric constructs in which we exchanged the C domains of the human CD80 and CD86 molecules, and used them to address the role of the C domain in T cell activation both in vitro and in vivo.
| Methods |
|---|
|
|
|---|
Animals
Female BALB/c mice (68 weeks old) were purchased from Jackson Laboratories (Bar Harbor, ME) and housed in accordance with animal care guidelines at the Biological Resource Laboratories at the University of Illinois at Chicago.
Antibodies and CTLA-4Ig
FITC- or phycoerythrin (PE)-labeled mAb to ectodomains of CD80 and CD86, i.e. clones MEM-233 and BU63 (Caltag, San Francisco, CA), clones BB1, IT2.2 and L307.4 (BD PharMingen, San Diego, CA), clones 37711.111 and 37301.111 (R & D Systems, Minneapolis, MN), clone Dal1 (Serotec, Raleigh, NC), and goat polyclonal antibodies (pAb) to ectodomains of CD80 and CD86 (R & D Systems) along with FITC-labeled rabbit anti-goat IgG were used in flow cytometry. Paired antibodies and required cytokine standards for detecting mouse IL-2 and IFN-
(BD PharMingen) were used in ELISA. Recombinant mouse CTLA-4Ig (rmCTLA-4Ig) was purchased from R & D Systems and used in the binding assay.
Preparation of C domain exchange gene constructs
Human CD80 and CD86 cDNAs were obtained from Dr Rafick Sekaly (Montreal Quebec, Canada). CD80 and CD86 genes were PCR amplified and ligated into pSR
neo1+ vector (Generous gift of Dr Francois Denis, Sherbrooke, Canada) downstream of the SR
promoter to make pCD80 and pCD86 expression vectors. V and C domain chimeras were generated by PCR amplification using the Expand High Fidelity Polymerase System (Boehringer-Mannheim, Mannheim, Germany). The following primers were used in these reactions:
A:CTGCTTGCTCAACTCTACGTC (forward, vector)
B:CTGAAGTTAGCTTTGACTGATAACG (reverse, CD80)
C:GCAATAGCATCACAAATTTCA (reverse, vector)
D:TCAGTCAAAGCTAACTTCAGTCAACC (forward, CD86)
E:GGGAAGTCAGCAAGCACTGACAGTTC (reverse, CD86)
F:TCAGTGCTTGCTGACTTCCCTACACC (forward, CD80)
G:TACGGCCGCCTCGAGACCTGCTTCCCATCCT (forward, T80)
H:TACGGCCGTCGACCAGACCACATTCCTT (forward, T86)
I:CAGGTCTCGAGGAAAATGCTCTTGCTTGGTG (reverse, T80)
J:GTCTGGTCGACGCTGAGGGTCCTCAAGCTC (reverse, T86)
The V domain of CD80 was amplified using primers A + B; the C domain, transmembrane (TM) and cytoplasmic tail (T) of CD86 were amplified using primers C + D. These fragments were then purified, combined and used as templates in second step PCR reaction using forward (A) and reverse (C) primers. The PCR product was ligated into the pSR
neo1+ vector and the resultant plasmid (pV80C86T86) could encode a chimeric molecule expressing the V domain of CD80, and C, TM and T regions of CD86. The plasmid pV86C80T80 was created in a similar way using primers A + E and C + F as in the first step, and the resulting fragments were combined and expanded with the A + C primers. Restriction sites were then introduced at the junction of the C domain and the TM region of CD80 (XhoI) and CD86 (SalI) using primers G + I and H + J respectively, and reverse and forward primers of vector (primers A + C). These products were digested using respective enzymes, and ligated to produce pV80C86T86 and pV86C80T80 constructs with added restriction sites. The pV86C80T80 construct was digested with XhoI and BamHI, and the pV80C86T86 construct with SalI and BamHI, to releaseT80 and T86 fragments respectively. The C domain exchange chimeras of CD80 and CD86 were generated by religation of appropriate fragments. pSR
neo1+ vector containing these chimeras in which the C domain was exchanged were designated pV80C86T80 and pV86C80T86. In pSR
neo1+, the cloned cDNA expression is under the control of the SR
promoter, consisting of the SV-40 early promoter, and the R segment and part of the U5 sequence (R-U5') of the long terminal repeat of human T cell leukemia virus type 1. All constructs were sequenced to verify the accuracy of PCR products and cloning.
Expression of plasmids
Chinese hamster ovary (CHO) cells were transfected with pCD80, pCD86, pV80C86T80 or pV86C80T86 by electroporation using 950 µF capacitance and 250 V using Gene Pulse (Bio-Rad, Hercules, CA). Cells were selected, using G-418, for stable expression of either wild-type or chimeric proteins. Cells showing high-level expression of cDNA were sorted using a flow cytometer and expanded in culture. Protein expression was monitored by FACS analysis prior to use in each functional assay. Cells transfected with vector alone and selected were used as negative control.
FACS analysis
The surface expression of chimeric proteins was confirmed using a series of pAb and mAb to the ectodomains of CD80 or CD86. cDNA transfected CHO cells and control cells (10 x 105) were stained with 1 µg of either anti-CD80 or anti-CD86 antibodyPE or FITC conjugates and subjected to FACS analyses. Data were analyzed using CellQuest data acquisition software (Becton Dickinson, Franklin Lakes, NJ).
CTLA-4 binding assay
Either control CHO cells or CHO cells expressing wild-type or chimeric CD80 and CD86 molecules (1 x 106) were incubated with varying concentrations of rmCTLA-4Ig for 10 min on ice. Cells were washed once using 2% FBS in PBS and incubated with an optimal dilution of PE-labeled anti-human IgG antibody for 10 min. These cells were washed and subjected to FACS analysis.
Similarly, to detect CTLA-4 expression on T cells, we stimulated 1 x 106 CD4+ T cells with concanavalin A (Con A; 1 µg/ml) for 48 h at 37°C, and then the cells were washed and stained with PE-labeled anti-mouse CTLA-4 antibody (2 µg/1 x 106 cells). Cells stained with PE-labeled isotype-matched antibody served as controls. Cells were washed and analyzed by FACS as mentioned above.
T cell proliferation
Spleens and lymph nodes were collected from 8-week-old BALB/c mice, single-cell suspensions were prepared, and CD4+ T cells were isolated using magnetic beads coupled with anti-mouse CD4 antibody and magnetic separation columns by following the manufacturers directions (Miltenyi Biotec, Auburn, CA). After mitomycin C treatment, control CHO cells or CHO cells expressing CD80, CD86, V80C86T80 or V86C80T86 were plated in 96-well tissue culture plates in triplicate (5 x 104 cells/100 µl/well) and 50 µl of Con A at a final concentration of 1 µg/ml was added. CD4+ T cells were added to these wells (5 x 105 cells/100 µl/well) and incubated in a CO2 incubator. Supernatants were collected after 48 h from these plates to determine cytokine production. After 72 h, cells were pulsed with 1 µCi/well of [3H]thymidine for 18 h in 100 µl RPMI 1640 medium supplemented with 1% normal mouse serum. Cells were harvested and [3H]thymidine incorporation was measured using a Microbeta scintillation counter (Perkin-Elmer Wallac, Gaithersburg, MD). A similar assay also was carried out in the presence of Fab fragments of anti-CTLA-4 antibodies.
Induction of xenoresponse
Control CHO cells or CHO cells expressing CD80, CD86, V80C86T80 or V86C80T86 were injected into 8-week-old BALB/c mice i.p. (1 x 107 cells/mice) on days 0 and 10. Mice were sacrificed on day 20, spleens were collected, and single-cell suspensions were made and used in ex vivo assays.
Ex vivo assays
T cell proliferation against CHO cells or CHO cells expressing wild-type or chimeric proteins was tested as described above using spleen cells. Cytotoxicity was assessed using a standard 51Cr-release assay. In brief, splenocytes from naive mice or mice primed with control CHO cells or CHO cells expressing wild-type or chimeric proteins were incubated in 12-well tissue culture plates (1 x 106 cells/well) along with mitomycin C-treated control CHO cells or CHO cells expressing various CD80/CD86 proteins (1 x 105 cells/well). After 96 h, lymphocytes from these wells were collected, counted and plated into 96-well plates along with 51Cr-pulsed CHO cells at varying E:T cell ratios. Following incubation at 37°C for 6 h, 100 µl of supernatant was harvested from each well and 51Cr release was measured using a Wallac
-counter (Gaithersburg, MD). Spontaneous release was measured from cells cultured in medium alone and maximal release was measured from cells lysed with 1 N HCl. Specific lysis was calculated using the equation: % specific lysis = [(counts sample counts spontaneous)/counts maximal counts spontaneous)] x 100.
Cytokine production
Triplicate samples of cell-free culture supernatants were collected after 48 h incubation of cells, as described above in in vitro and ex vivo assays, and stored at 80°C until use. These supernatants were tested for the release of IL-2 and IFN-
using commercially available ELISA reagents, following manufacturers instructions (PharMingen and Caltag). Plates were read using a microplate reader (Bio-Rad) at 450 nm and the concentrations of different cytokines were calculated against respective standards.
Statistical analysis
P values (statistical significance) were determined using one-tailed Students t-test in which each experimental group was compared individually with the control experiment where vector-transfected CHO cells were used.
| Results and discussion |
|---|
|
|
|---|
C domain of CD80 prevents co-stimulatory signals
In this investigation, we analyzed the importance of C domains of the CD80 and CD86 molecules for CTLA-4 binding, and consequent effects on T cell activation. Domain swapping has been used earlier to generate useful information on protein structure/function (3234). Therefore, we constructed C domain exchange chimeras of CD80 and CD86 (Fig. 1A), expressed them in CHO cells, and then evaluated their effects on T cell activation. The surface expression of wild-type and chimeric constructs was tested using a number of different mAb and pAb against the ectodomains of CD80 and CD86 (Fig. 1B). Staining with pAb showed that the integrity of the chimeric proteins is maintained. While wild-type CD80 and CD86 showed slightly higher pAb binding, as expected, cells expressing chimeric proteins showed reduced binding. Lower reactivity shown by pAb anti-CD86 against V80C86T80 relative to V86C80T86 and pAb anti-CD80 against V86C80T86 relative to V80C86T80 is most likely due to weak immunogenicity of the C domain. Since mAb directed against the C domain are currently unavailable, we used four different mAb, with unique binding specificities, directed against the V domain of either CD80 or CD86. These antibodies bound well to their corresponding targets, indicating that the V domain structure was not dramatically altered as a consequence of C domain swapping.
|
Murine CD4+ T cells were stimulated with Con A, in the presence of CHO cells expressing either wild-type or chimeric human CD80/CD86 molecules. As shown by both T cell proliferation and IL-2 production, CD80 had a negligible effect on T cell activation, while CD86 co-stimulation supported strong T cell activation by Con A (Fig. 2). This is consistent with earlier reports in which only human CD86, but not human CD80, could support an anti-HIV peptide immune response following DNA vaccination of mice (15,16). Like CD86, the V80C86T80 chimera showed a substantial increase in T cell activation relative to CD80; in contrast, relative to CD86, V86C80T86 significantly diminished T cell activation. These results showed that the C domain can affect CD80/CD86 function.
|
Similar responses were obtained when human peripheral blood CD4+ cells were stimulated with phytohemagglutinin in the presence of CHO cells expressing these molecules (results not shown). The above observations and other earlier reports (15,16,3537) indicate that human CD80 and CD86 molecules can effectively interact with murine T cells. For this reason and to be able to test their role in in vivo response, we used the mouse system throughout this study.
Blocking xenogeneic immune responses
Xenogenic tissues induce direct T cell activation, reflecting the ability of co-stimulatory molecules to function across species barriers (15,3739). Blockade of co-stimulatory pathways using CTLA-4Ig or blocking antibodies can induce significantly prolonged survival of xenotransplants and long-lasting tolerance (37,38). Therefore, we investigated the effects of wild-type and chimeric molecules on the xenogeneic immune response.
In the first set of experiments, mice were immunized with normal CHO cells and the primed spleen cells from these mice were incubated with CHO cells or CHO cells expressing wild-type and chimeric ligands. As shown in Fig. 3(AD), co-stimulation with CD86 enhanced T cell activation as measured by T cell proliferation, IL-2 and IFN-
production, and cytotoxicity. In contrast, the T cell response to CD80 resulted in a down-modulation of the T cell response when compared to the response generated by untransfected CHO cells. Co-stimulation with the V86C80T86 chimera had an effect similar to that of CD80, while the V80C86T80 chimera, similar to CD86, demonstrated an enhanced T cell activation. These observations further demonstrated the influence of C domains on the function of CD80 and CD86 in vitro.
|
This inhibitory effect was also seen in their ability to induce responses in vivo. Mice were immunized with CHO cells or CHO cells expressing various wild-type or chimeric co-stimulatory ligands. Later, the spleen cells were harvested from these immunized animals and the cells were either re-stimulated in vitro with untransfected CHO cells or re-stimulated with the same transfected CHO cell with which they had been immunized originally. As shown in Fig. 4, CD80 and V86C80T86 induced substantially lower xenoresponses (i.e. T cell proliferation, IL-2 and IFN-
responses, and cytotoxicity) in mice compared to either CHO cells or CHO cells expressing CD86 or V80C86T80. This inhibitory effect did not change significantly by the in vitro stimulation with the untransfected CHO cell. This suggests that in vivo inhibitory effect induced by CD80 and V86C80T86 persists, and cannot be readily reversed in vitro.
|
It could be argued that the lower level of CD80 expression on CHO cells as seen in Fig. 1 may have been responsible for the inhibition or lowered co-stimulation observed in the presence of CD80 compared to CD86. Interestingly, the V86C80T86 chimera, although expressed at a comparable level to that of CD86 and V80C86T80, also induced an inhibitory effect. This strongly suggests a differential functional role for the C domains of CD80 and CD86. The inhibition of co-stimulation in the presence of molecules containing the CD80 C domain was clearly seen in our xeno-immune response model (Figs 3 and 4).
C domain-induced immunomodulation is mediated by CTLA-4
To test whether the decreased stimulation seen in the presence of the CD80 C domain is at least in part due to increased binding to CTLA-4, we analyzed the effect of a CTLA-4 specific blocking antibody. As shown in Fig. 5, CTLA-4 expression was up-regulated after Con A stimulation, and levels of expression were comparable to the levels seen after stimulation with either an antigen, a mitogen or a combination of phorbol myristate acetate and ionomycin that have been previously reported by others (17,18,40,41). This suggested that early after mitogenic stimulation, CTLA-4 is up-regulated on T cells, and its interaction with CD80 and V86C80T86 could lead to suppression of T cells. This was confirmed by using anti-CTLA-4 Fab fragments to block CTLA-4 interactions with its ligands. The use of this antibody enhanced T cell activation in all cases except CD86 (Fig. 6A and B). This enhancement was especially striking with the wild-type CD80 and V86C80T86 in which suppression of both T cell proliferation and IL-2 production was most profound. This again shows that lower responses seen in Figs 3 and 4 in the presence of CD80 are not due to lower expression, but because of more efficient interaction with CTLA-4. There was only a modest increase in T cell activation with either CD86 or V80C86T80 when cultures were supplemented with anti-CTLA-4 Fab antibody. This lack of significant inhibition of co-stimulation by CD86 C domain-containing molecules strongly suggests that the CD86 and V80C86T80 molecules, unlike CD80 and V86C80T86, may have weaker binding to CTLA-4, and that the binding to CTLA-4 is somehow affected by the C domain.
|
|
C domain of CD80 indirectly influences CTLA-4 binding
To test whether different T cell co-stimulatory effects were due to differences in binding to CTLA-4, we compared CTLA-4Ig binding to wild-type and chimeric CD80 and CD86. CD80 showed higher binding to CTLA-4 compared to CD86 (Fig. 7). Although the levels of surface expression of both chimeric molecules on CHO cells were comparable, the transfer of the CD80 C domain to the CD86 molecule (V86C80T86) increased the binding to CTLA-4. Conversely, placing the CD86 C domain in CD80 (V80C86T80) reduced the binding to CTLA-4 considerably (Fig.7).
|
This study was primarily focused on addressing the issue of differences in the co-stimulatory function of CD80 and CD86. In particular, we investigated how these functional differences relate to interactions with CTLA-4 and looked for structural motifs that affected CTLA-4 interactions. As described earlier, in the normal biologic situation the time of expression and the receptor ligand density on the surface of the cells play an important role in these differences. However, when these ligands are constitutively expressed individually, the differences seen in their function would relate to the differences in their tertiary structure and binding affinity to their receptors. Domain exchange can address the issue of differences in tertiary and quaternary structures that contribute to the receptorligand binding strength and dimerization. The present study clearly demonstrates that human CD80, relative to human CD86, can bind well to murine CTLA-4 and suppress murine T cell activation, and that the C domain can indirectly influence binding of CD80 and CD86 to CTLA-4 and plays a significant role, albeit indirect, in regulating T cell activation. We hypothesize that these effects are indirect, primarily based on co-crystallization studies that demonstrated that C domains of CD80 and CD86 do not directly interact with either CD28 or CTLA-4. Our results could be explained if the C domain influences the structure of principal CTLA-4 binding regions on the variable domains of these molecules; in other words, the C domain of CD86 induces conformational constraints limiting the binding of the relatively fixed CTLA-4 homodimer. An alternative explanation is that the C domain of CD80 permits CD80 dimerization that further stabilizes the oligomerization of the CTLA-4 dimer with the CD80 dimer. In fact, it has been previously reported that soluble CD80 forms parallel, 2-fold rotationally symmetric homodimers in the crystal lattice (42). If this were true, then it would suggest that the C domain of CD86 does not allow dimerization. By extension, therefore, the initial low-affinity interactions between CTLA-4 and CD86 are not stable enough to allow CTLA-4-mediated suppression. Our data, supported by the work of others (6,27), show the importance of the C domain of the CD80 molecule in co-stimulation. Our results suggest that the differential co-stimulatory effects of CD80 versus CD86 reside not exclusively within the receptor-binding domain (V domain), but also in the C domain because of its influence on the overall conformation of the molecule. Similarly, other differences in T cell function induced upon CD80 and CD86 engagement may also be dependent on structural motif differences within the C domain of CD80 and CD86. A complete understanding of the structural components of these two important B7 ligands that contribute to their functional differences could have therapeutic implications.
| Acknowledgements |
|---|
This work is supported by the Department of Surgery, University of Illinois at Chicago, National Institute of Health grant HHSDK4741705A2.
| Abbreviations |
|---|
APCantigen-presenting cell
CHOChinese hamster ovary
Con Aconcanavalin A
CTLcytotoxic T lymphocyte
CTLA-4cytotoxic T lymphocyte antigen-4
ECDextracellular Ig-like domain
pAbpolyclonal antibody
PEphycoerythrin
| References |
|---|
|
|
|---|
- Lenschow, D. J., Walunas, T. L. and Bluestone, J. A. 1996. CD28/B7 system of T cell co-stimulation. Annu. Rev. Immunol. 14:233.[CrossRef][ISI][Medline]
- Salomon, B and Bluestone, J. A. 2001. Complexities of Cd28/B7: ctla-4 co-stimulatory pathways in autoimmunity and transplantation. Annu. Rev. Immunol. 19:225.[CrossRef][ISI][Medline]
- Chambers, C. A. 2001. The expanding world of co-stimulation: the two-signal model revisited. Trends Immunol. 22:217.[CrossRef][ISI][Medline]
- Greenfield, E. A., Nguyen, K. A. and Kuchroo, V. K. 1998. CD28/B7 co-stimulation: a review. Crit. Rev. Immunol. 18:389.[ISI][Medline]
- Van der Merwe, P. A., Bodian, D. L. S., Daenke, P., Linsely, P. S. and Davis, S. J. 1997. CD80 binds both CD28 and CTLA-4 with a low affinity and very fast kinetics. J. Exp. Med. 185:393.
[Abstract/Free Full Text] - Greene, J. L., Leytze, G. M., Emswiler, J., Peach, R., Bajorath, J., Cosand, W. and Linsley, P. S. 1996. Covalent dimerization of CD28/CTLA-4 and oligomerization of CD80/CD86 regulate T cell co-stimulatory interactions. J. Biol. Chem. 271:26762.
[Abstract/Free Full Text] - Freeman, G. J., Freedman, A. S., Segil, J. M., Lee, G., Whitman, J. F. and Nadler, L. M. 1989. B7, a new member of the Ig superfamily with unique expression on activated and neoplastic B cells. J. Immunol. 143:2714.[Abstract]
- Azuma, M., Ito, D., Yagita, H., Okumura, K., Phillips, J. H., Lanier, L. L. and Somoza, C. 1993. B70 antigen is a second ligand for CTLA-4 and CD28. Nature 366:76.[CrossRef][Medline]
- Rennert, P., Furlong, K., Jellis, C., Greenfield, E., Freeman, G. J., Ueda, Y., Levine, B., June, C. H. and Gray, G. S. 1997. The IgV domain of human B7-2 (CD86) is sufficient to co-stimulate T lymphocytes and induce cytokine secretion. Int. Immunol. 9:805.
[Abstract/Free Full Text] - Lanier L. L., OFallon, S., Somoza, C., Phillips, J. H., Linsley, P. S., Okumura, K., Ito, D. and Azuma, M. 1995. CD80 (B7) and CD86 (B70) provide similar co-stimulatory signals for T cell proliferation, cytokine production, and generation of CTL. J. Immunol. 154:97.[Abstract]
- Schweitzer, A. N., Borriello, F., Wong, R. C., Abbas, A. K. and Sharpe, A. H. 1997. Role of co-stimulators in T cell differentiation: studies using antigen-presenting cells lacking expression of CD80 or CD86. J. Immunol. 158:2713.[Abstract]
- Freeman, G. J., Boussiotis, V. A., Anumanthan, A., Bernstein, G. M., Ke, X. Y., Rennert, P. D., Gray, G. S., Gribben, J. G. and Nadler, L. M. 1995. B7-1 and B7-2 do not deliver identical co-stimulatory signals, since B7-2 but not B7-1 preferentially co-stimulates the initial production of IL-4. Immunity 2:523.[CrossRef][ISI][Medline]
- Kuchroo, V. K., Das, M. P., Brown, J. A., Ranger, A. M., Zamvil, S. S., Sobel, R. A., Weiner, H. L., Nabavi, N. and Glimcher, L. H. 1995. B7-1 and B7-2 co-stimulatory molecules activate differentially the Th1/Th2 developmental pathways: application to autoimmune disease therapy. Cell 80:707.[CrossRef][ISI][Medline]
- Matulonis, U., Dosiou, C., Freeman, G., Lamont, C., Mauch, P., Nadler, L. M. and Griffin, J. D. 1996. B7-1 is superior to B7-2 co-stimulation in the induction and maintenance of T cell-mediated antileukemia immunity. Further evidence that B7-1 and B7-2 are functionally distinct. J. Immunol. 156:1126.[Abstract]
- Agadjanyan, M. G., Kim, J. J., Trivedi, N., Wilson, D. M., Monzavi-Karbassi, B., Morrison, L. D., Nottingham, L. K., Dentchev, T., Tsai, A., Dang, K., Chalian, A. A., Maldonado, M. A., Williams, W. V. and Weiner, D. B. 1999. CD86 (B7-2) can function to drive MHC-restricted antigen-specific CTL responses in vivo. J. Immunol. 162:3417.
[Abstract/Free Full Text] - Kim, J. J., Bagarazzi, M. L., Trivedi, N., Hu, Y., Kazahaya, K., Wilson, D. M., Ciccarelli, R., Chattergoon, M. A., Dang, K., Mahalingam, S., Chalian, A. A., Agadjanyan, M. G., Boyer, J. D., Wang, B. and Weiner, D. B. 1997. Engineering of in vivo immune responses to DNA immunization via codelivery of co-stimulatory molecule genes. Nat. Biotechnol. 15:641.[CrossRef][ISI][Medline]
- Boulougouris, G., McLeod, J. D., Patel, Y. I., Ellwood, C. N., Walker, L. S. and Sansom, D. M. 1998. Positive and negative regulation of human T cell activation mediated by the CTLA-4/CD28 ligand CD80. J. Immunol. 161:3919.
[Abstract/Free Full Text] - Inobe, M., Aoki, N., Linsley, P. S., Ledbetter, J. A., Abe, R., Murakami, M. and Uede, T. 1996. The role of the B7-1a molecule, an alternatively spliced form of murine B7-1 (CD80), on T cell activation. J. Immunol. 157:582.[Abstract]
- Chai, J. G., Vendetti, S., Amofah, E., Dyson, J. and Lechler, R. 2000. CD152 ligation by CD80 on T cells is required for the induction of unresponsiveness by co-stimulation-deficient antigen presentation. J. Immunol. 165:3037.
[Abstract/Free Full Text] - Fló, J, Tisminetzky, S. and Baralle, F. 2000. Modulation of the immune response to DNA vaccine by co-delivery of co-stimulatory molecules. Immunology 100:259.[CrossRef][ISI][Medline]
- Santra, S., Barouch, D. H., Jackson, S. S., Kuroda, M., Schmitz, J. E., Lifton, M. A., Sharpe, A. H. and Letvin, N. L. 2000. Functional equivalency of B7-1 and B7-2 for co-stimulating plasmid DNA vaccine-elicited CTL responses. J. Immunol. 165:6791.
[Abstract/Free Full Text] - Santra, S., Barouch, D. H., Sharpe, A. H. and Letvin, N. L. 2000. B7 co-stimulatory requirements differ for induction of immune responses by DNA, protein and recombinant pox virus vaccination. Eur. J. Immunol. 30:2650.[CrossRef][ISI][Medline]
- McAdam. A. J., Gewurz, B. E., Farkash, E. A. and Sharpe, A. H. 2000. Either B7 co-stimulation or IL-2 can elicit generation of primary alloreactive CTL. J. Immunol. 165:3088.
[Abstract/Free Full Text] - Vaughan, A. N., Malde, P., Rogers, N. J., Jackson, I. M., Lechler, R. I. and Dorling, A. 2000. Porcine CTLA4Ig lacks a MYPPPY motif, binds inefficiently to human B7 and specifically suppresses human CD4+ T cell responses co-stimulated by pig but not human B7. J. Immunol. 165:3175.
[Abstract/Free Full Text] - Milich, D. R., Linsley, P. S., Hughes, J. L. and Jones, J. E. 1994. Soluble CTLA-4 can suppress autoantibody production and elicit long term unresponsiveness in a novel transgenic model. J. Immunol. 153:429.[Abstract]
- Blazar, B. R., Taylor, P. A., Linsley, P. S. and Vallera, D. A. 1994. In vivo blockade of CD28/CTLA4: B7/BB1 interaction with CTLA4Ig reduces lethal murine graft-versus-host disease across the major histocompatibility complex barrier in mice. Blood 83:3815.
[Abstract/Free Full Text] - Peach, R. J., Bajorath, J., Naemura, J., Leytze, G., Greene, J., Aruffo, A. and Linsley, P. S. 1995. Both extracellular immunoglobulin-like domains of CD80 contain residues critical for binding T cell surface receptors CTLA-4 and CD28. J. Biol. Chem. 270:21181.
[Abstract/Free Full Text] - Ellis, J. H., Burden, M. N., Vinogradov, D. V., Linge, C. and Crowe, J. S. 1996. Interactions of CD80 and CD86 with CD28 and CTLA-4. J. Immunol. 156:2700.[Abstract]
- Stamper, C. C., Zhang, Y., Tobin, J. F., Erbe, D. V., Ikemizu, S., Davis, S. J., Stahl, M. L., Seehra, J., Somers, W. S. and Mosyak, L. 2001. Crystal structure of the B7-1/CTLA-4 complex that inhibits human immune responses. Nature 410:608.[CrossRef][Medline]
- Schwartz, J. C., Zhang, X., Fedorov, A. A., Nathenson, S. G. and Almo, S. C. 2001. Structural basis for co-stimulation by the human CTLA-4/B7-2 complex. Nature 410:604.[CrossRef][Medline]
- Rennert, P., Furlong, K., Jellis, C., Greenfield, E., Freeman, G. J., Ueda, Y., Levine, B., June, C. H. and Gray, G. S. 1997. The IgV domain of human B7-2 (CD86) is sufficient to co-stimulate T lymphocytes and induce cytokine secretion. Int. Immunol. 9:805.
[Abstract/Free Full Text] - Kamata, T., Tieu, K. K., Irie, A., Springer, T. A. and Takada, Y. 2001. Amino acid residues in the alpha IIb subunit that are critical for ligand binding to integrin alpha IIbbeta 3 are clustered in the beta-propeller model. J. Biol. Chem. 276:44275.
[Abstract/Free Full Text] - Adak, S., Aulak, K. S. and Stuehr, D. J. 2001. Chimeras of nitric-oxide synthase types I and III establish fundamental correlates between heme reduction, hemeNO complex formation, and catalytic activity. J. Biol. Chem. 276:23246.
[Abstract/Free Full Text] - Tang, J. G. and Koeffler, H. P. 2001. Structural and functional studies of CCAAT/enhancer-binding protein epsilon. J. Biol. Chem. 276:17739.
[Abstract/Free Full Text] - Lenschow, D. J., Ho, S. C., Sattar, H., Rhee, L., Gray, G., Nabavi, N., Herold, K. C. and Bluestone, J. A. 1995. Differential effects of anti-B7-1 and anti-B7-2 monoclonal antibody treatment on the development of diabetes in the nonobese diabetic mouse. J. Exp. Med. 181:1145.
[Abstract/Free Full Text] - Maher, S. E., Karmann, K., Min, W., Hughes, C. C., Pober, J. S. and Bothwell, A. L. 1996. Porcine endothelial CD86 is a major co-stimulator of xenogenic human T cells: cloning, sequencing and functional expression in human endothelial cells. J. Immunol. 157:3839.
- Rogers, N. J., Mirenda, V., Jackson, I., Dorling, A. and Lechler, R. I. 2000. Co-stimulatory blockade by the induction of an endogenous xenospecific antibody response. Nat Immunol. 1:163.[CrossRef][ISI][Medline]
- Lenschow, D. J., Zeng, Y., Thistlethwaite, J. R., Montag, A., Brady, W., Gibson, M., Linsley, P. S. and Bluestone, J. A. 1992. Long-term survival of xenogenic pancreatic islet grafts induced by CTLA-4Ig. Science 257:789.
[Abstract/Free Full Text] - Larsen, C. P., Elwood, E. T., Alexander, D. Z., Ritchie, S. C., Hendrix, R., Tucker-Burden, C., Cho, H. R., Aruffo, A., Hollenbaugh, D., Linsley, P. S., Winn, K. J. and Pearson, T. C. 1996. Long-term acceptance of skin and cardiac allografts after blocking CD40 and CD28 pathways. Nature 381:434.[CrossRef][Medline]
- Wakikawa, A., Utsuyama, M. and Hirokawa, K. 1997. Altered expression of various receptors on T cells in young and old mice after mitogenic stimulation: a flow cytometric analysis. Mech. Ageing Dev. 94:113.[CrossRef][ISI][Medline]
- Xia, M., Gasser, J. and Feige, U. 1999. Dexamethasone enhances CTLA-4 expression during T cell activation. Cell. Mol. Life. Sci. 55:1649.[CrossRef][ISI][Medline]
- Ikemizu, S., Gilbert, R. J., Fennelly J. A., Collins A. V., Harlos K., Jones E. Y., Stuart, D. I. and Davis, S. J. 2000. Structure and dimerization of a soluble form of B7-1. Immunity 12:51.[CrossRef][ISI][Medline]
This article has been cited by other articles:
![]() |
N. Perez, S. Karumuthil-Melethil, R. Li, B. S. Prabhakar, M. J. Holterman, and C. Vasu Preferential Costimulation by CD80 Results in IL-10-Dependent TGF-{beta}1+-Adaptive Regulatory T Cell Generation J. Immunol., May 15, 2008; 180(10): 6566 - 6576. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







