Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Citing Articles
Right arrowScopus Links
Google Scholar
Right arrow Articles by Endrizzi, B. T.
Right arrow Articles by Jameson, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Endrizzi, B. T.
Right arrow Articles by Jameson, S. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 15, No. 11, pp. 1341-1348, November 2003
© 2003 Japanese Society for Immunology

Differential role for IL-7 in inducing lung Kruppel-like factor (Kruppel-like factor 2) expression by naive versus activated T cells

Bart T. Endrizzi1 and Stephen C. Jameson1

1 Center for Immunology and Department of Laboratory Medicine and Pathology, University of Minnesota, Minneapolis, MN 55455, USA

Correspondence to: S. Jameson; E-mail: james024{at}umn.edu
Transmitting editor: M. J. Bevan


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Kruppel-like Factor 2 [KLF2, also called lung Kruppel-like factor (LKLF)] is a transcription factor shown to be necessary for the maintenance of naive T cells. KLF2 is expressed in both naive and memory cells, and is proposed to promote quiescence in these populations. During T cell stimulation, both KLF2 protein and mRNA are down-regulated, and loss of KLF2 appears to be critical for full T cell activation. It is unclear, however, how KLF2 expression is maintained in naive T cells. Recently it was proposed that IL-7, which is known to promote KLF2 re-expression in antigen-stimulated T cells, may also induce KLF2 expression in naive T cells. Here we address this issue by comparing the impact of IL-7 on KLF2 expression in naive and activated T cells. Use of bcl-2 transgenic T cells allowed us to uncouple the requirements for IL-7 in preserving naive T cell survival from its role in maintaining KLF2 expression. Our data demonstrates that IL-7 signals are not required for KLF2 maintenance in naive T cells, suggesting that this cytokine has distinct effects on KLF2 expression in naive versus activated T cells.

Keywords: cytokine, homeostasis, survival, T cell


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Twenty-three mammalian members of the SP1/Kruppel-like family (KLF) of transcription factors have been identified. Of the factors that have been studied, most have been shown to be critical in the development and function of the tissues where they are expressed (1). One member of this family, KLF2 [also called lung Kruppel-like factor (LKLF)], is expressed in the lung bud cells going through lung morphogenesis and in the smooth muscle cells that generate the tunica media of the vasculature during vasculogenesis, as well as in both B and T cells (25). KLF2 gene ablation causes severe defects in late lung differentiation and in proper function of the tunica media in the vasculature, the latter leading to a compromise in blood vessel integrity that is lethal for the embryo (3,68). These findings reinforce the profound role this family of transcription factors plays in tissue formation and function, and shows the critical nature of KLF2 in the tissues where it is expressed.

In addition to its role in lung and vascular development, it has been shown that KLF2 is critical for survival of naive T cells. KLF2 is expressed at the single-positive stage of T cell development, and continues to be expressed in peripheral naive and memory T cells, but is rapidly down-regulated in T cells that have been stimulated through the TCR (5,6,9,10). KLF-2-deficient T cells have been generated using Rag-blastocyst chimeras, revealing that the lack of KLF2 has a profound effect on maintenance of mature T cells. KLF2-deficient T cells are nearly absent in peripheral lymphoid tissues, and the few remaining cells display markers typical of activation (CD69+, CD44high, CD62L, Fas ligand+) and readily progress through apoptotic death following isolation (6). KLF2 has been thus hypothesized to facilitate survival of naive T cells by maintaining cells in a quiescent state. Thymic development of T cells and maintenance of B cells appears unaffected by KLF2 deficiency (6). In contrast to the necessity of KLF2 expression in naive T cells, loss of KLF2 protein appears to be important for T cell activation: forced expression of KLF2 in Jurkat T cells leads to a reduction in cellular proliferation, cell size and protein synthesis (11). Together, these data support the hypothesis that KLF2 acts chiefly as a quiescence factor, promoting T cell survival by inducing a state of rest in mature naive and memory T cells.

Given the essential role of KLF2 in T cell homeostasis, it is fundamental to understand how KLF2 expression is regulated. Previously, we have shown that KLF2 re-expression can be induced in activated T cells through stimulation with either IL-2 or IL-7 (9). Both of these cytokines are also known to promote survival of activated T cells (9,12). These findings, along with the demonstration that KLF2 is expressed in memory T cells (9,10), suggest that induction of KLF2 by pro-survival cytokines supports maintenance of activated T cells and possibly their differentiation into the memory pool.

However, while these experiments shed light on the regulation of KLF2 in T cells after encounter with antigen, the factors that control KLF2 expression in naive T cells are unknown. Both we (9) and DiSanto (13) have proposed that KLF2 expression in naive T cells might also be maintained by stimulation through cytokines. IL-7 supports naive T cell survival in vitro (14,15) and recent data suggests it plays a non-redundant role in promoting naive T cell homeostasis in vivo (1619). These results, along with the coincident loss in expression of IL-7 receptor {alpha} chain and KLF2 expression early after T cell stimulation (9,17) and the ability of IL-7 to induce KLF2 re-expression late in T cell activation, as discussed above, lead DiSanto to propose IL-7 as an attractive candidate for a mediator of KLF2 expression in naive T cells (13).

IL-7 mediates its effects on survival, at least in part, through regulation of pro- and anti-apoptotic bcl-2 family members (19,20), and overexpression of bcl-2 can substitute for IL-7 receptor {alpha} in T cell development and survival (21,22). However, other data suggest the ability of IL-7 to maintain T cell survival may not depend on bcl-2 alone: IL-7 can augment survival of bcl-2-deficient T cells (23) and bcl-2 transgenes only partially restore T cell development in mice deficient in the common {gamma} chain ({gamma}c), a component of IL-7 receptor and several other cytokine receptors (24,25). More recently, Rathmell et al. (26) suggested that IL-7 stimulation was unnecessary for maintenance of bcl-2 expression in naive T cells, but that it was necessary for preservation of cell size and metabolic activity. These data leave open the possibility that one component of IL-7-mediated naive T cell survival might be maintenance of KLF2 expression. In this context, IL-7 may be acting to promote both naive T cell survival (through regulation of bcl-2 family members) and quiescence (through regulation of KLF2) (13).

Here we investigate the maintenance of KLF2 in naive T cells cultured in vitro in the presence or absence of IL-7. Most naive T cells die following IL-7 deprivation, but through isolation of remaining viable cells and parallel use of bcl-2 transgenic T cells to bypass cell death induced by cytokine withdrawal we show that IL-7 is not required to maintain normal expression levels of KLF2 in naive T cells. In contrast, we demonstrate that IL-7 induces expression of both KLF2 mRNA and protein in antigen-stimulated T cells. Thus, KLF2 expression appears to be regulated by distinct mechanisms in naive versus activated T cells, with IL-7 playing a key role in KLF2 induction only for the activated pool.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice
OT-I transgenic mice (27) were bred in our colony. OT-I CD8+ T cells respond to ovalbumin peptide (OVAp; SIINFEKL) presented by Kb. C57BL/6 mice were obtained from NCI (Fredrick, MD) or the Jackson Laboratory (Bar Harbor, ME). OT-I bcl-2 transgenic mice were generated from bcl-2 transgenic mice from the Jackson Laboratory (21) and Rag–/– OT-I bcl-2 transgenic mice were a kind gift from Dr Stephen Schoenberger (La Jolla Institute for Allergy and Immunology, San Diego CA).

T cell purification and culture
CD8+ T cells from OT-I transgenic mice were isolated from the lymph node and spleen through depletion of CD4+, IAb+ and B220+ cells by MACS high gradient magnetic separation columns (Miltenyi Biotec, Bergisch Gladbach, Germany). Briefly, cells were stained with the above-mentioned antibodies conjugated with FITC at a concentration of 0.14 µg antibody/107 cells and passed through the MACS column. Memory T cells were also removed with CD44 conjugated to FITC at a lower concentration of 0.045 µg antibody /107cells. This protocol yielded >93% purity for CD8+ cells and >95% purity for CD44low cells.

Naive T cells were cultured in RPMI media supplemented with 10% FCS, L-glutamine, 2-mercaptoethanol, HEPES and antibiotics (RP10 media). The cells were plated in a 24-well flat-bottom plate at 2 x 106 cells/ well in 2 ml of media and cultured up to 48 h with or without 10 ng/ml IL-7. Recombinant mouse IL-7 was obtained from R & D Systems (Minneapolis, MN) and was used in culture at 10 ng/ml. Recombinant mouse IL-12 was a kind gift from the laboratory of Dr Matt Mescher who obtained it from Genetics Institute (Cambridge, MA).

T cell stimulation was performed by culturing purified naive OT-I T cells with 5AKb fibroblasts pulsed with 10 nM OVAp as previously described (9). Cells were stimulated in the absence of exogenous cytokines for 48 h and then cultured with either IL-7 (10 ng/ml) alone or IL-7 plus IL-12 (1000 U/ml) for a further 24 h, as previously described (9).

For Ficoll purified cells, Cellgro lymphocyte separation medium (Mediatech, cellgro VA) was under-layered using 1:1 volume with the culture media, ~4 ml. The solution was then centrifuged at 1800 r.p.m. for 20 min.

Flow cytometry
Antibodies to CD4, CD8, CD44 and B220 conjugated with FITC, phycoerythrin, allophycocyanin or biotin were purchased from eBioscience (San Diego, CA) and from PharMingen (San Diego, CA). The apoptotic marker Annexin-V was purchased from PharMingen and used according to the manufacturer’s protocol. The cells were analyzed by flow cytometry using a FACSCalibur (Becton Dickinson, Mountain View, CA).

Cell lysis, SDS–PAGE western blot
Cells were collected and lysed at 2 x 106 cells in 35 µl of standard Laemmli buffer containing SDS and 2-mercaptoethanol. Laemmli buffer was preheated to 100°C prior to addition to the cells and cell lysates were immediately boiled at 100°C for 5 min. Lysates were then frozen at –80°C and stored for a minimum of 12 h. Prior to gel separation, cell lysates were re-boiled for 5 min. Equivalent amounts of cell lysate were resolved by SDS–PAGE on 10% gel or 10% pre-cast gels (Invitrogen, Carlsbad, CA), and electroblotted onto nitrocellulose membranes (Micron Separations, Westborough, MA). Even loading of lanes was approximated by use of similar numbers of cells per lysate and was controlled by Ponceau S staining of fresh blots. Western blot was performed with either anti-mouse KLF2 or anti-Cbl rabbit antiserum [Santa Cruz Biotechnology, Santa Cruz, CA; Cbl (C-15)], followed by donkey anti-rabbit Ig–horseradish peroxidase (Jackson ImmunoResearch, West Grove, PA) and visualized by SuperSignal Cemilumnesent substrate (Pierce, Rockford, IL). Rabbit anti-mouse KLF2 antisera was a kind gift of Dr Jeff Leiden and has been previously described (6,9,11). Following development with the SuperSignal, blots were exposed using CL-CPosure X-ray film (Pierce) for 3–20 s. Developed films were scanned at 1200 d.p.i. and bands were quantified using ImageQuant software.

Real-time PCR primer and probe sequence
Cells (3 x 106 per sample) were lysed for RNA isolation using a Qiagen (Valencia, CA) QIAshredder homogenizer and RNA was purified with Qiagen RNeasy prep kit according to the manufacture’s protocol. cDNA was generated by use of Invitrogen SuperScript first-strand synthesis for RT-PCR.

Real-time PCR analysis was performed using Cepheid (Sunnyvale, CA) Smart Cycler using the manufacturer’s guidelines. All KLF2 PCR products were amplified with a two-step cycle. cDNA loading was controlled by the use of parallel generation of an HPRT PCR product from the same samples. HPRT was characterized as a control mRNA through numerous culture experiments. Activation lead to consistent slight increases in HPRT expression as determined by quantitative real-time PCR analysis. Control for quantitation of KLF2 in activated samples was adjusted for this increase.

Real-time primers and probes were generated using primer3 software (www.genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi). Primers were as follows: KLF2 forward primer 5'-AGCCTATCTTGCCGTCCTT-3' residues 14–31 (numbering refers to cDNA coding sequence), KLF2 reverse primer 5'-CCAACACGTTGTTTAGGTCCTC-3' residues 112–133. KLF2 probe 5'-5TET-/CGCTGGCCGCGAAATGAAC/-3BHQ-1–3' from Integrated DNA Technologies (Minneapolis MN). HPRT forward primer 5'-GGTGAAAAGGACCTCTCGAA-3' residues 492–511, HPRT reverse primer 5'-AGTCAAGGGCATATCCAACA-3' residues 564–583 from Integrated DNA Technologies. HPRT probe 5'-5FAM-/TGTTGGATTTGAAATTCCAGACAAGTTTGT/-TAMRA-3' residues 534–563 from Applied Biosystems (Foster City CA).


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
KLF2 protein and mRNA levels are maintained in viable naive T cells deprived of IL-7
We isolated phenotypically naive (CD44lo) CD8+ OT-I T cells from lymph node and spleen of OT-I transgenic mice, which respond to OVAp in the context of the MHC class I molecule Kb. As expected, based on previous observations (6,9,11), naive OT-I T cells express high levels of KLF2 protein (Fig. 1a) and mRNA (data not shown). These cells were then placed in culture in the presence or absence of recombinant IL-7. Naive T cells cultured for 24 h in the absence of IL-7 appeared to undergo a drastic decrease in KLF2 expression compared to cells cultured with IL-7 (Fig. 1a). We also probed for Cbl, in order to control for protein loading. The apparent even protein loading seen with Cbl further substantiated that KLF2 maintenance required cellular exposure to IL-7.



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 1. Changes in KLF2 protein expression and cell viability in naive T cells cultured with or without IL-7. Naive CD8+ OT-I T cells were isolated and analyzed directly (‘t = 0’) or after 24 h of in vitro culture in the presence or absence of IL-7, as indicated. (a) Groups of 2 x 106 live cells (as determined by Trypan blue exclusion) per condition were lysed, run on SDS–PAGE, and analyzed for KLF2 and Cbl protein expression by western blot. Densitometric quantitation of western blot is based on positive control designated as ‘1’. (b) The same cell populations were analyzed for binding to FITC-conjugated Annexin-V as measured by flow cytometry. Results are representative of four similar experiments.

 
Cell death in the absence of IL-7 was apparent and an initial concern for interpreting our results. Indeed, using Trypan blue (vital dye) exclusion as a measure of cell death, demonstrated that ~30–50% of naive OT-I T cells die within 24 h if cultured in the absence of IL-7 (data not shown). An adjustment was made for the percentage of Trypan blue excluding cells in the preparation of lysates (see Methods). However, this approach does not actually remove dead cells and we were concerned that the samples may include cells in early stages of apoptosis. Rathmell et al. demonstrated that analysis of bcl-2 expression was complicated by inclusion of apoptotic cells in the cell lysates (26). Our subsequent analysis using binding of Annexin-V suggested that a much higher percent of cells were entering apoptosis then determined by Trypan blue exclusion, with >70% of OT-I cells cultured without IL-7 having initiated programmed cell death (Fig. 1b). The addition of IL-7 rescued the majority of these cells (Fig. 1b). As an approach to compensate for this problem, we purified viable cells by their buoyant density on Ficoll. This protocol efficiently eliminates the majority of Annexin-V-staining cells from OT-I T cells cultured without IL-7 (Fig. 2a) Analysis of the KLF2 protein expression showed that, when only viable OT-I cells were analyzed, KLF2 expression was maintained in naive OT-I cells regardless of the presence or absence of IL-7 (Fig. 2b). Since Cbl expression was evidently not affected by early apoptosis (Fig. 1), we dispensed with this control in favor of using Ficoll purified cells.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 2. KLF2 protein expression in viable Ficoll-purified OT-I T cells cultured with or without IL-7. Naive CD8+ OT-I T cells were isolated and analyzed directly or after 24 h of in vitro culture in the presence or absence of IL-7. Post-culture, each population was purified for viable cells by buoyant density in Ficoll. (a) Annexin-V staining of OT-I T cells directly ex vivo and after 24 h culture without IL-7. (b) Western blot of KLF2 protein expression in Ficoll-purified OT-I CD8+ T cells either directly ex vivo or cultured for 24 h ± IL-7. Negative control blot (–ctrl) shows loss of KLF2 in activated OT-I CD8+ T cells stimulated with OVAp/Kb for 48 h s (see Methods). Positive control blot (+ctrl) is independently isolated CD8+ T cells. Densitometric quantitation was as in Fig. 1. Each population of cells was Ficoll purified for viability prior to cell lysate preparation. (c) Western blot of KLF2 protein expression in Ficoll-purified OT-1 T cells that had been cultured in the presence or absence of IL-7 over a 12-h time course, where samples were taken at 0, 2, 6 and 12 h. Results are representative of four separate experiments.

 
It was possible that the effects of IL-7 stimulation on maintenance of KLF2 expression would be manifested at earlier time points, prior to apoptosis becoming severe in the population cultured without cytokine. This appeared unlikely, since analysis of in vitro culture at 2, 6 and 12 h showed that the presence or absence of IL-7 had little effect on KLF2 protein expression (Fig. 2c). To see if KLF2 levels were regulated at the level of transcription, we also analyzed the expression of KLF2 mRNA by real-time RT-PCR. Like KLF2 protein expression, KLF2 mRNA levels were maintained in viable naive T cells regardless of exposure to IL-7 (Fig. 3). As expected based on previous findings (6), KLF2 mRNA levels were drastically reduced in T cells stimulated with antigen (Fig. 3).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3. Comparison of mRNA expression in naive OT-1 T cells cultured in the presence or absence of IL-7 and OT-1 T cells activated by 5AKb fibroblasts. The 24-h in vitro culture time course of naive CD8+ OT-I T cells cultured in the presence or absence of IL-7 or activated with OVAp pulsed onto 5AKb fibroblasts. RNA was isolated at indicated time points from cell cultures and cDNA was synthesized by reverse transcription. KLF-2 mRNA levels were quantified using real-time PCR. KLF-2 mRNA levels were normalized using HPRT as a control. Results are representative of three separate experiments that coincide with protein analysis experiments.

 
Maintenance of cell viability through transgenic expression of bcl-2 allows dissociation of IL-7 effects on cell viability versus KLF2 expression
While the results from the Ficoll-purified cell culture experiments were compelling, we were concerned that the small subset of OT-I cells which had survived following IL-7 withdrawal might not be representative of the bulk population. If IL-7 deprivation did lead to KLF2 loss, but this event was rapidly followed by apoptosis, it could be difficult to detect viable naive T cells lacking KLF2. To test this possibility, we cultured naive CD8+ T cells from bcl-2 transgenic OT-I mice in the presence or absence of IL-7. Transgenic expression of bcl-2 has previously been reported to maintain in vitro viability of naive T cells cultured in the absence of survival cytokines (21,22). Indeed, analysis of Annexin-V binding indicated that the bcl-2 transgenic naive T cells maintained a small percentage of apoptotic cells regardless of IL-7 exposure in vitro (Fig. 4a). Thus using bcl-2 transgenic OT-I T cells allowed us to dissociate the requirement for IL-7 in maintaining viability and so to test whether the cytokine had an independent effect on KLF2 expression. Western blot analysis for KLF2 expression in bcl-2 transgenic cells reinforced the conclusion that cells cultured with or without IL-7 maintained similar levels of KLF2 protein expression over a 48-h time period (Fig. 4b). Analysis of mRNA levels by real-time PCR also showed that KLF2 transcription was not affected by IL-7 exposure in bcl-2 transgenic cells (data not shown). This effect did not appear to result from aberrant protein expression due to the bcl-2 transgene, since there was a good correlation between KLF2 and Cbl expression levels, regardless of the presence or absence of IL-7 (Fig. 4c). Analysis of bcl-2 transgenic T cells therefore supported the finding that IL-7 signaling is not required for the maintenance of KLF2. While it is possible that the overexpression of bcl-2 bypasses the normal regulation of KLF2, our preliminary analysis suggests that bcl-2 transgenic OT-I cells down-regulate KLF2 expression following activation similar to normal OT-I cells (data not shown), suggesting that at least this aspect of KLF2 regulation is not altered due to transgenic bcl-2 expression.



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 4. Comparison of survival and KLF2 protein expression in CD8+ bcl-2 transgenic T cells cultured in the presence or absence of IL-7. (a) Annexin-V staining of bcl-2 transgenic OT-I CD8+ T cells ± IL-7. Boxed numbers show percentage of cells Annexin-V+ for each time point. (b) Western blot of KLF2 in bcl-2 transgenic OT-I CD8+ T cells cultured for the indicated times ± IL-7. Densitometric quantitation of the western blot is based on the 24-h, no cytokine sample. Results are representative of five separate experiments. (c) Western blot of KLF-2 in bcl-2 transgenic OT-I CD8+ T cells cultured for 24 h ± IL-7. Samples were loaded at the cell equivalents noted. The blot was also probed for Cbl as a loading control.

 
IL-7 is capable of re-inducing KLF2 in activated T cells, but is opposed by IL-12
The finding that IL-7 stimulation was not necessary for KLF2 maintenance in naive T cells is in stark contrast to the capacity of this cytokine to drive KLF2 expression in activated T cells, as reported previously (9). In those experiments, both IL-2 and IL-7 were capable of inducing KLF2 in activated OT-I cells, while IL-12 was unable to support KLF2 re-expression. It is possible that interpretation of these experiments was complicated by cell death, as was evident in our analysis of naive T cells (cf. Figures 1 and 2).

Therefore, we activated OT-I T cells in vitro, cultured these cells in various cytokines, and then analyzed KLF2 protein and mRNA expression among the viable (Ficoll purified) cells. Samples for western blot analysis and real-time PCR analysis were taken over a 48-h period of initial activation. At the 48-h time point, either IL-7 alone or IL-7 with IL-12 was added to the culture media. Samples were again taken at intervals over the next 24 h. Consistent with previously reported data, activated T cells rapidly lost KLF2 mRNA and protein expression (Fig. 5a and b). The level of KLF2 at the 48-h time point was variable from experiment to experiment, but was consistently low compared to naive T cells, both by western blot analysis and by real-time PCR. With the addition of IL-7 at the 48-h time point, KLF2 mRNA was consistently and rapidly up regulated to levels comparable to naive T cells (Fig. 5a). This was also reflected in the return of KLF2 protein levels to the naive T cell level (Fig. 5b). However, the inclusion of IL-12 was able to efficiently suppress the re-induction of KLF2 mRNA and protein expression mediated by IL-7 (Fig. 5a and b).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5. Analysis of the effect of IL-12 stimulation on KLF2 re-induction following activation of CD8+ OT-I T cells. Naive CD8+ OT-I T cells were isolated and activated by in vitro culture with 5AKb fibroblasts pulsed with OVAp. Cell lysates were prepared for KLF2 protein analysis from the cultured cells at the time points indicated. Concurrently, RNA samples were prepared for reverse transcription and analysis by of mRNA levels by real-time PCR. After 48 h of activation the RP10 media was replaced with media containing IL-7 or IL-7 and IL-12. Samples were then taken at 4, 8, 12 and 24 h after the change in media (at 52, 56, 64 and 72 h respectively). At all time points of culture, viable cells were purified on Ficoll before analysis. (a) KLF2 mRNA was analyzed from the indicated culture time points and is reported as a relative comparison to KLF2 mRNA levels found in freshly isolated OT-1 T cells. Levels of KLF2 mRNA for each time point were normalized against HPRT mRNA. (b) Samples of 2 x 106 cells from the activated cultured cells were lysed, run on SDS–PAGE and analyzed for KLF2 by western blotting. Results are representative of three separate experiments.

 
These data confirm the ability of IL-7 to induce re-expression of KLF2 after T cell activation and that IL-12 inhibits this induction. These findings demonstrate that the impact of IL-7 on KLF2 expression is different for activated versus naive T cells.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The expression of KLF2 in naive T cells is critical for their survival. Data from Kuo et al. demonstrated that, while thymic development of KLF2-deficient T cells is essentially normal, numbers of peripheral T cells are severely compromised (6). Similar findings occur with TCR transgenic KLF2-deficient cells (our unpublished observations), indicating that the phenotype is not due to selection of cells with aberrant TCRs. On the other hand, forced expression of KLF2 in the Jurkat T cells induces their withdrawal from cell cycle and movement toward a state of quiescence (11), which may in some ways mimic differentiation toward a resting memory population. A key issue then is understanding the basis for appropriate expression of KLF2 in naive, activated and memory T cells.

Considerable data suggest that, at least for CD8 T cells, naive T cell survival requires signals through certain {gamma}c-utilizing cytokines and the TCR (interacting with self-peptide–MHC ligands), while similar cytokines (but not TCR signals) are required for survival of memory T cells (28). For naive T cells, IL-7 appears to be the critical physiological cytokine and we have shown that IL-7 is capable of inducing KLF2 re-expression in activated T cells (9). Based on these and other findings, we and others proposed that KLF2 expression may be regulated in naive, activated and memory T cells by exposure to cytokines which signal through {gamma}c receptors (9,13).

Our current studies suggest this hypothesis is only partially correct. While we extend the evidence that IL-7 is able to induce re-expression of KLF2 in activated T cells, our data suggest IL-7 signaling is dispensable for maintenance of KLF2 mRNA and protein expression in naive T cells. Hence, these findings indicate KLF2 is regulated by distinct mechanisms in naive versus recently activated T cells. Although we focused on OT-I T cells in this report, additional experiments gave similar results using polyclonal B6 T cells (data not shown), arguing that our findings are not biased by using TCR transgenic animals.

Interpretation of our initial experiments on the role of IL-7 in KLF2 expression by naive T cells was complicated by cytokine-withdrawal-induced apoptotic cell death. Interest ingly, a similar complication was reported by Rathmell et al. in their analysis of the role played by IL-7 in bcl-2 maintenance (26). These authors showed that inclusion of apoptotic cells in the sample led to apparent loss of bcl-2 in the total population. They proposed that this was mediated by degradation of bcl-2 protein by caspases released with the preparation of the cell lysate, although whether similar degradation processes account for the apparent loss of KLF2 (but not the Cbl control) in our experiments is unclear. These findings highlight an intrinsic complication in studies on regulation of survival factor expression, i.e. that loss of expression can lead to rapid cell death. Furthermore, it was possible that the few surviving naive T cells which persisted after IL-7 withdrawal were simply those which had recently received an IL-7 signal in vivo and hence were not truly reflective of the impact of IL-7 deprivation. By using bcl-2 transgenic T cells we sought to overcome these limitations, by overcoming the death signal which would normally accompany IL-7 withdrawal. The data using bcl-2 transgenic cells support the hypothesis that IL-7 signaling is not essential for KLF2 expression.

It is possible that transgenic overexpression of bcl-2 itself may force aberrant KLF2 expression. Indeed, published reports have shown that bcl-2 transgenic expression can inhibit NF-AT activity (29), which potentially might affect KLF2 regulation. However, the similarity between the patterns of KLF2 expression in normal and bcl-2 transgenic cells following IL-7 withdrawal makes this possibility more remote. Furthermore, preliminary data suggest that transgenic bcl-2 expression does not prevent KLF2 loss following T cell activation (data not shown), arguing that at least this aspect of KLF2 regulation is preserved in bcl-2 transgenic cells. Together these data argue that bcl-2 is unlikely to be playing an active role in KLF2 gene regulation.

Our findings re-open the question of whether KLF2 expression is induced by exogenous survival signals other than IL-7 or whether KLF2 is constitutively expressed. A model congruent with our data would be one in which KLF2 becomes a constitutively expressed factor critical for naive T cell maintenance after maturation through the single-positive stage in the thymus. The requirement for KLF2 is demonstrated by the deficit in peripheral T cells reported for KLF2 knockout lymphocytes (6). However, expression of this constitutively active molecule is necessarily interrupted during T cell activation by cognate antigen, thus allowing for induction of cell cycle necessary for clonal expansion and proper activation. Results from Buckley et al. support the hypothesis that KLF2 degradation is necessary for activation by demonstrating a halt in cell cycle progression, and a decrease in cell size and metabolism when Jurkat T cells were induced to overexpress KLF2 (11). Finally, we would propose that IL-7 (or similar {gamma}c receptor-utilizing cytokines) would be required for KLF2 re-expression after activation, possibly permitting differentiation of the resting memory pool.

Alternatively, TCR engagement with self-peptide–MHC ligands might sustain basal expression of KLF2 in naive T cells. This possibility must be considered since the engagement with the TCR is thought to be important for naive T cell homeostasis. At first glance this model appears to conflict with extensive data showing that stimulation through the TCR leads to loss of KLF2 (6,9); it is feasible, however, that the TCR signals imparted by low affinity self-peptide–MHC ligands promote KLF2 expression. Testing a potential role for basal TCR signaling in maintaining KLF2 expression is currently under investigation.

While the studies presented here suggest that IL-7 is not required for maintenance of KLF2 expression in naive T cells, it is possible that IL-7 signals are required for initial induction of KLF2 expression in newly developed mature thymocytes. Similarly, it is possible that cytokines (IL-2 and IL-7) which induce KLF2 after T cell activation might only be required for initial KLF2 expression, and these cytokines would then not be required for sustained expression of KLF2 in late activated and memory T cells. As for naive T cells, investigation of this interesting hypothesis is complicated by the fact that these and related cytokines (such as IL-15) play an important role in regulating survival of activated and memory T cells.

Of additional interest are the ramifications of our study for KLF2 function. Leiden et al. proposed that KLF2 is chiefly a quiescence factor, enforcing a resting, non-cycling state (6,11). This hypothesis is further strengthened by the data that IL-12, which can promote functional reactivity of activated CD8 T cells (30,31), also suppresses re-expression of KLF2 [(9) and this report]. On the other hand, KLF2 is expressed in actively dividing T cells and in the effector pool, as demonstrated by studies on activated CD8 T cells in vitro and in vivo (9,10). In addition, KLF2 is abundantly expressed in embryonic stem cells, under conditions where the cells are undergoing extensive proliferation (32). Hence, a model in which KLF2 inhibits cell division and effector differentiation may be an oversimplification. At the same time, KLF2 appears not to function as a dominant survival factor: we found that KLF2 expression was maintained in the absence of IL-7, yet the cells rapidly die. While IL-7-driven KLF2 expression in activated T cells correlates with their rescue from cell death and generation of the memory pool, it is still unclear whether KLF2 plays a critical role in these survival and differentiative steps. These data question whether KLF2 acts purely as either a survival or quiescence factor and its function may instead be a composite of these two roles.


    Acknowledgements
 
We would like to thank Jeff Leiden for supplying the polyclonal anti-KLF2 antibody used for western blotting, and Matt Mescher for providing IL-12 and for advice with T cell purification and activation conditions. We also wish to thank other members of the Hogquist and Jameson laboratories for their support and input into this project. This work was supported in part by awards from the NIH (R01 AI38903) and ACS (RPG-99-264-01) to S. C. J. and through an NIH Immunology Training Grant (T32 AI07313) to B. T. E.


    Abbreviations
 
{gamma}c—common {gamma} chain

KLF—Kruppel-like factor

LKLF—lung Kruppel-like factor

OVAp—ovalbumin peptide (SIINFEKL)


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Black, A. R., Black, J. D. and Azizkhan-Clifford, J. 2001. Sp1 and kruppel-like factor family of transcription factors in cell growth regulation and cancer. J. Cell. Physiol. 188:143.[CrossRef][Web of Science][Medline]
  2. Anderson, K. P., Kern, C. B., Crable, S. C. and Lingrel, J. B. 1995. Isolation of a gene encoding a functional zinc finger protein homologous to erythroid Kruppel-like factor: identification of a new multigene family. Mol. Cell Biol. 15:5957.[Abstract/Free Full Text]
  3. Kuo, C. T., Veselits, M. L., Barton, K. P., Lu, M. M., Clendenin, C. and Leiden, J. M. 1997. The LKLF transcription factor is required for normal tunica media formation and blood vessel stabilization during murine embryogenesis. Genes Dev. 11:2996.[Abstract/Free Full Text]
  4. Glynne, R., Ghandour, G., Rayner, J., Mack, D. H. and Goodnow, C. C. 2000. B-lymphocyte quiescence, tolerance and activation as viewed by global gene expression profiling on microarrays. Immunol. Rev. 176:216.[CrossRef][Web of Science][Medline]
  5. Kuo, C. T. and Leiden, J. M. 1999. Transcriptional regulation of T lymphocyte development and function. Annu. Rev. Immunol. 17:149.[CrossRef][Web of Science][Medline]
  6. Kuo, C. T., Veselits, M. L. and Leiden, J. M. 1997. LKLF: a transcriptional regulator of single-positive T cell quiescence and survival. Science 277:1986.[Abstract/Free Full Text]
  7. Wani, M. A., Means, R. T., Jr and Lingrel, J. B. 1998. Loss of LKLF function results in embryonic lethality in mice. Transgenic Res. 7:229.[CrossRef][Web of Science][Medline]
  8. Wani, M. A., Wert, S. E. and Lingrel, J. B. 1999. Lung Kruppel-like factor, a zinc finger transcription factor, is essential for normal lung development. J. Biol. Chem. 274:21180.[Abstract/Free Full Text]
  9. Schober, S. L., Kuo, C. T., Schluns, K. S., Lefrancois, L., Leiden, J. M. and Jameson, S. C. 1999. Expression of the transcription factor lung Kruppel-like factor is regulated by cytokines and correlates with survival of memory T cells in vitro and in vivo. J. Immunol. 163:3662.[Abstract/Free Full Text]
  10. Grayson, J. M., Murali-Krishna, K., Altman, J. D. and Ahmed, R. 2001. Gene expression in antigen-specific CD8+ T cells during viral infection. J. Immunol. 166:795.[Abstract/Free Full Text]
  11. Buckley, A. F., Kuo, C. T. and Leiden, J. M. 2001. Transcription factor LKLF is sufficient to program T cell quiescence via a c-Myc-dependent pathway. Nat. Immunol. 2:698.[CrossRef][Web of Science][Medline]
  12. Vella, A. T., Dow, S., Potter, T. A., Kappler, J. and Marrack, P. 1998. Cytokine-induced survival of activated T cells in vitro and in vivo. Proc. Natl Acad. Sci. USA 95:3810.[Abstract/Free Full Text]
  13. Di Santo, J. P. 2001. Lung Krupple-like factor: a quintessential player in T cell quiescence. Nat. Immunol. 2:667.[CrossRef][Web of Science][Medline]
  14. Boise, L. H., Minn, A. J., June, C. H., Lindsten, T. and Thompson, C. B. 1995. Growth factors can enhance lymphocyte survival without committing the cell to undergo cell division. Proc. Natl Acad. Sci. USA 92:5491.[Abstract/Free Full Text]
  15. Vella, A., Teague, T. K., Ihle, J., Kappler, J. and Marrack, P. 1997. Interleukin 4 (IL-4) or IL-7 prevents the death of resting T cells: stat6 is probably not required for the effect of IL. J. Exp. Med. 186:325.[Abstract/Free Full Text]
  16. Tan, J. T., Dudl, E., LeRoy, E., Murray, R., Sprent, J., Weinberg, K. I. and Surh, C. D. 2001. IL-7 is critical for homeostatic proliferation and survival of naive T cells. Proc. Natl Acad. Sci. USA 98:8732.[Abstract/Free Full Text]
  17. Schluns, K. S., Kieper, W. C., Jameson, S. C. and Lefrancois, L. 2000. Interleukin-7 mediates the homeostasis of naive and memory CD8 T cells in vivo. Nat. Immunol. 1:426.[CrossRef][Web of Science][Medline]
  18. Vivien, L., Benoist, C. and Mathis, D. 2001. T lymphocytes need IL-7 but not IL-4 or IL-6 to survive in vivo. Int. Immunol. 13:763.[Abstract/Free Full Text]
  19. Hofmeister, R., Khaled, A. R., Benbernou, N., Rajnavolgyi, E., Muegge, K. and Durum, S. K. 1999. Interleukin-7: physiological roles and mechanisms of action. Cytokine Growth Factor Rev. 10:41.[CrossRef][Web of Science][Medline]
  20. Plas, D. R., Rathmell, J. C. and Thompson, C. B. 2002. Homeostatic control of lymphocyte survival: potential origins and implications. Nat. Immunol. 3:515.[CrossRef][Web of Science][Medline]
  21. Maraskovsky, E., O‘Reilly, L. A., Teepe, M., Corcoran, L. M., Peschon, J. J. and Strasser, A. 1997. Bcl-2 can rescue T lymphocyte development in interleukin-7 receptor-deficient mice but not in mutant rag-1-/- mice. Cell 89:1011.[CrossRef][Web of Science][Medline]
  22. Akashi, K., Kondo, M., von Freeden-Jeffry, U., Murray, R. and Weissman, I. L. 1997. Bcl-2 rescues T lymphopoiesis in interleukin-7 receptor-deficient mice. Cell 89:1033.[CrossRef][Web of Science][Medline]
  23. Nakayama, K., Dustin, L. B. and Loh, D. Y. 1995. T–B cell interaction inhibits spontaneous apoptosis of mature lymphocytes in Bcl-2-deficient mice. J. Exp. Med. 182:1101.[Abstract/Free Full Text]
  24. Kondo, M., Akashi, K., Domen, J., Sugamura, K. and Weissman, I. L. 1997. Bcl-2 rescues T lymphopoiesis, but not B or NK cell development, in common gamma chain-deficient mice. Immunity 7:155.[CrossRef][Web of Science][Medline]
  25. Jacobs, H., Krimpenfort, P., Haks, M., Allen, J., Blom, B., Demolliere, C., Kruisbeek, A., Spits, H. and Berns, A. 1999. PIM1 reconstitutes thymus cellularity in interleukin 7- and common gamma chain-mutant mice and permits thymocyte maturation in Rag- but not CD3gamma-deficient mice. J. Exp. Med. 190:1059.[Abstract/Free Full Text]
  26. Rathmell, J. C., Farkash, E. A., Gao, W. and Thompson, C. B. 2001. IL-7 enhances the survival and maintains the size of naive T cells. J. Immunol. 167:6869.[Abstract/Free Full Text]
  27. Hogquist, K. A., Jameson, S. C., Heath, W. R., Howard, J. L., Bevan, M. J. and Carbone, F. R. 1994. T cell receptor antagonist peptides induce positive selection. Cell. 76:17.[CrossRef][Web of Science][Medline]
  28. Jameson, S. C. 2002. Maintaining the norm: T-cell homeostasis. Nat. Rev. Immunol. 2:547.[Web of Science][Medline]
  29. Linette, G. P., Li, Y., Roth, K. and Korsmeyer, S. J. 1996. Cross talk between cell death and cell cycle progression: BCL-2 regulates NFAT-mediated activation. Proc. Natl Acad. Sci. USA 93:9545.[Abstract/Free Full Text]
  30. Curtsinger, J. M., Schmidt, C. S., Mondino, A., Lins, D. C., Kedl, R. M., Jenkins, M. K. and Mescher, M. F. 1999. Inflammatory cytokines provide a third signal for activation of naive CD4+ and CD8+ T cells. J. Immunol. 162:3256.[Abstract/Free Full Text]
  31. Valenzuela, J., Schmidt, C. and Mescher, M. 2002. The roles of IL-12 in providing a third signal for clonal expansion of naive CD8 T cells. J. Immunol. 169:6842.[Abstract/Free Full Text]
  32. Anisimov, S. V., Tarasov, K. V., Tweedie, D., Stern, M. D., Wobus, A. M. and Boheler, K. R. 2002. SAGE identification of gene transcripts with profiles unique to pluripotent mouse R1 embryonic stem cells. Genomics 79:169.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
M. Gohda, J. Kunisawa, F. Miura, Y. Kagiyama, Y. Kurashima, M. Higuchi, I. Ishikawa, I. Ogahara, and H. Kiyono
Sphingosine 1-Phosphate Regulates the Egress of IgA Plasmablasts from Peyer's Patches for Intestinal IgA Responses
J. Immunol., April 15, 2008; 180(8): 5335 - 5343.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Q. Li, C. Eppolito, K. Odunsi, and P. A. Shrikant
IL-12-Programmed Long-Term CD8+ T Cell Responses Require STAT4
J. Immunol., December 1, 2006; 177(11): 7618 - 7625.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. J. Sohn, D. Li, L. K. Lee, and A. Winoto
Transcriptional Regulation of Tissue-Specific Genes by the ERK5 Mitogen-Activated Protein Kinase
Mol. Cell. Biol., October 1, 2005; 25(19): 8553 - 8566.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Feng and Y. W. Kan
The binding of the ubiquitous transcription factor Sp1 at the locus control region represses the expression of {beta}-like globin genes
PNAS, July 12, 2005; 102(28): 9896 - 9900.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. J. Fry and C. L. Mackall
The Many Faces of IL-7: From Lymphopoiesis to Peripheral T Cell Maintenance
J. Immunol., June 1, 2005; 174(11): 6571 - 6576.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Right arrowScopus Links
Google Scholar
Right arrow Articles by Endrizzi, B. T.
Right arrow Articles by Jameson, S. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Endrizzi, B. T.
Right arrow Articles by Jameson, S. C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?