International Immunology, Vol. 15, No. 11, pp. 1389-1399,
November 2003
© 2003 Japanese Society for Immunology
CD75s is a marker of murine CD8+ suppressor T cells
1 Department of Pathology, Emory University School of Medicine, Atlanta, GA 30322, USA 2 Complex Carbohydrate Research Center, University of Georgia, Athens, GA, USA 3 Institut für Immunologie, University of Dresden, Dresden, Germany 4 Department of Ophthalmology, Emory University School of Medicine, Atlanta, GA 30322, USA
Correspondence to: J. Kapp, Department of Ophthalmology, Emory University, School of Medicine, Building B, Room 2602, 1365 Clifton Road, NE, Atlanta, GA 30322, USA. E-mail: jkapp{at}emory.edu
Transmitting editor: D. R. Green
| Abstract |
|---|
|
|
|---|
We have previously described a monoclonal antibody, 984, which specifically recognizes murine CD8+ suppressor T cells (Ts) but not CD8+ cytolytic T lymphocytes (CTLs). Removal of 984+ cells abrogates the suppressive effect of CD8+ Ts generated either in vivo or in vitro while having no effect upon CTL. In this report, the molecules recognized by 984 are identified as 2-6 sialylated neolacto series gangliosides, which are members of the newly defined CD75s cluster. We proceed to demonstrate that like 984, a separate anti-CD75s antibody (CRIS-4), recognizes primary CD8+ Ts cells. In addition, the 2,6 sialyltransferase responsible for the synthesis of the 984 epitope is identified, allowing the manipulation and study of the regulation of this epitope. This is the first report of CD75s on murine cells and the first report that delineates lymphocyte function based upon CD75s expression. In addition to contributing to the growing body of evidence that lineage dependent gangliosides are expressed by T lymphocytes, these findings suggest that CD8+ CD75s+ T lymphocytes represent a functionally distinct subset of CD8+ T cells with negative regulatory function.
Keywords: 984, CD75s, ganglioside, suppressor T cell, tolerance
| Introduction |
|---|
|
|
|---|
The existence of T lymphocytes capable of exerting a negative regulatory effect upon primary immune responses has been known for over thirty years (1). Although there has been considerable recent progress made in understanding the role that CD4+ CD25+ regulatory T cells play in immunological tolerance (24), a large body of literature supports the existence of CD8+ T cells that are capable of suppressing immune responses in an antigen-specific fashion (58). Based upon these findings, it has been hypothesized that a distinct subset of CD8+ T cells, named suppressor T cells (Ts), function to maintain immunological tolerance. However, progress in our understanding of the biology of CD8+ Ts has been impeded by technical limitations in the isolation of CD8+ Ts. Neither culture conditions that consistently allow establishment of primary Ts clones nor isolation of Ts specific surface markers have been described.
Despite the difficulties isolating CD8+ Ts, the biological phenomenon of CD8+ Ts-mediated suppression persists in current models of immunological tolerance. It has recently been demonstrated that adoptive transfer of non-lytic CD8+ Ts is capable of transferring antigen specific non-responsiveness in models of both oral and i.v. tolerance (9,10) and that adoptive transfer of allospecific CD8+ Ts can prevent transplant rejection (11). In addition, considerable evidence has recently been accumulated to indicate an important role for CD8+ Ts in human immunological tolerance (12,13). However, the inability to isolate CD8+ Ts remains an impediment to the study of their function. Thus, the development of tools to identify CD8+ Ts remains an important goal for ongoing investigations of CD8+ Ts.
We have previously described the generation of the monoclonal antibody 984.D4.6 (984), using Ts hybridomas as a source of antigen (14). 984 reacts with numerous CD8+ Ts hybridomas and an ovalbumin (OVA) specific CD8+ Ts line, but not helper T cell lines, cytolytic T lymphocyte (CTL) lines, other murine hybridoma lines, unstimulated splenocytes or unstimulated thymocytes (15). Oral tolerization to OVA induces non-lytic CD8+ splenocytes, which can adoptively transfer tolerance to OVA. Removal of 984+ cells from this suppressive CD8+ population abrogates the ability to transfer tolerance (10). Likewise, CD8+ splenocytes of mice injected with alloantigen i.p. contain suppressive activity that can be abrogated by removal of 984+ cells (16). However, removal of 984+ cells has no effect upon cytolytic activity of primary CD8+ CTLs (14). Taken together, these findings indicate that 984 recognizes a surface molecule expressed by non-lytic CD8+ Ts cells.
Previous attempts to characterize the epitope recognized by 984 suggested that the epitope contained a carbohydrate (15). In this report, we identify CD75s bearing gangliosides as the molecules specifically recognized by 984. To the best of our knowledge, this is the first report of CD75s+ cells of murine origin and the only report to delineate lymphocyte function based upon the expression of CD75s.
| Methods |
|---|
|
|
|---|
Mice
BALB/c and C57Bl/6 mice (females from 8 to 12 weeks of age) were obtained from the National Cancer Institute (Frederick, MD). Mice were maintained on standard laboratory chow and water ad libitum in a temperature- and light-controlled environment. All procedures were conducted according to the guidelines of the Committee on Care and Use of Laboratory Animals, Institute of Laboratory Animals Resources, National Research Council.
Cell lines
Cell lines used in this report include the T cell thymoma cell line BW5147, a Ts hybridoma 372B3.5 (B3.5) (17), a non-lytic CD8+ T cell hybridoma RF.33.70 (RF) (18), and a non-transformed OVA-specific cytolytic cell line OVA-CTL (19). Both B3.5 and RF were made by fusing primary T cell populations with BW5147. Cell lines were maintained in RPMI 1640 containing 5% fetal calf serum, 1 mM L-glutamine, 1 mM sodium pyruvate and 50 µM 2-mercaptoethanol (Sigma-Aldrich). B3.5 and BW5147 were split in half every day by removing half of the cell culture and replacing it with fresh media in the same flask. RF was split one-twentieth every 4 days. The OVA-specific CTL line was cultured as previously described (19). All cultures were grown at 37°C in a humidified 5% CO2 and 95% air atmosphere. In some experiments, cells were cultured with DL-threo-1-phenyl-2-palmitoylamino-3- morpholino-1-propanolHCl (DL-PPMP), which is an inhibitor of glucosylceramide synthase (20). DL-PPMP (Biomol, Plymouth, PA) was dissolved in absolute ethanol and rapidly injected into PBS containing 0.14 mg/ml fat free BSA (Sigma-Aldrich) to generate a 1.9 mM stock solution. The stock was then diluted into media to a final concentration of 20 µM. Mock treatment consisted of addition of the same volume of ethanol/PBS/BSA without DL-PPMP.
Generation and assay of Ts in mixed lymphocyte reactions (MLR)
First step cultures (FSCs) consisted of 3 x 106 C57Bl/6 (H-2b) responder splenocytes and 5 x 106 BALB/C (H-2d) irradiated (2000 rad) stimulator splenocytes in 1 ml of media in 48-well plates. FSCs were incubated for 3 days at 37°C in a humidified 5% CO2, 95% air atmosphere and then harvested by centrifuging and resuspending in standard growth medium (SGM). Ts activity of FSC cells was measured in second step cultures (SSCs) by adding the specified number of irradiated (2000 rad) first step cells in 100 µl of SGM into wells of a 96-well U-bottom tissue plate containing 2.5 x 105 C57Bl/6 (H-2b) responder splenocytes and 10 x 105 BALB/C (H-2d) irradiated (2000 rad) stimulator splenocytes suspended in 100 µl SGM so that the final volume was 200 µl. After 4 or 5 days, the cytolytic activity was assessed by a standard 4 h chromium release assay by the addition of chromium labeled P815 (H-2d) target cells to the wells, as previously described (14). The percent specific cytolysis was determined by: % cytolysis = 100 x (c.p.m. sample spontaneous release)/(maximum c.p.m. spontaneous release).
Positive and negative selection of cells
CD8+, CD4+, CD19+ or Thy-1.2+ cells were prepared by positive selection using magnetic beads according to manufacturers instructions (Miltenyi Biotec, Auburn, CA). Positively selected FSC cells were added to SSCs in a number equivalent to that in total FSCs. CRIS-4+ cells were removed from FSC by treating with CRIS-4 (10 µg/ml or 1 µg/106 cells) and complement using LOW-TOX-M rabbit complement (Cederlane, Ontario, Canada) according to the manufacturers instructions. Treatment with a rat IgM isotype matched antibody (Serotech, Raleigh, NC) and complement was used as a negative control. Dead cells were removed by density gradient centrifugation using Lympholyte M (Accurate Chemicals, Westbury, NY). Remaining viable cells were counted, suspended in media, and added to SSC.
Flow cytometry
The monoclonal antibody 984.D4.6.5 was generated as previously described (14). Briefly, Lewis rats were immunized with supernatants from Ts hybridomas that were purified based upon immunosuppressive activity. Hybridomas were created by fusing the spleen cells of immunized rats with the mouse myeloma line Sp 2/0 Ag14 (non-Ig-secreting). Supernatants from the resulting hybridomas were screened for Ts specific antibodies by immunofluorescence using Ts hybridomas as a positive indicator line and BW5147 as a negative control. In the current studies, both 984.D4.6.5 (rat IgM) and CT-1 [mouse IgM specific for GalNAc-ß14[SA alpha 2,3]-Gal (21)] antibodies were collected from the supernatants of 14-day cultures. CRIS-4 and HD66 were generous gifts from Drs Reinhardt Schwartz-Albiez and Gerhard Moldenhauer (Deutsches Krebsforschungszentrum Heidelberg, Germany).
Staining with 984 and CT-1 was carried out using fluorescein conjugated goat anti-mouse IgG, A and M (ICN, Costa Mesa, CA) or phycoerythrin conjugated goat anti-rat IgM (ICN) as secondary antibodies. Both of these secondary antibodies react with rat and mouse IgM. A rat IgM isotype matched control (Serotech) was used with all 984 staining.
Enzymatic treatment of cells
Enzymatic digestion of 372B3.5 and BW5147 was carried out by washing cells three times in RPMI and resuspending 2 x 106 cells in 1 ml of RPMI containing one of the following: 100 µg of pronase, chymotrypsin or pepsin, 500 µg trypsin, 10 mg papain, 10 mU of neuraminidase, or 1 U of glycoprotease F. All enzymes were purchased from Sigma-Aldrich, and digestions were allowed to proceed for 1 h at 37°C 5% CO2. Treatment with endo-ß-galactosidase (V-Labs, Covington, LA) was carried out by suspending 1 x 106 cells in 100 µl of 50 mM sodium acetate, 150 mM NaCl pH 5.5 containing 60 mU of enzyme and incubating for 2 h at 37°C. Treatment with sodium-m-periodate (Sigma-Aldrich) was carried out by suspending cells in PBS with 10 mM sodium-m-periodate and incubating for 30 min at room temperature in the dark. Digested cells were then washed three times and analyzed by flow cytometry.
Isolation of gangliosides from 372B3.5
Gangliosides were extracted by standard described methods (22). Approximately 5 x 1010 cells were extracted with isopropanol:hexane:water (55:25:20 lower phase) and subjected to Folch partitioning. Anionic lipids were isolated by anion exchange chromatography from the Folch upper phase. HPLC fractionation of gangliosides was carried out as previously described (23).
Isolation of glycolipids from leukocytes
The glycolipids of 1 x 1012 unseparated human leukocytes were prepared and characterized as described previously (24). The identity of the four major monosialogangliosides 2-3 SPG, 2-6 SPG, 2-3 SnHC and 2-6 SnHC was determined by immunostaining using the 2,3 and 2,6 sialylated type 2 carbohydrate chain-specific antibodies M2590 (25) and HD-66 (26), respectively, and by fast atom bombardment mass spectrometry.
ELISA
Dried anionic lipids isolated from B3.5 or purified GM1, GD1a and GT1b (Sigma-Aldrich) were dissolved in absolute ethanol at 45°C with sonication and then coated onto Costar® 96-well vinyl plates (Corning Inc., Corning, NY) by overnight evaporation in a chemical fume hood at room temperature. The dried wells were washed once with distilled water and incubated in blocking buffer (2% bovine serum albumin, 2% polyvinylpyrrolidone in PBS) for 90 min at room temperature. Wells were washed with PBS containing 0.1% Tween-20 (Sigma-Aldrich) and incubated overnight at 4°C with 100 µl of 984 or rat IgM at a final concentration of 10 µg/ml. Wells were washed three times with PBS/Tween-20 and incubated for 2 h at room temperature with 100 µl biotinylated goat anti-mouse IgM (Vector, Burlingame, CA) at a final concentration of 10 µg/ml. Wells were washed three times and incubated with avidin conjugated horse radish peroxidase (diluted 1/10 000) (Sigma-Aldrich) for 20 min at room temperature. Wells were washed six times with PBS/Tween-20 and developed by incubating with the horse radish peroxidase substrate 2,2'-azino-di-(3- ethylbenzthiazoline-6-sulfonate) (KPL, Gathers burg, MD). Absorbance was measured at 405 nM using a microplate reader.
Thin layer chromatography (TLC)
TLC analysis was carried out on high performance TLC (HPTLC) silica gel 60 plates (Merck, Darmstadt, Germany). The running solvent was CHCl3:MeOH:H20 (120:70.17) (v/v/v) containing 0.02% CaCl2, and the running time was 35 min. The gangliosides were visualized by dipping the air-dry plates into a solution of 70 mg orcinol in 100 ml of 3 M sulfuric acid followed by heating at 95°C for 15 min. TLC immunostaining was performed as described (27) with modifications (28).
Northern blot analysis
RNA was isolated from cell lines using RNAzol B (Tel-Test, Inc., Friendswood, TX) according to the manufacturers instructions. Twenty micrograms of RNA from each condition was then resolved by formaldehyde denaturing agarose gel electrophoresis and transferred to nitrocellulose overnight by capillary transfer. The cDNA probe for ST6Gal I was generated by digesting pGEM-T-ST6 (see below) with NotI and BamHI and isolating the insert by low melting point agarose electrophoresis. Probes were radiolabeled with [
-32P]CTP using the random oligonucleotide labeling system (Amersham Pharmacia Biotech, Uppsala, Sweden) and hybridized to membranes using Express hyb (Clontech, Palo Alto, CA) according to the manufacturers instructions.
Plasmid construction
An expression vector for the ß-galactoside
-2,6-sialyltransferase (ST6Gal I) was constructed by RTPCR amplifying the ST6Gal I coding region and ligating into pIRES- NEO (Clontech). RNA was isolated from the hybridoma 372B3.5 and subjected to RTPCR using the 5' primer GGGCGGCCGCCACCATGATTCATACCAACTTGAAGAGAA (NotI site in bold, Kozak consensus sequence underlined) and the 3' primer CCGGATCCTCAACAGCGATTGTTCCGGAA GCCA (BamHI site in bold). The primers were designed based upon the sequence data in GenBank (accession number D6106). The pGEM-T-ST6 vector was created by directly ligating the PCR product into pGEM-T-Easy (Promega, Madison, WI) according to the manufacturers instructions. Nucleic acid sequencing was carried out using the T7 promoter on pGEM-T-Easy in order to confirm the correct identity of the amplicon. The expression cassette for ST6GAL I was removed from pGEM-T-ST6 by digesting with NotI and BamHI and was ligated into pIRES-NEO (Invitrogen, Carlsbad, CA) that had been digested with the same restriction endonucleases and treated with calf intestinal alkaline phosphatase.
Creation of stable transfectants
BW5147 and B3.5 were transfected with pIRES-Neo or pIRES-ST6 using the FuGENE 6 transfection reagent (Roche Diagnostics, Indianapolis, IN) according to the manufacturers instructions. Stable transfectants were selected by culturing in selective media containing G418 (1.5 mg/ml) (Mediatech, Herndon, VA).
| Results |
|---|
|
|
|---|
The 984 epitope contains a sialylated N-acetyllactosamine chain
We have previously reported that 984 stains most Ts hybridomas but not hybridomas of other phenotypes nor the fusion partner used to create the Ts hybridomas (15). We selected the hybridomas B3.5 and RF, which stain strongly for 984, as a convenient source of 984 immunoreactive material. Both B3.5 and RF stained positive with 984 compared to an isotype matched control while no staining was observed with BW5147, the fusion partner used to make both of these hybridomas (Fig. 1). Previously, we have reported that the epitope recognized by 984 contains a carbohydrate (15). To confirm and extend those findings, B3.5 was subjected to several treatments known to destroy carbohydrates. Treatment of B3.5 with neuraminidase, an enzyme that removes terminal sialic acids from carbohydrate chains, abrogated antibody binding (Fig. 2A, panel 2) compared to a mock treated control (Fig. 2A, panel 1). Likewise, treatment of cells with periodate, which oxidizes carbohydrates, completely abrogated 984 binding (Fig. 2A, panel 4), whereas a mock treatment had little effect (Fig. 2A, panel 3). Together, these data suggest that the epitope recognized by 984 contains a sialylated oligosaccharide and that the sialic acid is required for 984 binding.
|
|
To help determine the structure of the 984 immunoreactive carbohydrate, B3.5 was treated with a variety of endo and exoglycosidases. Treatment of B3.5 with an endo-ß-galactosidase that specifically recognizes the structure R-GlcNAcß13Galß14Glc/GlcNAc abrogated all antibody binding (Fig 2A, panel 6) while mock treatment of B3.5 had no effect (Fig. 2A, panel 5). The absence of 984 staining after treatment with this enzyme suggests that the 984 epitope contains a poly-N-acetyllactosamine structure. The weaker staining intensity with 984 seen in panels 14 compared with panels 5 and 6 was due to the use of a less sensitive fluorescein-conjugated secondary antibody in the former and a more sensitive phycoerythrin-conjugated secondary antibody in the latter. To verify the specificity of the endo-ß-galactosidase treatment, the enzyme was tested on a different carbohydrate epitope. CT-1 is an anti-carbohydrate antibody that recognizes the sialylated oligosaccharide GalNAc-ß14[SA alpha 2,3]-Gal on CTL (21). This oligosaccharide does not contain LacNAc units and is thus not a member of the acetyllactosamine family. The CT-1+, OVA-specific CTL line (OVA-CTL), which has previously been shown to be 984 (15) was digested with endo-ß-galactosidase. Neither mock treatment (Fig. 2A, panel 7) nor digestion with endo-ß-galactosidase (Fig. 2A, panel 8) had any effect on CT-1 staining. This observation confirmed that the sensitivity of the 984 epitope to digestion with endo-ß-galactosidase was not due to contamination with either neuraminidase or other non-specific glycosidases. Together, these data suggest that the 984 epitope expressed by a Ts hybridoma contained a carbohydrate that consisted of a poly-N-acetyllactosamine structure terminated with a sialic acid.
Carbohydrates of the poly-N-acetyllactosamine family reside on both glycoproteins and glycolipids (29). The nature of the 984 immunoreactive glycoconjugate was next investigated by treating B3.5 with a panel of proteases. The intensity of 984 staining of B3.5 (Fig. 2B, panel 1) was undiminished by treatment with trypsin (Fig. 2B, panel 2), chymotrypsin (Fig. 2B, panel 3) or papain (Fig. 2B, panel 4). In a separate series of experiments, 984 reactivity on untreated cells (Fig. 2B, panel 5) was undiminished by treatment with pepsin (Fig. 2B, panel 6) and was slightly enhanced with treatment by pronase (Fig. 2B, panel 7). In addition, glycoprotease F, an enzyme that cleaves N-linked oligosaccharides from glycoproteins, had no effect (Fig. 2B, panel 8). To confirm that each protease was ezymatically active, the generation of peptide fragments was monitored by subjecting the supernatants of treated cells to Tristricine gel electrophoresis (data not shown). Sensitivity to glycosidases and insensitivity to proteases was the same on RF as shown above for B3.5 (data not shown).
The 984 epitope containing glycoconjugate expressed by B3.5 is a glycolipid
The insensitivity of the 984 epitope to proteases led us to hypothesize that the carbohydrate recognized by 984 resided on a glycolipid. This was tested by culturing RF in the presence of a selective inhibitor of glycolipid synthesis. DL-PPMP is a potent inhibitor of glucosylceramide synthase (20). Since glycoprotein synthesis does not involve glucosylceramide synthase, DL-PPMP specifically inhibits glycolipid synthesis. After four days of culture, 984 expression was markedly decreased on DL-PPMP treated cells compared with untreated or mock treated cells (Fig. 3). Incubation with DL-PPMP had no effect upon staining with anti-CD45 (Fig. 3) confirming that the decrease in 984 staining did not result from a non-specific inhibition of protein synthesis. These data suggest that the 984 epitope resides on a glycolipid.
|
Direct evidence that 984 recognized a glycolipid was established by assessing 984 immunoreactivity of glycolipids extracted from B3.5. Since the 984 epitope contains a terminal sialic acid, we predicted that any 984 immunoreactive glycolipids should reside in the anionic glycolipid fraction. Anionic glycolipids were isolated by Folch extraction followed by anion exchange chromatography. The immunoreactivity of the isolated anionic lipid fraction was assessed by ELISA. Wells of a 96-well plate were coated with the anionic lipid fraction of B3.5 or with control gangliosides GM1, GD1a or GT1b. The B3.5 anionic lipid fraction was immunoreactive with 984 compared to an isotype matched control (Fig. 4A). Binding was specific, since 984 did not bind to any of the other ganglioside species compared with an isotype matched control. Neither the neutral glycolipids from B3.5 nor any lipids isolated from BW5147 were immunoreactive with 984 (data not shown).
|
While the above data indicate that the 984 epitope is present on a glycolipid, they do not rule out the existence of a concurrent 984 immunoreactive protein. However, we were unable to detect a 984 immunoreactive glycoprotein present on B3.5 or RF but absent on BW5147 despite exhaustive western blotting experiments using several methods. Taken together, these data suggest that cell surface staining with 984 is predominantly, if not exclusively, due to reactivity with glycolipid species.
984 specifically recognizes 2,6 sialylated neolacto series gangliosides
The neolacto series gangliosides consist of poly-N-acetyllactosamine chains terminated with a sialic acid. Based upon the above data, we hypothesized that 984 was recognizing a member of the neolacto series family. The ability of 984 to specifically recognize this class of glycolipid was assessed by performing the TLC immuno-overlay technique using neolacto series gangliosides extracted from human leukocytes. One TLC plate was stained with orcinol (Fig. 4B) to visualize all glycolipids present. The identity of the four major monosialogangliosides (2-3 SPG, 2-6 SPG, 2-3 SnHC and 2-6 SnHC) was previously determined by immunostaining and fast atom bombardment mass spectrometry (24,25). A parallel plate was immunostained with 984. 984 bound to both 2-6 SPG and 2-6 SnHC. In addition, 984 reacted with a slower migrating band that may represent 2-6 SnOC. This interaction is highly specific for 2-6 sialylated neolacto series gangliosides since the 984 antibody did not recognize the same structures when the sialic acid is in a 2,3 linkage.
The anionic lipids from the B3.5 hybridoma were then separated into four fractions by HPLC, and each fraction was assayed for 984 immunoreactivity (Fig. 4C). Two main 984 immunoreactive bands with the same mobility as 2-6 SPG and 2-6 SnHC were detected in fractions 1 and 3, respectively. TLC overlay of other HPLC fractions did not result in any detectable 984 immunoreactive species (data not shown). Taken together, these data demonstrate that 984 specifically binds to purified 2,6 neolacto series gangliosides and suggests that 984 reacts with 2-6 SPG and 2-6 SnHC from the Ts hybridoma B3.5.
Comparison of 984 with other anti-CD75s antibodies
CD75s is a recently named cluster of differentiation formed by combining CDw76, some members of CD75, and several other antibodies (30). Anti-CD75s antibodies are defined by a specificity for N-acetyllactosamine chains terminated in a 2,6 linked sialic acid. Since 984 specifically binds to purified gangliosides containing this carbohydrate structure, we conclude that 984 is an anti-CD75s antibody. The staining pattern of 984 was compared with two previously characterized monoclonal anti-CD75s antibodies, CRIS-4 and HD66. Both CRIS-4 and HD66 bind 2,6 sialylated neolacto series gangliosides (26). The reactivity of CRIS-4 and HD66 for B3.5 and BW5147 was compared to 984 by flow cytometry. B3.5 stained strongly positive with CRIS-4 and to a lesser extent with HD66 (Fig. 5). BW5147, the fusion partner initially used to generate the B3.5 hybridoma, failed to stain with either 984 or the anti-CD75s antibodies.
|
ST6Gal I synthesizes the 984 epitope
ST6Gal I adds 2,6 linked sialic acids to the core structure found in poly-N-acetyllactosamine chains and has been previously shown to participate in the synthesis of CD75s (31). Culturing at low cell density results in weak expression of 984 in B3.5 (B3.5-lo), whereas BW5147 expresses no detectable 984 at high or low (Bw5147-lo) density (15). To investigate whether expression of ST6Gal I correlates with expression of the 984 epitope, mRNA for ST6Gal I was measured by northern blot analysis of RNA from B3.5, B3.5-lo and BW5147. Hybridization with a full length cDNA probe for ST6Gal I demonstrated a strong signal for B3.5, a weak signal that was just on the threshold of detection on the original northern blot for B3.5-lo, and no signal for BW5147 or BW5147-lo (Fig. 6A). These differences are not an artifact of loading or sample degradation, based upon the results of stripping the membrane and probing for GAPDH. Thus, expression of ST6Gal I mRNA correlates with the presence and intensity of 984 immunoreactivity.
|
To demonstrate that ST6Gal I is capable of synthesizing 984, B3.5-lo and BW5147-lo were transfected with either an expression vector for ST6Gal I or with the empty expression vector. Transfected cells were selected by culturing in the presence of 1.4 mg/ml G418 for three weeks. Parallel transfections were performed with a plasmid that does not confer G418 resistance and had no viable cells after selection with G418.
Northern blot analysis was performed on the neomycin-resistant populations to confirm the expression of mRNA encoding ST6Gal I in the populations transfected with the ST6Gal I expression vector (Fig. 6B). Both B3.5-lo and BW5147-lo that had been transfected with ST6Gal I expression vector had detectable mRNA that hybridized with a ST6Gal I cDNA probe. The majority of this mRNA ran at a slightly faster mobility than the wild type ST6Gal I mRNA expressed in B3.5. This is due to the removal of 5' and 3' untranslated regions during construction of the expression vector. In addition, a smear of heavier species was observed in both B3.5-lo and BW5147-lo that had been transfected with the expression vector for ST6Gal I. This is most likely to represent read through transcripts that result from random integration in this polyclonal population. Neither untransfected BW5147-lo nor BW5147-lo that had been transfected with an empty expression vector showed any measurable ST6Gal I mRNA. Untransfected B3.5-lo and B3.5-lo that had been transfected with an empty expression vector had trace amounts of wild type ST6Gal I mRNA with an identical mobility to that found in untransfected B3.5. These differences are not an artifact of loading or sample degradation, since stripping and reprobing of the membrane with a probe for GAPDH resulted in roughly equivalent signal in all lanes.
To assess whether the expression of ST6Gal I had any effect upon the levels of 984 immunoreactivity, the stable transfectants were stained with 984 and analyzed by flow cytometry. B3.5-lo showed weak reactivity with 984 that increased after transfection with the expression vector for ST6Gal I (Fig. 6C). This increase was not due to the transfection procedure or the G418 selection since B3.5-lo transfected with the empty expression vector showed no change in 984 reactivity. BW5147-lo that had been transfected with the expression vector for ST6Gal I had no measurable increase in 984 positivity compared with untransfected cells. Thus, ST6Gal I synthesizes the 984 epitope and differences in ST6Gal I expression appear to be responsible for the differences in the levels of the 984 epitope expressed by B3.5 and B3.5-lo. However, expression of ST6Gal I was alone insufficient to confer expression of the 984 epitope upon BW5147.
Depletion of CD75s+ cells abrogates suppressive activity of CD8+ Ts
MLR contain a cell population that potently suppresses the generation of allospecific CTL activity when added to a fresh MLR (32). In this system, removal of CD8+, but not CD4+, T cells eliminates the suppressive activity (14). Likewise, removal of 984+ cells also eliminates the suppressive activity while having no effect upon CTL activity (14), suggesting that a functionally distinct population of Ts in the CD8+ compartment is recognized by the 984 antibody. The suppressive activity in this system is antigen specific (33), not due to lysis of stimulator cells in the second MLR (3336), nor due to release of non-specific factors, depletion of nutrients, or consumption of cytokines such as IL-2 (14). In this system, CD8+ Ts are generated in an MLR referred to as a FSC. These cells are then irradiated and their suppressive activity is measured by adding them to a second MLR referred to as a SSC. Suppression is measured by assaying the generation of allo-specific lytic activity in the SSC.
While several groups have reported that depletion of CD8+ cells from this system abrogates the suppressive effect, whether or not CD8+ T cells are alone sufficient to cause suppression has not been assessed. To test this, Thy-1+, CD4+, CD8+ and CD19+ populations, were positively selected from FSC and added to a SSC to determine which populations contained the negative regulatory activity (Fig. 7A). Purity of the selected populations was confirmed by flow cytometry and routinely reached 95% (data not shown). The addition of the unfractionated FSC to a SSC resulted in the almost complete absence of CTL activity in the SSC. Addition of Thy-1+ cells or CD8+ cells from the FSC to a SSC had the same effect as the unfractionated FSC. CD4+ cells slightly enhanced CTL activity in the SSC while CD19+ cells slightly suppressed, but neither effect was statistically significant. These data indicate that CD8+ T cells are alone sufficient to mediate suppressive effects in this system.
|
We have previously reported that removal of 984+ cells from FSC resulted in the abrogation of suppressive activity while having no effect upon lytic activity of treated FSC cells (14). Although the above data indicate that 984 recognizes CD75s on Ts hybridomas, it does not rule out the possibility that 984 may be recognizing a different antigen on primary CD8+ Ts. We hypothesized that if the antigen recognized by 984 on primary CD8+ Ts was CD75s, then a different CD75s antibody should also be capable of depleting suppressive activity in this system. To test this hypothesis, CRIS-4+ cells were depleted from FSCs by treating with CRIS-4 and complement. Like 984, CRIS-4 plus complement did not significantly reduce cytolytic activity of FSC cells (Fig. 7B) but depletion of CRIS-4+ cells reversed suppression of the SSC (Fig. 7C). Treatment with an isotype matched control plus complement or complement alone had no effect on suppression (Fig. 7C). It is important to note that the reversal of Ts activity by CRIS-4 has not occurred each time we have run this experiment. In a total of five similar experiments, CRIS-4 reversed Ts three out of five times (60%). We conclude that the reversal of Ts by CRIS-4 is not an artifact, since the isotype control treatment, which was carried out under identical conditions to the CRIS-4 treatment, never reversed Ts activity. However, there is a degree of variability in this system, which might be attributed to the the heterogeneity of chain length known to occur in the carbo hydrate antigen recognized by both 984 and CRIS-4 (see Discussion). Nevertheless, removal of CRIS-4+ cells, like the removal of 984+ cells, removes suppressive activity while having no significant effect upon lytic activity of CD8+ T cells.
| Discussion |
|---|
|
|
|---|
We have previously shown that the 984 antibody recognizes both primary murine CD8+ Ts and Ts hybridomas but not CD8+ CTL (15). However, the molecules recognized by 984 were not previously identified. In the current study, sensitivity of the 984 epitope to neuraminidase and endo-ß-galactosidase suggested that 984 bound to an oligosaccharide containing sialic acid and LacNAc groups. The ability of 984 to specifically recognize such structures was confirmed by demonstrating that 984 binds to the 2,6 neolacto gangliosides 2-6 SPG and 2-6 SnHC that consist of LacNAc chains terminated in a 2,6 linked sialic acid, but not the same structures when the sialic acid is in a 2,3 linkage. In addition, we have previously shown that 984 does not bind to 2,6 sialylated carbohydrates with different core structures (15). Together, these data indicate that 984 specifically recognizes 2,6 sialylated LacNAc chains, which is the structure defined as CD75s. We thus conclude that 984 is an anti-CD75s antibody.
The inability of multiple proteases to decrease 984 staining and the abrogation of 984 staining by culturing cells in the presence of DL-PPMP, suggested that the 984 epitope resides primarily on a ganglioside. Extraction and analysis of gangliosides from the Ts hybridoma B3.5 confirmed that the 984 epitope resides on two lipid species with identical TLC mobilities as 2-6 SPG and 2-6 SnHC. Taken together, these data strongly suggest that 2-6 SPG and 2-6 SnHC are the molecules that 984 is recognizing on B3.5. Although less common than protein antigens, T cell subtype specific gangliosides have been reported in Th1 and Th2 lymphocytes (3739). Ideally, one would confirm the structure of the 984 immunoreactive gangliosides by mass spectrometry and NMR analysis. However, despite nearly quantitative recoveries of ganglioside from 25 l cultured B3.5, analysis by NMR revealed insufficient material was present for a structural elucidation.
Glycoproteins displaying the CD75s epitope have been detected in human lymph nodes (40) and we cannot rule out that such proteins may contribute to the 984 immunoreactivity of 984+ hybridomas. However, since treatment with DL-PPMP removes the vast majority of 984 staining, we conclude that if CD75s bearing glycoproteins are present they constitute a minor percentage of the 984 immunoreactive material. Furthermore, we were unable to detect any 984 immunoreactive proteins present on B3.5 or RF but absent from BW5147, despite exhaustive attempts at western blotting (data not shown). We hypothesize that the CD75s epitope on primary CD8+ Ts is likewise a ganglioside. However, the exact nature of the glycoconjugate that bears the CD75s epitope on primary Ts has not yet been determined since so few cells express the 984 epitope.
In a previous report, 984 was shown to bind a 200 kDa band in extracts of B3.5 but not BW5147 by western blot (15). At that time, treatment of B3.5 with pronase partially decreased 984 binding as measured by a cell-based ELISA. Currently, the previously reported 200 kDa band is not detectable by western blot nor is the 984 reactive epitope on B3.5 sensitive to proteases. Given the genetic instability of hybridomas, it is possible that B3.5 previously expressed a 200 kDa 984 immunuoreactive surface protein but no longer does so. Alternatively, the 200 kDa band may have been a lipoprotein or micelle structure containing the 984 immunoreactive gangliosides described here. Such complexes can be very sensitive to particular buffer conditions including ionic strength and temperature, which may make them difficult to reproduce over time. In addition, it is not uncommon for enzyme preparations from microbial sources to be contaminated with other enzymes. Thus, the apparent pronase sensitivity might have been due to neuraminidase contamination of these reagents in our earlier studies.
Although anti-CD75s antibodies all recognize 2,6 sialylated LacNAc carbohydrate chains, much like different monoclonal antibodies recognizing the same protein, the precise epitope recognized by any given CD75s antibody can vary. It has been previously demonstrated that different anti-CD75s antibodies display a binding preference for longer or shorter LacNAc chains. Immuno-overlay and ELISA analysis has shown that HD66 binds predominantly 2,6 neolacto gangliosides with one LacNAc unit, and CRIS-4 binds to gangliosides with three or more LacNAc units (41). In the current report, we demonstrate by TLC immuno-overlay that 984 can recognize 2,6 neolacto gangliosides with one or two LacNAc repeats and probably gangliosides with three LacNAc repeats. Whether 984 is capable of recognizing longer chains remains to be determined.
While our previous reports demonstrate that 984 recognizes CD8+ Ts in several different models of immunological tolerance and the current data indicate that 984 recognizes CD75s, it does not necessarily follow that CD75s is the molecule recognized by 984 on primary CD8+ Ts cells. However, we have demonstrated that a separate CD75s antibody (CRIS-4) has the same biological properties of abrogating CD8+ Ts activity as previously reported for 984. Since an isotype matched control has never reversed Ts activity in our hands, we consider these findings with CRIS-4 to be specific. This supports the conclusion that CD75s is a marker of CD8+ Ts. However, the removal of Ts activity by CRIS-4 and complement has been somewhat variable. The exact reason for this variability is currently unclear. Given that the mean carbohydrate chain length of 2,6 neolacto gangliosides on any given cell population is the net result of the coordinate expression of at least five different synthetic enzymes, subtle differences in culture conditions could easily change the distribution of long and short chain molecules. It has been previously demonstrated that CRIS-4 has a preference for longer chain molecules (41). Thus, we hypothesize that in some settings the mean chain length of CD75s will drop to a level where CRIS-4 no longer binds to a sufficient number of CD8+ Ts to deplete Ts activity.
Positive staining with 984 correlates with the expression of mRNA for the 2,6 sialyltransferase, ST6Gal I. In addition, overexpression of ST6Gal I in a weakly 984+ hybridoma resulted in increased 984 immunoreactivity. We conclude that ST6Gal I synthesizes the 984 epitope by sialylating the core N-acetyllactosamine structure. It has been reported that ST6Gal I can synthesize epitopes recognized by other anti-CD75s antibodies (31) thus lending more support to the conclusion that 984 is an anti-CD75s antibody. Overexpression of ST6Gal I in BW5147 did not result in positive staining with 984. Given the complex multistep process of ganglioside synthesis, this could be due to either the lack of another enzyme required for LacNAc synthesis or an overabundance of a LacNAc chain terminating enzyme other than ST6Gal I. Thus, fusion of the primary CD8+ Ts cell with BW5147 to create B3.5 appears to have contributed the 984+ phenotype through expression of ST6Gal I as well as altering other synthetic machinery.
We have previously reported that incubation of FSC with 984 in the absence of complement enhances Ts activity (14). It is thus unclear if CD75s is just a marker of CD8+ Ts or if it is functionally involved in suppression. Recently, lacto-N-neotetraose (Galß14GlcNAcß13Galß14Glc), was shown to induce cell populations that produce IL-10 and TGF-ß, which contributes to negative regulation of primary immune responses in mice (42). Since lacto-N-neotetraose is the unsialylated core of 2,6 SnHC, it is possible that the presence of this carbohydrate on CD8+ Ts cells may provide a natural ligand that activates negative regulatory pathways. Thus, CD75s may not only represent a surface marker of murine CD8+ Ts, but may also be functionally involved in immunological suppression.
| Acknowledgements |
|---|
We are grateful to Suzanna Schott and Jing Ming Liu for outstanding technical assistance. We thank T. F. Tedder, Reinhardt Schwartz Albiez, and Gerhard Moldenhauer for generous gifts of antibody reagents. We also thank Pat Bucy and Linda Pilarski for useful conversations and David Webb and Peter Jensen for helpful suggestions and critical review of this manuscript. This work was supported in part by grants from the NCI (CA-70372), a core grant from NIH (P30EY06360), NIH Resource Center for Biomedical Complex Carbohydrates (NIH #P41RR05351), Research to Prevent Blindness, Inc. New York, NY, and a gift from Malcom and Musette Powell. J. A. K. is the recipient of the Jules and Doris Stein Professorship in Ophthalmology awarded by Research to Prevent Blindness Inc. New York, NY.
| Abbreviations |
|---|
2-6 SnHC2-6 sialosylneolactohexaosylceramide
2-6 SnOC2-6 sialosylneolactooctasosylceramide
2-6 SPG2-6 sialoparagloboside
984984.D4.6
CTLcytolytic T lymphocyte
DL-PPMPDL-threo-1-Phenyl-2-palmitoylamino-3-morpholino-1-propanolHCl
FSCfirst-step culture
SGMstandard growth medium
SSCsecond-step culture
ST6Gal Iß-galactoside
2,6-sialyltransferase
TLCthin-layer chromatography
Tssuppressor T cell
| References |
|---|
|
|
|---|
- Gershon, R. K. and Kondo, K. 1970. Cell interactions in the induction of tolerance: the role of thymic lymphocytes. Immunology 18:723.[ISI][Medline]
- McHugh, R. S. and Shevach, E. M. 2002. The role of suppressor T cells in regulation of immune responses. J. Allergy Clin. Immunol. 110:693.[CrossRef][ISI][Medline]
- Shevach, E. M. 2000. Regulatory T cells in autoimmunity*. Annu. Rev. Immunol. 18:423.[CrossRef][ISI][Medline]
- Curotto de Lafaille, M. A. and Lafaille, J. J. 2002. CD4(+) regulatory T cells in autoimmunity and allergy. Curr. Opin. Immunol. 14:771.[CrossRef][ISI][Medline]
- Benacerraf, B. and Germain, R. N. 1981. A single major pathway of T-lymphocyte interactions in antigen-specific immune suppression. Scand. J. Immunol. 13:1.[CrossRef][ISI][Medline]
- Dorf, M. E. and Benacerraf, B. 1984. Suppressor cells and immunoregulation. Annu. Rev. Immunol. 2:127.[Medline]
- Green, D. R., Flood, P. M. and Gershon, R. K. 1983. Immunoregulatory T-cell pathways. Annu. Rev. Immunol. 1:439.[CrossRef][ISI][Medline]
- Jensen, P. E. and Kapp, J. A. 1985. Stimulation of helper T cells and dominant suppressor T cells that recognize autologous insulin. J. Mol. Cell. Immunol. 2:133.[ISI][Medline]
- Ferguson, T. A., Herndon, J., Elzey, B., Griffith, T., Schoenberger, S. and Green, D. R. 2002. Uptake of apoptotic antigen-coupled cells by lymphoid dendritic cells and cross-priming of CD8+ T cells produce active immune unresponsiveness. J. Immunol. 168:5589.
[Abstract/Free Full Text] - Ke, Y. and Kapp, J. A. 1996. Oral antigen inhibits priming of CD8+ CTL, CD4+ T cells, and antibody responses while activating CD8+ suppressor T cells. J. Immunol. 156:916.[Abstract]
- Zhou, J., Carr, R. I., Liwski, R. S., Stadnyk, A. W. and Lee, T. D. 2001. Oral exposure to alloantigen generates intragraft CD8+ regulatory cells. J. Immunol.167:107.
[Abstract/Free Full Text] - Cortesini, N. S. 2002. Molecular mechanism of T-cell-mediated suppression. Transplant. Proc. 34:1998.[CrossRef][ISI][Medline]
- Cortesini, R., LeMaoult, J., Ciubotariu, R. and Cortesini, N. S. 2001. CD8+CD28- T suppressor cells and the induction of antigen-specific, antigen-presenting cell-mediated suppression of Th reactivity. Immunol. Rev. 182:201.[CrossRef][ISI][Medline]
- Devens, B. H., Koontz, A. W., Kapp, J. A., Pierce, C. W. and Webb, D. R. 1991. Involvement of two distinct regulatory T cell populations in the antigen-specific suppression of cytolytic T cell generation. J. Immunol. 146:1394.[Abstract]
- Kapp, J. A., Pierce, C. W., Webb, D. R., Devens, B., Godfrey, W., Fukuse, S., Engleman, E., Lake, J. P., Magnani, J. I., and Maiti, P. K. 1995. Characterization of the epitope recognized by a mAb that reacts differentially with murine suppressor T cells. Int. Immunol. 7:1319.
[Abstract/Free Full Text] - Devens, B. H. and Webb, D. R. 1995. Phenotypic identification of specific and nonspecific suppressor T-cell populations involved in the in vivo response to alloantigen. Cell. Immunol. 161:1.[CrossRef][ISI][Medline]
- Sorensen, C. M. and Pierce, C. W. 1982. Antigen-specific suppression in genetic responder mice to L-glutamic acid60-L-alanine30-L-tyrosine10 (GAT). Characterization of conventional and hybridoma-derived factors produced by suppressor T cells from mice injected as neonates with syngeneic GAT macrophages. J. Exp. Med.156:1691.
[Abstract/Free Full Text] - Rock, K. L., Rothstein, L. and Gamble, S. 1990. Generation of class I MHC-restricted T-T hybridomas. J. Immunol. 145:804.[Abstract]
- Ke, Y., Li, Y. and Kapp, J. A. 1995. Ovalbumin injected with complete Freunds adjuvant stimulates cytolytic responses. Eur. J. Immunol. 25:549.[ISI][Medline]
- Abe, A., Inokuchi, J., Jimbo, M., Shimeno, H., Nagamatsu, A., Shayman, J. A., Shukla, G. S. and Radin, N. S. 1992. Improved inhibitors of glucosylceramide synthase. J. Biochem. 111:191.
[Abstract/Free Full Text] - Conzelmann, A. and Lefrancois, L. 1988. Monoclonal antibodies specific for T cell-associated carbohydrate determinants react with human blood group antigens CAD and SDA. J. Exp. Med. 167:119.
[Abstract/Free Full Text] - Schnaar, R. L. 1994. Isolation of glycosphingolipids. Methods Enzymol. 230:348.[ISI][Medline]
- Levery, S. B., Nudelman, E. D., Salyan, M. E. and Hakomori, S. 1989. Novel tri-and tetrasialosylpoly-N-acetyllactosaminyl gangliosides of human placenta: structure determination of pentadeca- and eicosaglycosylceramides by methylation analysis, fast atom bombardment mass spectrometry, and 1H NMR spectroscopy. Biochemistry 28:7772.[CrossRef][Medline]
- Kniep, B., Peter-Katalinic, J., Muthing, J., Majdic, O., Pickl, W. F. and Knapp, W. 1996. The CDw65 monoclonal antibodies VIM-8 and VIM-11 bind to the neutral glycolipid V3FucnLc8Cer. J. Biochem. 119:456.
[Abstract/Free Full Text] - Hirabayashi, Y., Hamaoka, A., Matsumoto, M., Matsubara, T., Tagawa, M., Wakabayashi, S. and Taniguchi, M. 1985. Syngeneic monoclonal antibody against melanoma antigen with interspecies cross-reactivity recognizes GM3, a prominent ganglioside of B16 melanoma. J. Biol. Chem. 260:13328.
[Abstract/Free Full Text] - Kniep, B., Muhlradt, P. F., Dorken, B., Moldenhauer, G., Vilella, R. and Schwartz-Albiez, R. 1990. Monoclonal antibodies against the human lymphocyte differentiation antigen CD 76 bind to gangliosides. FEBS Lett. 261:347.[CrossRef][ISI][Medline]
- Bethke, U., Muthing, J., Schauder, B., Conradt, P. and Muhlradt, P. F. 1986. An improved semi-quantitative enzyme immunostaining procedure for glycosphingolipid antigens on high performance thin layer chromatograms. J. Immunol. Methods 89:111.[CrossRef][ISI][Medline]
- Kniep, B. and Muhlradt,P. F. 1987. Monoclonal antibodies of the myeloid panel recognizing glycosphingolipids. In McMichael, A. J., ed., Leukocyte Typing III, p. 619. Oxford University Press, Oxford.
- Feizi, T. 1985. Demonstration by monoclonal antibodies that carbohydrate structures of glycoproteins and glycolipids are onco-developmental antigens. Nature 314:53.[CrossRef][Medline]
- Mason, D., Andre, P., Bensussan, A., Buckley, C., Civin, C., Clark, E., de Haas, M., Goyert, S., Hadam, M., Hart, D., Horejsi, V., Meuer, S., Morrissey, J., Schwartz-Albiez, R., Shaw, S., Simmons, D., Uguccioni, M., van der Schoot, E., Vivier, E. and Zola, H. 2002. CD antigens 2002. Blood 99:3877.
[Free Full Text] - Bast, B. J., Zhou, L. J., Freeman, G. J., Colley, K. J., Ernst, T. J., Munro, J. M. and Tedder, T. F. 1992. The HB-6, CDw75, and CD76 differentiation antigens are unique cell-surface carbohydrate determinants generated by the beta-galactoside alpha 2,6-sialyltransferase. J. Cell Biol. 116:423.
[Abstract/Free Full Text] - Fitch, F. W., Engers, H. D., Cerottini, J. C. and Bruner, K. T. 1976. Generation of cytotoxic T lymphocytes in vitro. VII. Suppressive effect of irradiated MLC cells on CTL response. J. Immunol. 116:716.
[Abstract/Free Full Text] - Al Adra, A. R. and Pilarski, L. M. 1978. Antigen-specific suppression of cytotoxic T cell responses in mice. I. Suppressor T cells are not cytotoxic cells. Eur. J. Immunol. 8:504.[ISI][Medline]
- Al Adra, A. R., Pilarski, L. M. and McKenzie, I. D. C. 1980. Surface markers on the T cells that regulate cytotoxic T-cell responses. I. The Ly phenotype of suppressor T cells changes as a function of time and is distinct from that of helper or cytotoxic T cells. Immunogenetics 10:521.[CrossRef]
- Bucy, R. P. 1988. The effects of immunosuppressive pharmacological agents on the induction of cytotoxic and suppressor T lymphocytes in vitro. Immunopharmacology 15:65.[CrossRef][ISI][Medline]
- Schwartz, A., Sutton, S. L. and Gershon, R. K. 1982. Regulation of in vitro cytotoxic T lymphocyte generation. II. Demonstration of noncytotoxic alloantigen-specific suppressor T lymphocytes. Eur. J. Immunol. 12:380.[ISI][Medline]
- Ebel, F., Schmitt, E., Peter-Katalinic, J., Kniep, B. and Muhlradt, P. F. 1992. Gangliosides: differentiation markers for murine T helper lymphocyte subpopulations TH1 and TH2. Biochemistry 31:12190.[CrossRef][Medline]
- Greer, J. M., Koerner, T. A., Hayakawa, K., Hardy, R. R. and Kemp, J. D. 1993. The 3G11+ antigen, a marker for murine CD4+ TH1 lymphocytes, is a ganglioside. Glycobiology 3:391.
[Abstract/Free Full Text] - Dittrich, F., Hayakawa, K., Nimtz, M., Ebel, F. and Muhlradt, P. F. 1994. Identification of the mouse helper T lymphocyte differentiation antigen 3G11 as the ganglioside IV3(NeuAc)2-GgOse4Cer. Biochem. Biophys. Res. Commun. 200:1557.[CrossRef][ISI][Medline]
- Eichler, W. A., G.Kupper, I., Behn, U. and Hommel Fiebig, H. 1995. Detection of CD76-like determinants on lymphocyte surface glycoproteins and characterization of their cellular expression using novel mAB. In Leukocyte Typing V. White Cell Differentiation Antigens, p. 596. Oxford University Press, Oxford.
- Kniep, B., Schakel, K., Nimtz, M., Schwartz-Albiez, R., Schmitz, M., Northoff, H., Vilella, R., Gramatzki, M. and Rieber, E. P. 1999. Differential expression of alpha2-6 sialylated polylactosamine structures by human B and T cells. Glycobiology 9:399.
[Abstract/Free Full Text] - Terrazas, L. I., Walsh, K. L., Piskorska, D., McGuire, E. and Harn, D. A. Jr. 2001. The schistosome oligosaccharide lacto-N-neotetraose expands Gr1+ cells that secrete anti-inflammatory cytokines and inhibit proliferation of naive CD4+ cells: a potential mechanism for immune polarization in helminth infections. J. Immunol. 167:5294.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
M. Rifa'i, Z. Shi, S.-Y. Zhang, Y. H. Lee, H. Shiku, K.-i. Isobe, and H. Suzuki CD8+CD122+ regulatory T cells recognize activated T cells via conventional MHC class I-{alpha}{beta}TCR interaction and become IL-10-producing active regulatory cells Int. Immunol., July 1, 2008; 20(7): 937 - 947. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||







