Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Huang, T. T.
Right arrow Articles by Aranda, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, T. T.
Right arrow Articles by Aranda, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 15, No. 11, pp. 1359-1367, November 2003
© 2003 Japanese Society for Immunology

TCR-mediated hyper-responsiveness of autoimmune G{alpha}i2-/- mice is an intrinsic naïve CD4+ T cell disorder selective for the G{alpha}i2 subunit

Tiffany T. Huang5, Yumei Zong2, Harnisha Dalwadi1, Chan Chung3, M. Carrie Miceli3,5, Karsten Spicher4, Lutz Birnbaumer4,5,7, Jonathan Braun1,5 and Richard Aranda2,6,8

1 Pathology and Laboratory Medicine, 2 Digestive Diseases, 3 Microbiology, Immunology and Molecular Genetics, 4 Molecular, Cellular and Developmental Biology, 5 Molecular Biology Institute, University of California at Los Angeles, Los Angeles, CA 90095, USA 6 VA Greater Los Angeles Healthcare System, Los Angeles, CA 90073, USA 7 Present address: Laboratory of Signal Transduction, and Division of Intramural Research, National Institute of Environmental Health Sciences, Research Triangle Park, NC, USA 8 Present address: Bristol-Myers Squibb Co., Princeton, NJ, USA

Correspondence to: J. Braun, Pathology and Medicine, UCLA, Box 951732, CHS 13-222, Los Angeles, CA 90095-1732, USA. E-mail: jbraun{at}mednet.ucla.edu
Transmitting editor: C. Terhorst


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Heterotrimeric Gi signaling regulates immune homeostasis, since autoimmunity occurs upon disruption of this pathway. However, the role of the lymphocyte-expressed G{alpha}i subunits (G{alpha}i2 and 3) on T cell activation and cytokine production is poorly understood. To examine this role, we studied T lymphocytes from mice deficient in the G{alpha}i2 or G{alpha}i3 subunits. G{alpha}i2-/- but not G{alpha}i3-/- splenocytes were hyper-responsive for IFN-{gamma} and IL-4 production following activation through the TCR. G{alpha}i2-/- T cells had a relaxed costimulatory requirement for IL-2 secretion and proliferation compared to wild-type cells. Purified naïve G{alpha}i2-/- T cells produced more IL-2 than naïve wild-type T cells following TCR activation, indicating that the hyper-responsive cytokine profile was not due to the expanded G{alpha}i2-/- memory T cells, but involved an intrinsic T cell alteration. Cytokine hyper-responsiveness was not seen when purified G{alpha}i2-/- T cells were stimulated with phorbol myristic acetate/ionomycin, localizing the alteration to a proximal TCR-specific signaling pathway. G{alpha}i2-/- CD4+ T cells were distinguished from wild-type or G{alpha}i3-/- T cells by a globally augmented TCR-induced calcium response. These findings indicate that G{alpha}i2-/- mice have an intrinsic CD4+ T cell abnormality in TCR signaling which may be one cause of augmented T cell effector function and G{alpha}i2-/- autoimmune susceptibility.

Keywords: autoimmunity, mucosa, signal transduction, T lymphocytes, TCR


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Heterotrimeric G proteins, composed of {alpha}ß{gamma} subunits, couple receptors characterized by seven transmembrane domains to a number of intracellular effector systems. Ligands that activate these G protein-coupled receptors are extremely diverse and include a number of molecules that are capable of modulating immune function, including chemokines and bioactive lipids (13). The G protein alpha subunits are characterized into four families: G{alpha}i, G{alpha}s, G{alpha}q and G{alpha}12/13. The G{alpha}i family is further classified into G{alpha}i1, G{alpha}i2 and G{alpha}i3. Some of the known intracellular effector functions of the {alpha}i subunits include the inhibition of adenylyl cyclase, the activation of K+ channels and the activation of 1,4,5-inositol triphosphate (IP3) kinase-{gamma} (47). Another distinguishing feature of Gi proteins is their inactivation by pertussis toxin (PT), which uncouples the Gi subunit from its receptor rendering it non-functional (6).

Both in vitro and in vivo studies suggest that Gi proteins participate in immune function. Chemokines and immunomodulatory lipids are ligands for Gi-coupled receptors (810). Pharmacological interruption of G{alpha}i signaling by PT has been shown to promote TH1 immune responses (11), enhance IL-12 production (12), and augment immune mediated pathology in transgenic animals predisposed to autoimmunity (13,14). PT has been used as an adjuvant in experimental immunization protocols. In this setting, the immune enhancing effect of PT has been attributed G{alpha}i blockade resulting in enhanced production of IL-12 and the augmented expression of costimulatory molecules such as B7-1, B7-2 on antigen presenting cells (11,15). Finally, mice deficient in the G{alpha}i2 subunit due to gene targeting have an immune system biased towards the production of TH1 cytokines which predisposes them to the development of a spontaneous inflammatory bowel disease (1619).

While G{alpha}i signaling has been shown to be specifically involved in the regulation of IL-12 production from CD8{alpha}+ dendritic cells (12), little is known about the significance of G{alpha}i expression in other immune cell types. G{alpha}i subunits are present in T cells but the specific signaling role they have has not been fully characterized (20,21). In fact, divergent results are often obtained depending upon the mode of G{alpha}i protein inactivation, and the use of human or mouse cells (22,23).

In this study, we take advantage of the availability of gene knockout mice deficient in either the G{alpha}i2 (G{alpha}i2-/-) or the G{alpha}i3 (G{alpha}i3-/-) subunit to investigate the specific role of the two G{alpha}i subunits in lymphocyte activation and cytokine production. We find that the G{alpha}i2-/-, but not G{alpha}i3-/-, genotype renders T lymphocytes hyper-responsive for TCR signaling and cytokine production, with a relaxed costimulatory requirement. This disorder is a selective, intrinsic feature of the naïve CD4+ T cell subset, and is associated with a developmental cell physiologic abnormality in TCR-mediated calcium signaling. This TCR signaling abnormality may contribute to the CD4+ T cell-mediated autoimmunity characteristic of G{alpha}i2-/- mice.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice
G{alpha}i2-/- and G{alpha}i3-/- mice were on a mixed (129Sv x C57BL/6J) background (24). Control wild-type mice were littermates on the same background. In some cases, age and gender-matched 129Sv and C57BL/6 mice were used as additional wild-type controls. These were indistinguishable by lymphocyte subsets and T cell function from the mixed background wild-type mice. Animals used in this study were between 6 and 10 weeks of age. The onset of clinical disease for the strain of the G{alpha}i2-/- mice we use in our laboratory starts at 10 weeks of age, the incidence of colitis with sign of rectal prolapse is evident by 12–16 weeks of age. Animals were used in compliance with protocols approved by the institutional review boards at the University of California Los Angeles and VA Greater Los Angeles Healthcare System.

Antibodies and reagents
Monoclonal antibodies specific for CD3{epsilon} (clone 145-2C11), CD28 (clone 37.51), CD44, CD62L, CD4 and goat anti-hamster IgG, were obtained from BD PharMingen (San Diego, CA). Anti-phosphotyrosine Ab (4G10) was from Upstate Biotechnology (Lake Placid, NY). Streptavidin, phorbol myristic acetate (PMA), and PT were from Sigma (St Louis, MO). Ionomycin was from Calbiochem (La Jolla, CA), and [3H]thymidine was from Amersham (Piscataway, NJ).

T cell purification
Purified total T cells were isolated from the spleen by negative selection using a T cell recovery column kit (Cedarlane Labs Limited, ON, CA) according to the manufacturer’s instructions. Purity ranged from 94 to 98% post isolation as determined by flow cytometry of cell surface CD3 expression.

In experiments where the naïve versus memory T cell population was required, CD4+ cells were purified from the mouse spleen using the mouse CD4+ T cell isolation kit according to the manufacturer’s instructions. (Miltenyi Biotech, Auburn, CA). The CD4+ T cells were separated into naïve and memory populations based on CD62L expression by using anti-CD62L microbeads (Miltenyi Biotech, Auburn, CA). Purity was determined by flow cytometry and ranged from 90 to 95% for CD4+ expression, and 80 to 85% and 0 to 2% for CD62L expression on the naïve and memory cell populations, respectively.

T cell stimulation and cytokine assays
Lymphocytes (1–2 x 106/ml) were isolated and cultured in complete RPMI 1640 medium supplemented with 1.0 mM sodium pyruvate, 1x non-essential amino acid, 100 U/ml penicillin, 0.1 mg/ml streptomycin (all from Gibco BRL, Grand Island, NY), 5% heat inactivated fetal calf serum (Hyclone, Logan, UT), and 0.05 µM 2-mercaptoethanol (Sigma), at 37°C in a 5% CO2-humidified atmosphere. Cells were stimulated with plate-bound anti-CD3, in the presence or absence of soluble anti-CD28 (1 µg/ml).

Supernatants for cytokine measurements were harvested after 24 or 48 h of cell culture, stored at –80°C, and assayed using the OptEIA ELISA kits according to manufacturer’s instruction (BD PharMingen, San Diego, CA). Plates were read on a microplate reader (Molecular Devices Corp., Sunnyvale CA). Cytokine concentrations were calculated by SoftMaxPro program based on the standard curves. Linear detection range was 3–200 pg/ml for IL-2, 16–1000 pg/ml for IL-4, and 31–2000 pg/ml for IFN-{gamma} and IL-10, respectively. For measurement of proliferation, splenocytes (106/ml) were cultured in 96-well plates for 48 h and [3H]thymidine (1 µCi/well) was added for the final 6 h. Cultures were harvested and counted on a micro cell harvester and radioactivity counted in a liquid scintillation counter (LKB 1205).

RNA preparation and RT–PCR
Spleens and purified T cells were homogenized in TRIzol Reagent (Gibco BRL, Rockville, MD) with RNaseOUTTM Recombinant Ribonuclease Inhibitor (Gibco BRL). Chloro form extraction was used to separate phases and RNA was precipitated by isopropanol. RT–PCR (Qiagen, Valencia, CA) was used to amplify GAPDH and G{alpha}i1-3 products. An aliquot of 0.5 µg of RNA was used for the RT–PCR. All reactions were performed at 42°C, 30 min, 94°C, 2 min for 1 cycle; 94°C, 30 s, 55°C, 30 s, 72°C, 1 min for 50 cycles; and 72°C, 5 min for 1 cycle. The products were visualized on a 2% agarose gel. GADPH was used to ensure proper RNA preparation and equal loading. Primers for G{alpha}i1, 2 and 3 products were designed as described by Williams et al. (25). G{alpha}i1: 5' ATGAACCGAATGCATGAAAGCA 3' and 5'GTCCTTCCTT TTATTGAGGTCT 3'; G{alpha}i2: 5' GCCAACAAGTACGACGGCA 3' and 5' GTATCTCTCACGCTTCTTGTGCT 3'; G{alpha}i3: 5' ATG AACCGAATGCATGAAAGCA 3' and 5'TTTGGTGTCAGTGG CACAGGTA 3'; GADPH; 5' TGCTGAGTATGTCGTGGACTCT 3' and 5' ATGTGATCATACTTGGCAGGTTTC 3'. Product sizes were 228, 284, 273 and 500 nt, respectively.

Phosphoprotein immunoblotting
Splenic T cells from wild-type or G{alpha}i2–/– mice were purified by negative selection using the T cell recovery column kit (Cedarlane Labs Limited). T cells (1 x 107) in 200 µl RPMI were incubated in the presence or absence of anti-CD3 antibody (5 µg/ml) for 30 min on ice, followed by crosslinking with rabbit anti-hamster IgG (1:200) at 37°C for 5 min. After stimulation, cell pellets were boiled in 2x reducing sample buffer. Cell lysates were resolved on 10% SDS–PAGE, transferred to nitrocellulose membrane and immunoblotted with anti-phosphotyrosine antibody.

Flow cytometry and intracellular calcium flux assay
Splenic mononuclear cells (1 x 106) were stained with anti-CD4-PERCP and anti-CD8-PE, or with anti-CD44-FITC, -CD62L-PE and -CD4-PERCP. At least 10,000 events were collected and analyzed by a FACSCalibur using Cell Quest software (Becton Dickinson, Mountain View, CA).

For calcium flux analysis, purified CD4+ T cells were incubated with 1 µM Indo-1 acetoxy-methyl ester (Indo-1 AM; Molecular Probes, Eugene, OR) for 40 min at 37°C in complete media. Cells were then stained with anti-CD44-FITC, -CD62L-PE and -CD4-PERCP at room temperature to distinguish naïve and memory subsets. Cells (3 x 106 cells/ml) were equilibrated at 37°C for 10 min, and after a 25 s reading for baseline calcium levels, anti-CD3-biotin (15 µg/ml) followed by streptavidin crosslinking (100 µg/ml) were added, and intracellular calcium flux was monitored for 512 s. Cells were gated for the naïve CD4 population (CD4 + CD62LhiCD44lo), and intracellular calcium concentration was calculated based on the ratio of the fluorescence at 400 and 500 nm (analyzed by FLOWJO software; Treestar, San Carlos, CA). For assessment of PT effects, wild-type cells were preincubated with 1 µg/ml PT (Sigma) (or medium control) for 1 h on ice, then loaded with Indo-1 and stimulated as above with anti-CD3 and streptavidin.

Statistical evaluation
When applicable, means of several independent experiments would be calculated with SD, because all experiments were set up in triplicate wells, thus they would not need SEM to adjust. Two-tailed t-tests were performed when applicable, and the differences were significant if P was <0.05, and the important comparisons differed by >2 SD, assuming they were in Gaussian distribution.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mouse T cells express G{alpha}i2 and G{alpha}i3 subunits
The G{alpha}i family of G proteins consists of three distinct subunits. Human immune cells have been shown to express at least two of the 3 G{alpha}i subunits (21), but it is not clear if there is preferential expression of the different G{alpha}i subunits in mouse immune cells, particularly T lymphocytes. There are no available antibodies that distinguish the mouse G{alpha}i subunits, so instead we used PCR to test for mRNA expression in T cells obtained from the spleen of wild-type mice. Figure 1(A) shows that in unfractionated splenocytes and in purified T lymphocytes, mRNA is present from the G{alpha}i2 and G{alpha}i3 genes, but not from G{alpha}i1. This is consistent with evidence that G{alpha}i2 and G{alpha}i3 are both expressed in the mouse immune system, and G{alpha}i1 is primarily restricted to neuronal tissue (7).



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1. G{alpha}i subunit expression and splenic T lymphocyte function. (A) Total RNA was prepared from spleen and purified splenic T cells of 129Sv mice. RT–PCR was used to amplify transcripts from the G{alpha}i1, 2 and 3 genes, and the control GAPDH gene. Positive controls used were plasmids encoding these genes and negative controls were vectors alone. Products were analyzed by agarose electrophoresis and ethidium bromide fluorography. (B–D) Splenocytes (106/ml) were stimulated with anti-CD3{epsilon} (10 µg/ml) for 24 h at 37°C, and (B) IFN-{gamma}, (C) IL-4 and (D) IL-10 production was measured by ELISA. The results are expressed as the mean of triplicate cultures ±SD, and wild-type compared with other groups by a Student’s t-test. Data are representative of four independent experiments.

 
The lack of the G{alpha}i3 subunit does not result in TCR-induced cytokine hyper-responsiveness
The lack of the G{alpha}i2 subunit has been associated with the capacity of splenocytes and mucosal lymphocytes to produce greater amounts of IFN-{gamma} and IL-12 in response to TCR or microbial stimuli respectively (12,16,18,19). Considering that the G{alpha}i2 and G{alpha}i3 subunits share signaling roles in some cell types (26), we determined the role of G{alpha}i3 expression in lymphocyte cytokine responses. We reasoned that if any signaling redundancy existed, lymphocytes that lack the G{alpha}i3 subunit may have a similar alteration in cytokine production.

G{alpha}i3-/- mice were healthy, and colony members were free of detectable disease by inspection or necroscopy even beyond 1 year of age (data not shown). A comparison of splenic T lymphocytes in G{alpha}i2-/- and G{alpha}i3-/- mice is shown in Fig. 2. The relative abundance of CD4+ and CD8+ T cells was comparable among these two null mutation mice, as well as wild-type littermate controls (Fig. 2A). There were also comparable absolute numbers of lymphocytes from spleen, and peripheral and mesenteric lymph nodes, among the three groups of animals (data not shown), indicating an overall similarity in T cell production and survival.



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 2. T lymphocyte subsets in G{alpha}i2-/- mice. Splenic mononuclear cells were isolated from G{alpha}i2-/- and G{alpha}i3-/- mice, and wild-type littermate controls. Cells were stained with CD4, CD8, CD62L and CD44, and analyzed by flow cytometry. (A) CD4 and CD8 profile of total splenocytes; (B) CD62L and CD44 profile, gated on CD4+ splenic T cells. The percentages of CD4+ T cells with naïve (CD62LhiCD44lo) and memory (CD62LloCD44hi) phenotypes are shown. Data are representative of five independent experiments.

 
Analysis of naïve and memory subsets of CD8+ T cells did not uncover differences in this compartment among the G{alpha}i2-/-, G{alpha}i3-/-, and wild-type mice (data not shown). However, there was a distinction in phenotypically naïve and memory CD4+ T cells (Fig. 2B). Compared with wild-type controls, memory CD4+ T cells were at twice the frequency in G{alpha}i2-/- mice, with a commensurate reduction in naïve CD4+ T cells, which was consistent with the observation made by Rudolph et al. (16). There was no significant difference in these subsets in age- and gender-matched G{alpha}i3-/- mice (Fig. 2B). These findings confirm the expanded memory population in G{alpha}i2-/- mice (12), and indicate that this trait is not shared by G{alpha}i3-/- mice.

The cytokine response of CD4+ T cells from these three groups of mice in response to TCR stimulation was compared in Fig. 1(B–D). We found that G{alpha}i3-/- splenocytes produced similar amounts of IFN-{gamma}, IL-4 and IL-10 when compared with wild-type cells. In contrast, G{alpha}i2-/- splenocytes produced significantly increased levels of IFN-{gamma} and IL-4 but not IL-10, as previously reported (16,18). Although both subunits are expressed in T cells, these data specifically identify G{alpha}i2 but not G{alpha}i3 as having a role in regulating the magnitude of cytokine responses following stimulation of T cells through the TCR.

The costimulatory requirement for IL-2 production is relaxed in G{alpha}i2-/- T cells
The increased levels of cytokines produced by G{alpha}i2-/- splenocytes following activation with anti-CD3 mAb indicated that these cells were hyper-responsive to stimulation through the TCR, and prompted us to further characterize their activation requirements specifically for IL-2 production. Optimal T cell activation occurs through a combination of TCR occupancy and interaction with accessory receptors on the T cell to counter-ligands on the antigen presenting cell. This process, costimulation, is necessary for efficient recruitment of signaling molecules into the immune synapse, and a full amplitude and temporal duration of biochemical activity along the recruited signaling pathways (8,27). As shown in Fig. 3(A), activation of G{alpha}i2-/- splenocytes with anti-CD3 alone, notably 1–10 µg/ml, resulted in significantly more IL-2 production compared with wild-type cells. The addition of a costimulatory (anti-CD28) stimulus augmented the production of IL-2 from both G{alpha}i2-/- and wild-type cells. Figure 3(B) shows that when cell proliferation was measured, G{alpha}i2-/- cells proliferated to a much greater extent than wild-type cells correlating with the IL-2 data. Analysis of T cells from G{alpha}i2-/- and wild-type mice for CD3 or CD28 expression by flow cytometry did not reveal any major differences (data not shown). These results indicate that G{alpha}i2-/- T cells are less stringent in their requirement for costimulation for enhanced IL-2 production and proliferation.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3. Increased IL-2 production and proliferation of CD4+ T cells from G{alpha}i2-/- mice in response to anti-CD3{epsilon} and anti-CD28 costimulation. (A) Splenocytes (106/ml) were stimulated in 24-well plates with increasing concentrations of plate-bound anti-CD3{epsilon} (1–10 µg/ml) alone or with soluble anti CD28 (1 µg/ml). IL-2 production was measured by ELISA. (B) Splenocytes (106/ml) in 96-well plate were stimulated with plate bound anti-CD3{epsilon} (10 µg/ml) in the presence or absence of anti-CD28 (1 µg /ml) for 48 h at 37°C. Cell proliferation was determined by [3H]thymidine incorporation. Values reflect the mean of triplicate cultures ±SD. Data shown are representative of two independent experiments showing similar results. (C) Purified naïve CD4+ T cells (2 x 106/ml) isolated from the spleen of G{alpha}i2-/- and wild-type mice were stimulated with plate-bound anti-CD3{epsilon} (1 µg/ml) for 48 h at 37°C. Supernatants were harvested and IL-2 production was measured by ELISA. Results are representative of two independent experiments with similar results.

 
It has been previously demonstrated that G{alpha}i2-/- mice have increased numbers of memory T cells present in the spleen (16) (Fig. 2B). Because memory T cells are thought to display relaxed activation requirements when stimulated through the TCR than naïve cells (28), it was possible that the higher levels of cytokines produced by G{alpha}i2-/- splenocytes were due to preferential stimulation of this antigen experienced T cell population. To examine this, we isolated naïve T cells from the spleen of G{alpha}i2-/- and wild-type mice and measured IL-2 production following stimulation with anti-CD3 (Fig. 3C). Naïve G{alpha}i2-/- T cells produced ~5–7-fold more IL-2 compared to naïve wild-type cells following activation with anti-CD3. These data demonstrate that the G{alpha}i2 deficiency renders naïve T cells less stringent with regard to their activation requirements, and further indicate that the cytokine hyper-responsiveness observed with G{alpha}i2-/- splenocytes is not necessarily due to preferential stimulation of the memory cell population.

Agents that bypass the TCR do not result in G{alpha}i2-/- T cell hyper-responsiveness
To determine if the increased cytokine production by G{alpha}i2-/- T cells was restricted to signals initiated only through the TCR, we examined the levels of IL-2 and IFN-{gamma} following activation with PMA and ionomycin, agents that bypass the antigen receptor (29) (Table 1). Activation of purified T cells with PMA and ionomycin resulted in cytokine levels that were similar between wild-type and G{alpha}i2-/- cells. In contrast, stimulation with anti-CD3 resulted in markedly enhanced production of IL-2 and IFN-{gamma}. These results localize the alteration in G{alpha}i2-deficient T cells to TCR signaling events preceding the distal calcium and MAP-kinase induced biochemical pathways directly activated by these pharmacologic agents.


View this table:
[in this window]
[in a new window]
 
Table 1. Cytokine production by purified T cells
 
TCR stimulation of G{alpha}i2-/- CD4+ T cells displays a globally augmented calcium response
One of the important TCR-induced signaling pathways leads to increased intracellular calcium and its sequelae (30). We therefore performed intracellular calcium flux assays to compare the calcium response of naïve CD4+ T cells to anti-CD3 stimulation from wild-type, G{alpha}i2-/- and G{alpha}i3-/- mice. As shown in Fig. 4(A), the calcium response in G{alpha}i2-/- T cells was distinguished from wild-type by faster kinetics, higher amplitude and delayed resequestration of intracellular calcium. A small but consistent elevation in baseline intracellular calcium concentration was also observed in G{alpha}i2-/- T cells. Conversely, G{alpha}i3-/- T cells (compared with wild-type) had a slight reduction in baseline calcium, and a modest reduction in the kinetics and amplitude of the TCR-stimulated calcium response (Fig. 4B).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 4. TCR-stimulated intracellular calcium flux and tyrosine phosphorylation. (A–C) CD4+ T cells were loaded with Indo-1, stained with subset-specific antibodies, equilibrated at 37°C, and stimulated with anti-CD3-biotin immediately followed by crosslinking with streptavidin. Intracellular calcium mobilization was observed for 512 seconds, and data was analyzed from events gated on the naïve CD4+ T cell population. (A) G{alpha}i2-/- and concurrent wild-type control; (B) G{alpha}i3-/- and concurrent wild-type control. (C) Wild-type CD4+ T cells preincubated for 1 h with pertussis, or with medium alone, prior to Indo-1 loading and stimulation with anti-CD3 and streptavidin. Representative of three independent experiments. (D) Wild-type and G{alpha}i2-/- T cells were incubated in the presence or absence of anti-CD3 antibody followed by crosslinking with rabbit anti-hamster IgG. Cell lysates were resolved on 10% SDS–PAGE, transferred to nitrocellulose membrane, and immunoblotted with anti-phosphotyrosine antibody. Open arrowheads denote constitutive phosphoproteins in G{alpha}i2-/- cells. Closed arrowhead denotes a TCR-induced phosphoprotein. Representative of six independent experiments.

 
One explanation for this result is that Gi activity has a direct, negative-regulatory effect on the TCR-stimulated calcium response, as recently reported for the BCR-stimulated calcium response (31). We therefore analyzed wild-type T cells pretreated with pertussis, under conditions which augment the BCR-mediated calcium response (Fig. 4C). However, pertussis treatment had only a modest effect on the TCR-mediated calcium response, consistent with other studies (3234).

TCR ligation initiates several protein kinase cascades contributing to calcium mobilization and its sequelae, as well as other direct pathways of biochemical activation and transcriptional regulation (8,35). We examined the global changes in TCR-induced protein tyrosine phosphorylation of G{alpha}i2-/- and wild-type T cells with anti-phosphotyrosine immunblots (Fig. 4D). Certain phosphoprotein bands were constitutively more prominent in G{alpha}i2-/- T cells (black arrowheads), but there was no obvious difference in TCR-induced phosphorylation (e.g. pp20). Moreover, immunoprecipitation and anti-phosphotyrosine immunoblot analysis of PLC-{gamma}, PKC-{theta}, LAT and Lck also failed to reveal differences between these two groups of T cells (data not shown). It therefore appeared that the unusual calcium response in G{alpha}i2-/- cells was not associated with a proximal kinase pathway abnormality.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
G{alpha}i2 signaling regulates IL-12 production (12), but an independent role of G{alpha}i signaling on TCR-mediated cytokine expression has not been well characterized. This study shows a selective role of G{alpha}i2 in T lymphocyte responsiveness to TCR signaling and cytokine production. T cell hyper-responsiveness in the G{alpha}i2-/- mouse is a selective, intrinsic feature of the naïve CD4+ T cell subset, manifested by relaxed costimulatory requirement and a cell physiologic abnormality in TCR-mediated calcium signaling. Our findings prompt reconsideration of the selective roles of G{alpha}i subsets, the immunobiologic disorder of the CD4+ T cell in G{alpha}i2-/- mice, and the nature of crosstalk between G{alpha}i2 and TCR signaling.

This study newly demonstrated that the G{alpha}i2 and G{alpha}i3 are the G{alpha}i subunits expressed in murine splenic T cells, extending previous reports concerning human blood T cells (21,36). Since G{alpha}i2 and G{alpha}i3 can have overlapping signaling roles (26), we were led to examine whether any abnormalities in TCR-mediated cytokine production were present in lymphocytes obtained from animals deficient in this G protein. However, unlike in G{alpha}i2-/- mice, G{alpha}i3-/- mice had normal production of IFN-{gamma}, IL-4 and IL-10. Thus, the G{alpha}i3 subunit did not appear to have a major role in regulating the magnitude of these cytokines in response to TCR engagement. The increased levels of cytokines produced by G{alpha}i2-/- cells also indicated that the G{alpha}i3 subunit could not functionally compensate for the absence of the other subunit. These data were obtained from splenocyte cultures, so the source of the cytokines may in part reflect non-T cells activated under these culture conditions. For example, the predominant source of IL-10 in such cultures after TCR stimulation is B lymphocytes (37). These results suggest that, at least in response to TCR stimuli, the G{alpha}i2 and G{alpha}i3 subunits have distinct, non-redundant signaling roles. Within this context, the G{alpha}i2 subunit is reported to be more abundantly expressed in T cells than the G{alpha}i3 subunit (20). Consequently, it is possible that the observed lack of signaling redundancy or functional compensation may relate in part to significantly lower expression levels of the G{alpha}i3 subunit in lymphocytes.

Our findings suggest an unappreciated intrinsic disorder in naïve CD4+ T cells. Enhanced cytokine production was observed with purified naïve CD4+ G{alpha}i2-/- T cells, indicating that this phenotype was not due to the preferential contribution of the expanded memory T cells or altered costimulatory cell activity in G{alpha}i2-/- spleen cell population. The naïve CD4+ T cell population in G{alpha}i2-/- mice was less stringent in its costimulatory requirement, with substantial cytokine production in the absence of costimulation at low to moderate levels of TCR ligation. It has been proposed that autoimmunity may occur when T cells no longer require a costimulatory or second signal to become optimally activated (38). In view of the exceptional colitis susceptibility of G{alpha}i2-/- mice, this hyper-responsiveness may represent an intrinsic T cell trait contributing to the autoimmune phenotype. Since IL-10 production was similar between wild-type and G{alpha}i2-/- splenocytes, it is likely that deficient IL-10 production by G{alpha}i2-/- mice in other in vitro and in vivo conditions reflects the skewed pro-inflammatory differentiation of antigen-presenting cell types associated with this null mutation.

The biochemical basis of TCR hyper-responsiveness in G{alpha}i2-/- T cells is perplexing. Activation with PMA and ionomycin revealed no difference between wild-type and G{alpha}i2-/- T cells. These agents bypass the antigen receptor to directly activate the Ca2+/calcineurin and protein kinase C pathways, suggesting that the TCR-mediated hyper-responsiveness in G{alpha}i2-/- T lymphocytes is due to an alteration involving proximal TCR signaling events. Accordingly, we observed that G{alpha}i2-/- CD4+ T cells responded to TCR stimulation with an augmented calcium response. However, other experiments did not reveal a concomitant elevation in activity of key upstream protein kinases. This suggests that the aberrant calcium response may involve distal steps in receptor-mediated calcium mobilization.

The products of activated PLC-{gamma}, diacylglycerol and IP3, mobilize endoplasmic reticulum calcium ion stores through channels activated by the InsP3 receptor and perhaps ryanodine receptors (30,39,40). This event activates plasma membrane store operated calcium channels (4143), which mediate capacitative calcium entry. This calcium current (I-CRAC), and its augmentation by calcium-dependent potassium channels, is responsible for the sustained, oscillatory intracellular calcium concentration sufficient to induce the calcium-dependent pathways to cytokine gene expression and cell proliferation (35,44,45). It is thus plausible that the augmented calcium response in G{alpha}i2-/- T cells (accelerated kinetics, increased amplitude and delayed resequestration) might reflect increased activity of one of these channels. With advances in the understanding of these molecules and reagents for their study, this prediction is becoming experimentally testable.

How does G{alpha}i2 activity affect the calcium response? Our pertussis experiment suggests that G{alpha}i2 activity does not directly influence the process. These results with knockout mice contrast with some studies utilizing human peripheral T cells or the Jurkat T cell line (22,23,34). The divergent results may relate to the differences between human and mouse cells, and the divergent inhibitory and stimulatory biological effects of PT in different cell types. Instead, we surmise that a G{alpha}i2-dependent process attenuates the constitutive expression or activity of molecules in the pertinent phase of the receptor-mediated calcium response. This may be a remote differentiative effect on the naïve CD4+ T cell, and may not be easily amenable to study. However, genetic manipulations and adoptive transfer should make it possible to determine whether or not the process requires G{alpha}i2 expression at the level of the T cell.

Taken together, our results suggest that in the normal situation, G{alpha}i2 may function as a negative regulator of T cell activation and cytokine production, most likely by attenuating the expression or activity of molecules affecting the sustained calcium response to TCR signaling pathways. These findings further support the idea that G protein coupled receptors utilizing G{alpha}i2 signaling may be an important molecular context for physiologic immunoregulation, and a potential target for molecular pathophysiology and therapeutic immunomodulation.


    Acknowledgements
 
This research was supported by a VA Career Development Award (R.A.), the UCLA Clinical and Fundamental Immunology Training Grant (AI 07126–23) (H.D. and T.H.), NIH grant DK46763 (J.B.), CURE Digestive Disease Research Center (J.B.), NIH grant DK43026 (L.B.), the Blinder Foundation for Crohn’s Disease Research (Y.Z), NIH grant RO1CA65979 and Arthritis Foundation Grant (M.C.M.), and Microbial Pathogenesis Training Grant 5T32AI07325 (C.C.). Flow cytometry was performed in the UCLA Jonsson Comprehensive Cancer Center and Center for AIDS Research Flow Cytometry Core Facility, supported by National Institute of Health awards CA-16042 and AI-28697.


    Abbreviations
 
G{alpha}i—G protein inhibitory alpha subunit

IP3—1,4,5-inositol trisphosphate

PE—phycoerythrin

PMA—phorbol myristic acetate

PT—pertussis toxin


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Stanners, J., Kabouridis, P. S., McGuire, K. L. and Tsoukas, C. D. 1995. Interaction between G proteins and tyrosine kinases upon T cell receptor. CD3-mediated signaling. J. Biol. Chem. 270:30635.[Abstract/Free Full Text]
  2. Marinissen, M. J. and Gutkind, J. S. 2001. G-protein-coupled receptors and signaling networks: emerging paradigms. Trends Pharmacol. Sci. 22:368.[CrossRef][Medline]
  3. Neves, S. R., Ram P. T. and Iyengar, R. 2002. G protein pathways. Science 296:1636.[Abstract/Free Full Text]
  4. Farfel, Z., Bourne, H. R. and Iiri, T. 1999. The expanding spectrum of G protein diseases. N. Engl. J. Med. 340:1012.[Free Full Text]
  5. Stoyanov, B., Volinia, S., Hanck, T., Rubio, I., Loubtchenkov, M., Malek, D., Stoyanova, S., Vanhaesebroeck, B., Dhand, R. and Nurnberg, B. 1995. Cloning and characterization of a G protein-activated human phosphoinositide-3 kinase. Science 269:690.[Abstract/Free Full Text]
  6. Bourne, H. R. 1997. How receptors talk to trimeric G proteins. Curr. Opin. Cell Biol. 9:134.[CrossRef][Web of Science][Medline]
  7. Birnbaumer, L. and Birnbaumer, M. 1995. Signal transduction by G proteins: 1994 edition. J. Recept. Signal Transduct. Res. 15:213.[Web of Science][Medline]
  8. Bromley, S. K., Burack, W. R., Johnson, K. G., Somersalo, K., Sims, T. N., Sumen, C., Davis, M. M., Shaw, A. S., Allen, P. M. and Dustin, M. L. 2001. The immunological synapse. Annu. Rev. Immunol. 19:375.[CrossRef][Web of Science][Medline]
  9. Berdyshev, E. V. 2000. Cannabinoid receptors and the regulation of immune response. Chem. Phys. Lipids 108:169.[CrossRef][Web of Science][Medline]
  10. Kabarowski, J. H., Zhu, K., Le, L. Q., Witte, O. N. and Xu, Y. 2001. Lysophosphatidylcholine as a ligand for the immunoregulatory receptor G2A. Science 293:702.[Abstract/Free Full Text]
  11. Ryan, M., McCarthy, L., Rappuoli, R., Mahon, B. P. and Mills, K. H. 1998. Pertussis toxin potentiates Th1 and Th2 responses to co-injected antigen: adjuvant action is associated with enhanced regulatory cytokine production and expression of the co-stimulatory molecules B7-1, B7-2 and CD28. Int. Immunol. 10:651.[Abstract/Free Full Text]
  12. He, J., Gurunathan, S., Iwasaki, A., Ash-Shaheed, B. and Kelsall, B. L. 2000. Primary role for Gi protein signaling in the regulation of interleukin 12 production and the induction of T helper cell type 1 responses. J. Exp. Med. 191:1605.[Abstract/Free Full Text]
  13. Brabb, T., Goldrath, A. W., von Dassow, P., Paez, A., Liggitt, H. D. and Goverman, J. 1997. Triggers of autoimmune disease in a murine TCR-transgenic model for multiple sclerosis. J. Immunol. 159:497.[Abstract]
  14. McAllister, C. G., Vistica, B. P., Sekura, R., Kuwabara, T. and Gery, I. 1986. The effects of pertussis toxin on the induction and transfer of experimental autoimmune uveoretinitis. Clin. Immunol. Immunopathol. 39:329.[CrossRef][Web of Science][Medline]
  15. Shive, C. L., Hofstetter, H. H., Arredondo, L., Shaw, C. and Forsthuber, T. 2002. The enhanced antigen-specific production of cytokines induced by pertussis toxin is due to clonal expansion of T cells and not to altered effector functions of long-term memory cells. Eur. J. Immunol. 30:2422.
  16. Rudolph, U., Finegold, M. J., Rich, S. S., Harriman, G. R., Srinivasan, Y., Brabet, P., Boulay, G., Bradley, A. and Birnbaumer, L. 1995. Ulcerative colitis and adenocarcinoma of the colon in G{alpha}i2-deficient mice. Nat. Genet. 10:143.[Web of Science][Medline]
  17. Hornquist, C. E., Lu, X., Rogers-Fani, P. M., Rudolph, U., Shappell, S., Birnbaumer, L. and Harriman, G. R. 1997. G{alpha}i2-deficient mice with colitis exhibit a local increase in memory CD4+ T cells and proinflammatory Th1-type cytokines. J. Immunol. 158:1068.[Abstract]
  18. Ohman, L., Franzen, L., Rudolph, U., Harriman, G. R. and Hultgren Hornquist, E. 2000. Immune activation in the intestinal mucosa before the onset of colitis in G{alpha}i2-deficient mice. Scand. J. Immunol. 52:80.[CrossRef][Web of Science][Medline]
  19. Ohman, L., Franzen, L., Rudolph, U., Birnbaumer, L. and Hornquist, E. H. 2002. Regression of Peyer’s patches in G{alpha}i2 deficient mice prior to colitis is associated with reduced expression of Bcl-2 and increased apoptosis. Gut 51:392.[Abstract/Free Full Text]
  20. Morris, A. J. and Malbon, C. C. 1999. Physiological regulation of G protein-linked signaling. Physiol. Rev. 79:1373.[Abstract/Free Full Text]
  21. Solomon, K. R., Rudd, C. E. and Finberg, R. W. 1996. The association between glycosylphosphatidylinositol-anchored proteins and heterotrimeric G protein alpha subunits in lymphocytes. Proc. Natl Acad. Sci. USA 93:6053.[Abstract/Free Full Text]
  22. Stanley, J. B., Gorczynski, R. M., Delovitch, T. L. and Mills, G. B. 1989. IL-2 secretion is pertussis toxin sensitive in a T lymphocyte hybridoma. J. Immunol. 142:3546.[Abstract]
  23. Lippert, E., Jacques, Y. and Hermouet, S. 2000. Positive regulation of human T cell activation by Gi2 proteins and interleukin-8. J. Leukoc. Biol. 67:742.[Abstract]
  24. Jiang, M., Spicher, K., Boulay, G., Martin-Requero, A., Dye, C. A., Rudolph, U. and Birnbaumer, L. 2002. Mouse gene knockout and knockin strategies in application to alpha subunits of Gi/Go family of G proteins. Methods Enzymol. 344:277.[Web of Science][Medline]
  25. Williams, C. J., Schultz, R. M. and Kopf, G. S. 1996. G protein gene expression during mouse oocyte growth and maturation, and preimplantation embryo development. Mol. Reprod. Dev. 44:315.[CrossRef][Web of Science][Medline]
  26. Rudolph, U., Spicher, K. and Birnbaumer, L. 1996. Adenylyl cyclase inhibition and altered G protein subunit expression and ADP-ribosylation patterns in tissues and cells from Gi2{alpha}-/- mice. Proc. Natl Acad. Sci. USA 93:3209.[Abstract/Free Full Text]
  27. Greenfield, E. A., Nguyen, K. A. and Kuchroo, V. K. 1998. CD28/B7 costimulation: a review. Crit. Rev. Immunol. 18:389.[Web of Science][Medline]
  28. Croft, M., Bradley, L. M. and Swain, S. L. 1994. Naive versus memory CD4 T cell response to antigen. Memory cells are less dependent on accessory cell costimulation and can respond to many antigen-presenting cell types including resting B cells. J. Immunol. 152:2675.[Abstract]
  29. Takahama, Y. and Nakauchi, H. 1996. Phorbol ester and calcium ionophore can replace TCR signals that induce positive selection of CD4 T cells. J. Immunol. 157:1508.[Abstract]
  30. Lewis, R. S. 2001. Calcium signaling mechanisms in T lympho cytes. Annu. Rev. Immunol. 19:497.[CrossRef][Web of Science][Medline]
  31. Dalwadi, H., Wei, B., Schrage, M., Su, T. T., Rawlings, D. J. and Braun, J. 2003. B cell developmental requirement for the G{alpha}i2 gene. J. Immunol. 170:1707.[Abstract/Free Full Text]
  32. Bromley, S. K., Peterson, D. A., Gunn, M. D. and Dustin, M. L. 2000. Cutting edge: hierarchy of chemokine receptor and TCR signals regulating T cell migration and proliferation. J. Immunol. 165:15.[Abstract/Free Full Text]
  33. Deehan, M. R., Klaus, G. G., Holman, M. J., Harnett, W. and Harnett, M. M. 1998. MAPkinase: a second site of G-protein regulation of B-cell activation via the antigen receptors. Immunology 95:169–177.[CrossRef][Web of Science][Medline]
  34. Vistica, B. P., McAllister, C. G., Sekura, R. D., Ihle, J. N., and Gery, I. 1986. Dual effects of pertussis toxin on lymphoid cells in culture. Cell. Immunol. 101:232.[CrossRef][Web of Science][Medline]
  35. Lewis, R. S. and Cahalan, M. D. 1995. Potassium and calcium channels in lymphocytes. Annu. Rev. Immunol. 13:623.[Web of Science][Medline]
  36. Solomon, K. R., Kurt-Jones, E. A., Saladino, R. A., Stack, A. M., Dunn, I. F., Ferretti, M., Golenbock, D., Fleisher, G. R. and Finberg, R. W. 1998. Heterotrimeric G proteins physically associated with the lipopolysaccharide receptor CD14 modulate both in vivo and in vitro responses to lipopolysaccharide. J. Clin. Invest. 102:2019.[Web of Science][Medline]
  37. Dalwadi, H., Wei, B., Kronenberg, M., Sutton, C. L. and Braun, J. 2001. The Crohn’s disease-associated bacterial protein I2 is a novel enteric T cell superantigen. Immunity 15:149.[CrossRef][Web of Science][Medline]
  38. Bachmaier, K., Krawczyk, C., Kozieradzki, I., Kong, Y. Y., Sasaki, T., Oliveira dos Santos, A., Mariathasan, S., Bouchard, D., Wakeham, A. and Itie, A. 2000. Negative regulation of lymphocyte activation and autoimmunity by the molecular adaptor Cbl-b. Nature 403:211.[CrossRef][Medline]
  39. Fill, M. and Copello, J. A. 2002. Ryanodine receptor calcium release channels. Physiol. Rev. 82:893.[Abstract/Free Full Text]
  40. Ritter, M., Menon, S., Zhao, L., Xu, S., Shelby, J. and Barry, W. H. 2001. Functional importance and caffeine sensitivity of ryanodine receptors in primary lymphocytes. Int. Immunopharmacol. 1:339.[CrossRef][Web of Science][Medline]
  41. Ma, H. T., Patterson, R. L., van Rossum, D. B., Birnbaumer, L., Mikoshiba, K. and Gill, D. L. 2000. Requirement of the inositol trisphosphate receptor for activation of store-operated Ca2+ channels. Science 287:1647.[Abstract/Free Full Text]
  42. Cui, J., Bian, J. S., Kagan, A. and McDonald, T. V. 2002. CaT1 contributes to the stores-operated calcium current in Jurkat T-lymphocytes. J. Biol. Chem. 277:47175.[Abstract/Free Full Text]
  43. Mori, Y., Wakamori, M., Miyakawa, T., Hermosura, M., Hara, Y., Nishida, M., Hirose, K., Mizushima, A., Kurosaki, M., Mori, E., Gotoh, K., Okada, T., Fleig, A., Penner, R., Iino, M. and Kurosaki, T. 2002. Transient receptor potential 1 regulates capacitative Ca(2+) entry and Ca(2+) release from endoplasmic reticulum in B lymphocytes. J. Exp. Med. 195:673.[Abstract/Free Full Text]
  44. Kerschbaum, H. H. and Cahalan, M. D. 1999. Single-channel recording of a store-operated Ca2+ channel in Jurkat T lymphocytes. Science 283:836.[Abstract/Free Full Text]
  45. Fanger, C. M., Rauer, H., Neben, A. L., Miller, M. J., Rauer, H., Wulff, H., Rosa, J. C., Ganellin, C. R., Chandy, K. G. and Cahalan, M. D. 2001. Calcium-activated potassium channels sustain calcium signaling in T lymphocytes. Selective blockers and manipulated channel expression levels. J. Biol. Chem. 276:12249.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
K. M. Spach, R. Noubade, B. McElvany, W. F. Hickey, E. P. Blankenhorn, and C. Teuscher
A Single Nucleotide Polymorphism in Tyk2 Controls Susceptibility to Experimental Allergic Encephalomyelitis
J. Immunol., June 15, 2009; 182(12): 7776 - 7783.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. McPherson, B. Wei, O. Turovskaya, D. Fujiwara, S. Brewer, and J. Braun
Colitis immunoregulation by CD8+ T cell requires T cell cytotoxicity and B cell peptide antigen presentation
Am J Physiol Gastrointest Liver Physiol, September 1, 2008; 295(3): G485 - G492.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I.-Y. Hwang, C. Park, and J. H. Kehrl
Impaired Trafficking of Gnai2+/- and Gnai2-/- T Lymphocytes: Implications for T Cell Movement within Lymph Nodes
J. Immunol., July 1, 2007; 179(1): 439 - 448.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
B. Hoang, A. Trinh, and R. A. Edwards
Decreased MAPK- and PGE2-dependent IL-11 production in Gi{alpha}2-/- colonic myofibroblasts
Am J Physiol Gastrointest Liver Physiol, June 1, 2007; 292(6): G1511 - G1519.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
U. M. Padigel, L. Stein, K. Redding, J. J. Lee, T. J. Nolan, G. A. Schad, L. Birnbaumer, and D. Abraham
Signaling through G{alpha}i2 protein is required for recruitment of neutrophils for antibody-mediated elimination of larval Strongyloides stercoralis in mice
J. Leukoc. Biol., April 1, 2007; 81(4): 1120 - 1126.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. D. Thompson, Y. Jin, K. H. Wu, R. A. Colvin, A. D. Luster, L. Birnbaumer, and M. X. Wu
Inhibition of G{alpha}i2 Activation by G{alpha}i3 in CXCR3-mediated Signaling
J. Biol. Chem., March 30, 2007; 282(13): 9547 - 9555.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Okada and J. G. Cyster
CC Chemokine Receptor 7 Contributes to Gi-Dependent T Cell Motility in the Lymph Node
J. Immunol., March 1, 2007; 178(5): 2973 - 2978.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Y. Wu, Y. Jin, R. A. Edwards, Y. Zhang, M. J. Finegold, and M. X. Wu
Impaired TGF-{beta} Responses in Peripheral T Cells of G{alpha}i2-/- Mice
J. Immunol., May 15, 2005; 174(10): 6122 - 6128.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
Y. Zhang, M. J. Finegold, Y. Jin, and M. X. Wu
Accelerated transition from the double-positive to single-positive thymocytes in G{alpha}i2-deficient mice
Int. Immunol., March 1, 2005; 17(3): 233 - 243.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Wei, P. Velazquez, O. Turovskaya, K. Spricher, R. Aranda, M. Kronenberg, L. Birnbaumer, and J. Braun
Mesenteric B cells centrally inhibit CD4+ T cell colitis through interaction with regulatory T cell subsets
PNAS, February 8, 2005; 102(6): 2010 - 2015.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (23)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Huang, T. T.
Right arrow Articles by Aranda, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, T. T.
Right arrow Articles by Aranda, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?