Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cho, J. Y.
Right arrow Articles by Murphy, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cho, J. Y.
Right arrow Articles by Murphy, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 15, No. 10, pp. 1149-1160, October 2003
© 2003 Japanese Society for Immunology

Identification of cooperative monomeric Brachyury sites conferring T-bet responsiveness to the proximal IFN-{gamma} promoter

Jae Youl Cho1,2, Vadim Grigura1, Theresa L. Murphy1 and Kenneth Murphy1

1 Department of Pathology and Immunology, Howard Hughes Medical Institute, Washington University School of Medicine, St Louis, MO 63110, USA 2 Present address: School of Biotechnology and Bioengineering, Kangwon National University, 92-1, Hyoja2-Dong, Chuncheon, Kangwon-Do 200-701, Korea

Correspondence to: K. M. Murphy, Department of Pathology and Immunology, Washington University School of Medicine, Box 8118, 660 S. Euclid Avenue, St Louis, MO 63110, USA. E-mail: murphy@immunology.wustl.edu
Transmitting editor: J. P. Allison


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The T-box transcription factor T-bet has been reported to augment the activity of IFN-{gamma} reporter constructs and to be required for CD4+, but not CD8+, T cell production for IFN-{gamma}. Despite these observations, the precise sequence targets of T-bet within the IFN-{gamma} locus have not been identified and the nature of T-bet’s role in selectively augmenting IFN-{gamma} production in CD4+ T cells has not been elucidated. As an initial step in this process, we examined the basis of T-bet-dependent augmentation of IFN-{gamma} reporter constructs to identify specific targets of this factor within the IFN-{gamma} locus. Deletion of previously proposed TDB and TRU elements left T-bet-induced IFN-{gamma} reporter activity unchanged, suggesting the existence of additional T-bet-responsive elements. We identified several additional monomeric Brachyury consensus elements within the proximal IFN-{gamma} promoter that operate cooperatively to increase both constitutive and stimulated promoter activity. The most proximal of these Brachyury elements is most significant quantitatively in mediating T-bet-dependent promoter augmentation. Mutation of this with any of the other Brachyury elements leads to a near eradication of T-bet-dependent promoter activation. The identification of these individual monomeric Brachyury-binding sites within the IFN-{gamma} locus should facilitate the in vivo analysis of the function of T-bet in the lineage- and background-dependent requirement for T-bet in IFN-{gamma} gene regulation.

Keywords: IFN-{gamma}, T-bet, transcription factor


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
IFN-{gamma} is a cytokine that is critical in promoting protective immune responses to a variety of pathogens (1). Expression of the IFN-{gamma} gene is tightly regulated both in which cell lineages express this cytokine and which signals induce it. Cells capable of abundant IFN-{gamma} production include NK cells, and both CD4+ and CD8+ T cells (2,3), although additional cell types, including dendritic cells, may also express some IFN-{gamma} (4). Inducibility of the IFN-{gamma} gene is controlled by at least two distinct signaling pathways (2,5,6). One involves signaling downstream of the antigen receptors expressed by T cells and is inhibited by cyclosporin A (CsA) (5), consistent with evidence that NF-AT family transcription factors are involved (710). A second pathway capable of inducing IFN-{gamma} involves cytokine signaling pathways, particularly the combined signaling of the cytokines IL-12 and IL-18 (5,11).

Recently, the T box family transcription factor T-bet was demonstrated to increase IFN-{gamma} transcription, both in the context of a reporter assay and when expressed retrovirally in non-transformed CD4+ T cells (12). The reporter used in that study contained several kilobases of upstream promoter, and a pair of dimeric Brachyury cis elements (TDB) located at approximately –2300 to –2291 and –1957 to –1948 upstream of the IFN-{gamma} promoter were suggested to potentially mediate T-bet-dependent reporter activation. However, these elements were not tested functionally at that time. A subsequent study confirmed T-bet responsiveness of the IFN-{gamma} reporter, but suggested an alternative region, termed the T-bet responsive unit (TRU), may mediate T-bet-dependent activation (13).

While T-bet can augment IFN-{gamma} reporter activity, T-bet is apparently not required for IFN-{gamma} expression in all cell types (14). When analyzing T-bet-deficient mice, diminished IFN-{gamma} production was observed in CD4+ T cells, but CD8+ T cells produced IFN-{gamma} normally. This group subsequently reported that T-bet-deficient CD4+ T cells on the Lpr-deficient background did produce IFN-{gamma}, indicating some complexity in the requirement for T-bet in CD4+ T cells (15). Recently, a role for T-bet in modifying the chromatin surrounding the IFN-{gamma} gene has been demonstrated (16,17), suggest a role in regulating IFN-{gamma} gene accessibility rather than initiating transcription directly.

In summary, the reported effects of T-bet on IFN-{gamma} expression are complex, differing between distinct cell types and genetic backgrounds, and potentially consistent with alternate models of accessibility versus transcriptional induction. Distinguishing various roles of T-bet involvement in IFN-{gamma} regulation would be facilitated by defining cis-acting elements mediating its effects on the IFN-{gamma} locus. In this study, we initiate this effort, identifying several conserved cis-acting elements within the IFN-{gamma} gene that can mediate T-bet-dependent reporter activation. In contrast to the suggested dimeric Brachyury elements located 2 kb upstream of the IFN-{gamma} promoter (12) or the TRU element (13), we identified several monomeric Brachyury elements located in the more proximal IFN-{gamma} promoter region that cooperate to mediate T-bet-dependent reporter activation. Identification of these elements should facilitate the more difficult task of analyzing the complex role of T-bet in controlling IFN-{gamma} gene expression in distinct cell lineages, such as in CD4+ versus CD8+ T cells.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cell transfections and luciferase measurements
EL-4-OVA cells were a gift of O. Kanagawa (St Louis, MO) (18). Transient transfections of EL-4-OVA were essentially as described (18). Briefly, 24 x 106 cells were electroporated at 280 V and 960 µF with 20 µg of the indicated reporter plasmids, and either 20 µg of the pcDNA vector (Invitrogen, Carlsbad, CA) or T-bet expression plasmid and 0.25 µg/ml of pRL-CMV (Promega, Madison, WI) to monitor transfection efficiency as preciously described (19). Transfected cells were harvested 12 h later, left un-stimulated or stimulated with 50 ng/ml phorbol 12-myristate 13-acetate (PMA) and 1 µM ionomycin as indicated in the figure legends. Cells were lysed after 6 h in 100 µl as described (18), and assayed for both firefly and Renilla luciferase activities (19). In Fig. 1(B), stable EL-4-OVA transfected lines expressing GFP-RV (19) or T-bet-RV (20) were established by retroviral infection as described (21). For inhibitor studies in Fig. 7, the ERK inhibitor PD98059 (22) was used at 50 µM, the p38 MAPK inhibitor SB203580 was used at 25 µM (23), the c-Jun kinase inhibitor SP600125 was used at 50 µM (24), the protein kinase C (PKC) inhibitor GF109203X was used at 5 µM (25) and the calcineurin inhibitor CsA was used at 10 µg/ml.




View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. T-bet augments both constitutive and stimulated IFN-{gamma} promoter reporter activity. (A) EL-4-OVA cells (24 x 106 cells) were transiently transfected with 20 µg of the indicated cytokine promoter luciferase reporter plasmids and either empty pcDNA vector (closed bars) or T-bet-pcDNA expression vector (open bars). After 12 h, cells were stimulated with PMA (50 ng/ml) + ionomycin (1 µM) (left panel) or were left unstimulated (right panel) for 6 h, and luciferase activities determined as described in Methods. Cytomegalovirus promoter-driven Renilla luciferase activity was used for normalization as described (19). Results are presented as the fold induction over luciferase activity of each construct determined with pcDNA. (B) EL-4-OVA cells were stably infected with the control GFP-RV retrovirus (open bars) or with the T-bet expressing T-bet-RV virus (closed bars) and infected cells purified by cell sorting. Cells (24 x 106) were transiently transfected with 20 µg of either IFN-{gamma} A or IFN-{gamma} B luciferase reporter plasmid. After 12 h, cells were left unstimulated (–) or were stimulated (+) with PMA (50 ng/ml) + ionomycin (1 µM) for 6 h and luciferase activity was determined. Results are presented as the fold induction of luciferase activity for each construct compared to its activity in GFP-EL-4-OVA cells. Results were similar in three independent experiments.

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 7. T-bet-induced IFN-{gamma} promoter activity is resistant to multiple inhibitors. EL-4-OVA cells (24 x 106 cells) were transiently transfected with 20 µg of either the IFN-{gamma} B or the IL-2 luciferase reporter plasmid and with 20 µg of the T-bet-pcDNA expression plasmid. After 12 h, cells were pretreated for 30 min with various pharmacological inhibitors, the ERK inhibitor PD98059 (50 µM), the p38 MAPK inhibitor SB203580 (25 µM), the c-Jun kinase inhibitor SP600125 (50 µM), the PKC inhibitor GF109203X (5 µM) and the calcineurin inhibitor CsA (10 µg/ml), and then stimulated with 50 ng/ml PMA + 1 µM ionomycin for 6 h. The results are expressed as the percentage of the induced reporter activity in each condition for each reporter compared to vehicle control.

 
T-bet expression and generation of T-bet mutations
The T-bet cDNA was released from a T-bet-RV retroviral vector (20) by BglII–XhoI digestion and ligated in to BamHI–XhoI-digested pcDNA, generating the T-bet-pcDNA expression plasmid. Internal deletion mutants of T-bet (Fig. 2) were constructed using Quick Change Site Directed Mutagenesis (Stratagene, La Jolla, CA) with the following sense (S) and antisense (AS) oligonucleotides, and T-bet-pcDNA plasmid as template. All mutations were verified by sequencing. {Delta}152–212: TD-del-1-S, GTC CAA GTT CAA CAC CGT GGC CGG GCT GGA G; TD-del-1-AS, GCC CGG CCA CGG TGT TGA ACT TGG ACC ACA AC. {Delta}223–250: TD-del-2-S, GTC CAC CCA GAC TCC AAC AAT GTG ACC CAG ATG; TD-del-2-AS, TCA CAT TGT TGG AGT CTG GGT GGA CAT ATA AGC. {Delta}136–316: TD-del-3-S, GTG TCT GGG AAG CTG GAG TCC ATG TAC GCA TCT GT; TD-del-3-AS, CGT ACA TGG ACT CCA GCT TCC CAG ACA CCT CCA A. {Delta}39–74: N-del-S, CGT TTC TTC TAT CCC GAG CCG CTA CCC TGC CCC T; N-del-AS, GGT CAG GGG CAG GGT AGC GGC TCG GGA TAG AAG AA. {Delta}440–475: C-del-S, AAT ACC CGC CCA AGA TGA CAC CTC CCT CCA GCC GG; C-del-AS, GCT GGA GGG AGG TGT CAT CTT GGG CGG GTA TTG A.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. T-bet-induced IFN-{gamma} promoter activity requires the T box domain. EL-4-OVA cells (24 x 106 cells) were transiently transfected with 20 µg of the IFN-{gamma} A luciferase reporter (open bars), the IFN-{gamma} F luciferase reporter (hatched bars) or the IFN-{gamma} P luciferase reporter (closed bars) and with 20 µg of the indicated T-bet expression vector expressing wild-type or mutant T-bet proteins. After 12 h, cells were stimulated with PMA (50 ng/ml) + ionomycin (1 µM) for 6 h and luciferase activity determined as described in Methods. The results are expressed as the percentage increase in activity caused by each mutant compared to the increase caused by wild-type T-bet, averaged for three independent experiments, i.e. 0% indicates no increase in IFN-{gamma} reporter activity and 100% indicates the same increase as caused by wild-type T-bet in the same experiment.

 
Luciferase-based promoter constructs
The IL-2-Luc (18), IL-4-Luc (18) and IL-5-Luc (26) luciferase reporter plasmids have been described. A 3.5-kb murine IFN-{gamma} promoter region was provided by Dr H. Fox (The Scripps Institute, La Jolla, CA) and various lengths of the IFN-{gamma} promoter were placed in the pBS-Luc vector as described (21) (Table 1). Three additional IFN-{gamma} reporters, IFN-{gamma} J, IFN-{gamma} F and IFN-{gamma} L, of intermediate length were constructed. PCR was used with the following top strand 5'-SalI-tailed oligonucleotides and a BamHI-tailed bottom strand oligonucleotide described previously (21), using the 3.5 kb murine IFN-{gamma} promoter region as template to generate promoter regions that were digested by SalI–BamHI and cloned into SalI–BamHI digested pBS-Luc (18). J oligo: GGGGTCGACAAAAGTTTGA AAAGGCTTCC; F oligo: GGGGTCGACGGCTGTCTCATCG TCAGAGA; L oligo: GGGGTCGACATGCCACAAAACCATAG CTG.


View this table:
[in this window]
[in a new window]
 
Table 1. IFN-{gamma} promoter constructs used to generate promoter mutations
 
Internal deletions and clustered point mutations of IFN-{gamma} promoter constructs
Internal deletion of previously proposed T-bet binding sites (TDB) (12), a proposed TRU (13), and the distal GATA and AP-1 cis elements were generated using Quick Change Site Directed Mutagenesis (Stratagene) on IFN-{gamma} A and IFN-{gamma} B constructs with the following pairs of S and AS oligonucle otides. P-TDB-del-S, ATA AGA CAC GTT TAA AGG TAT GAG TTA CCA CGA; P-TDB-del-AS, P-TCA TAC CTT TAA ACG TGT CTT ATT GAT CTT AG; P-TRU-del-S, AAG GGC TTC CTC ACC ACA TTA GAG TTT CCT CAT GGT TT; P-TRU-del-AS, CTC AAA CCA TGA GGA AAC TCT AAT GTG GTG AGG AAG CC; P-2nd Ap1-del (distal-GATA/AP-1)-S, TAA CTT AGC TCC CCC CAC CTT AAA AAA AAA AAA AC, P-2nd Ap1-del (distal-GATA/AP-1)-AS, GGT TTT TTT TTT TTT AAG GTG GGG GGA GCT AAG TTA C.

All constructs were made by serial application of Quick Change Site Directed Mutagenesis (Stratagene) to IFN-{gamma} A or IFN-{gamma} B constructs. Supplementary Fig. S1(A and B) (Supplementary Data available at International Immunology online) shows the specific order of application of the above oligonucleotide pairs, all intermediates constructs and identifies the figures in which each construct is used.

Site-directed mutations of Bra sequences in IFN-{gamma} promoter constructs
Three-base-pair clustered point mutations of T-bet action sites were generated with the following S and AS oligonucleotide pairs. P-63M (1-pm)-S ({Delta}bra construct), AAA ACT CCC GAA AAT ACG TAA TCC CGA GGA; P-63M (1-pm)-AS ({Delta}bra construct), TTT TCG GGA GTT TTT TTT TGG TTT TTT TTT TTT T; P-101M (2-pm) S, TTA GCT CCC CCC ACC TAT CCC CCA CCA TCT TAA AA; P-101M (2-pm) AS, GGT TTT TTT TTT TTT AAG ATG GTG GGG GAT AGG TGG; P-137M (3-pm) S: AAC ATG CCA CAA AAC CAT AGC CCC AAT GCA AAG TAA; P-137M (3-pm) AS, GGG AGC TAA GTT ACT TTG CAT TGG GGC TAT GGT TTT TG; P-260 (4-pm) S, ACC CCA AAT GGC CCG AAG TAA AAG TGC TTT CAG AGA; p-260 (4-PM) AS, GCA CTT TTA CTT CGG GCC ATT TGG GGT GGG GGC T; P-96M (2nd AP1-pm) S, TCC CCC CAC CTA TCT GTC AAA GTC TTA AAA AAA A; P-96M (2nd AP1-pm) AS, TTT TTT TTG GTT TTT TTT TTT TTA AGA CTT TGA CAG AT; P-69M (pm-1) S, CAT CTT AAA AAA AAA AAA ACC AAA AAC CCA CTT GTG AAA; P-69M (pm-1) AS, GGG ATT ACG TAT TTT CAC AAG TGG GTT TTT GGT TTT; P-66M (pm-2) S, TCT TAA AAA AAA AAA AAC CAA AAA AAA GAA TGT GAA AAT; P-66M (pm-2) AS, CTC GGG ATT ACG TAT TTT CAC ATT CTT TTT TTT GGT; P-60M (pm-4) S, AAA AAA AAA CTT GTT CTA ATA CGT AAT CCC GAG GAG C; P-60M (pm-4) AS, GAT TAC GTA TTA GAA CAA GTT TTT TTT TGG TTT TTT TTT; P-57M (pm-5) S: AAA AAA AAC TTG TGA ATC CAC GTA ATC CCG AGG AGC CT; P-57M (pm-5) AS, CGG GAT TAC GTG GAT TCA CAA GTT TTT TTT TGG TTT TTT; P-54M (pm-6) S, AAA CCA AAA AAA AAC TTG TGA AAA ATG TTT AAT CCC GAG G; P-54M (pm-6) AS, GAA GGC TCC TCG GGA TTA AAC ATT TTC ACA AGT TTT. P-51M (pm-7) (1st AP1-pm) S, AAC TTG TGA AAA TAC GCC CTC CCG AGG AGC CTT; P-51M (pm-7) (1st AP1-pm) AS, AAG GCT CCT CGG GAG GGC GTA TTT TCA CAA GTT TT.

All constructs were made by serial application of Quick Change Site Directed Mutagenesis (Stratagene) to the IFN-{gamma} reporter constructs shown in Table 1. Specific details of the construction of each plasmid are shown in Supplementary Fig. S1(A–I) (Supplementary Data), which provides the specific order of application of each oligonucleotide pairs to the particular starting plasmid or intermediate, shows all intermediate constructs and identifies the figures in which each construct is used. All mutations were verified by mapping and sequencing.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
T-bet augments constitutive and induced activity of the IFN-{gamma} promoter
First, we compared the effects of T-bet expression on the activity of several cytokine promoter systems. For each, we examined the potential effect of T-bet on both the constitutive activity of several cytokine promoters, as well as induced activity using stimulation with PMA + ionomycin (Table 2). The IL-2 promoter shows very strong induction by PMA + ionomycin stimulation, with luciferase activity induced from a constitutive level of 330 to 15,000 RLU upon PMA + ionomycin stimulation. However, neither constitutive nor stimulated IL-2 promoter activity was affected by co-expression of T-bet. Similarly, the activity of the IL-4 and IL-5 promoters was not augmented by co-expression of T-bet. However, we confirmed the previously reported augmentation of IFN-{gamma} promoter activity is exerted by co-expression of T-bet (Table 1). Using two different reporter constructs, we observed a significant increase in both the constitutive activity of the IFN-{gamma} promoter in unstimulated cells and approximately a similar degree of augmentation in stimulated cells (Table 1).


View this table:
[in this window]
[in a new window]
 
Table 2. T-bet augments constitutive and stimulated IFN-{gamma} promoter activity
 
To examine whether the degree of augmentation of promoter activity was similar between conditions of no stimulation or stimulation by PMA + ionomycin, we repeated the experiment shown in Table 1 to determine the relative activity of each promoter construct in the presence of T-bet in terms of its activity in the presence of vector control only (Fig. 1A). For cells without stimulation, we observed ~5- to 7-fold induction of consecutive IFN-{gamma} reporter activity in the presence of T-bet as compared to vector control. Similarly, in cells stimulated with PMA + ionomycin, we observed a similar degree of augmentation of IFN-{gamma} reporter activity caused by T-bet relative to vector control, again ~7-fold induction. Finally, we confirmed this augmentation of both consecutive and stimulated promoter activity using stable reporter cell lines (Fig. 1B). We generated EL-4-OVA stable cell lines that expressed either a T-bet-expressing retrovirus or expressed the retrovirus as a control. These two cell lines were transiently transfected with two different IFN-{gamma} reporter constructs (IFN-{gamma} A or IFN-{gamma} B) and either left unstimulated or stimulated with PMA + ionomycin (Fig. 1B). Here, we also observed ~5-fold induction of IFN-{gamma} reporter activity caused by T-bet, occurring for both reporter constructs, and under both non-stimulated and stimulated conditions.

Finally, to investigate if this augmentation of the IFN-{gamma} reporters required T-bet’s DNA-interaction domain, we tested a series of T-bet mutations (Fig. 2). In Fig. 2, we expressed the activity of each T-bet mutant as a percent of the increased in IFN-{gamma} reporter activity caused by wild-type T-bet. Three different internal deletions in the T-bet T-box DNA binding domain completely eliminated each mutant’s ability to augment reporter activity (Fig. 2). In contrast, an internal deletion downstream of the DNA binding domain ({Delta}440–475) only partially reduced the increase in reporter activity. Finally, an internal deletion in the transcriptional activation domain ({Delta}39–74) significantly reduced T-bet-induced promoter activation. Interestingly, wild-type T-bet augmented promoter activity not only of a IFN-{gamma} reporter containing ~3 kb of upstream promoter (IFN-{gamma} A), but also augmented activity of reporters containing 200 bp (IFN-{gamma} F) and 90 bp (IFN-{gamma} P) of the upstream promoter sequence. This finding led us to ask whether the previously suggested T-bet target sites, TDB (12) and TRU (13), in the upstream region of the IFN-{gamma} promoter were in fact necessary for T-bet-induced promoter activity.

T-bet induces IFN-{gamma} promoter activity independently of the TDB and TRU elements
The initial study showing T-bet augmentation of the IFN-{gamma} promoter suggested two dimeric T-bet binding sites located ~2000 bp upstream of the IFN-{gamma} transcriptional start site (12), and, recently, a TRU was suggested to be located between –445 and –415 (13). However, constructs IFN-{gamma} F and IFN-{gamma} P used in Fig. 2 lacked both of these proposed elements, and yet remained responsive to T-bet for increased activity. Therefore, we generated additional reporter constructs containing selective deletions of both TDB and TRU (Fig. 3) in the context of the large genomic region contained in IFN-{gamma} A and IFN-{gamma} B, and determined the relative induction by T-bet.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3. T-bet augments the IFN-{gamma} promoter independently of the TDB and TRU regions. (A and B) Within the IFN-{gamma} B and IFN-{gamma} A luciferase reporters, internal deletion mutants were generated that lack the putative TRU region between –497 and –446 (13) ({Delta}TRU) or the TDB region between –2332 and –1966 ({Delta}TDB) (12) (see Methods). EL-4-OVA cells (24 x 106) were transiently transfected with 20 µg of the indicated IFN-{gamma} promoter luciferase reporter plasmid and either empty pcDNA vector (closed bars) or T-bet-pcDNA expression vector (open bars). After 12 h, cells were stimulated with PMA + ionomycin for 6 h and luciferase activities determined. Cytomegalovirus promoter-driven Renilla luciferase activity was used for normalization. Results are presented as the fold induction and SD of normalized firefly luciferase activity compared to the activity of each construct measured with pcDNA. Results were similar in three independent experiments.

 
Consistent with earlier results, wild-type IFN-{gamma} reporter A and B (containing ~3.5 and 2.4 kb of upstream genomic) sequences showed ~6- to 7-fold induction by T-bet (Fig. 3A). However, when either the TDB or TRU elements were internally deleted, no loss in T-bet-induced activity was observed (Fig. 3A). This suggested either that other elements could mediate induction by T-bet or that these elements were redundant. To distinguish these possibilities we examined a series of reporter constructs to determine the minimal T-bet-responsive IFN-{gamma} reporter length (Fig. 3B). First, we compared reporter constructs IFN-{gamma} E and IFN-{gamma} J, which have upstream boundaries that span the proposed TRU element, but lack the TDB elements. We observed ~6- to 7-fold T-bet inducibility in both IFN-{gamma} E and J, indicating essentially no difference in T-bet inducibility of IFN-{gamma} promoter that contained or lack the TRU element. Next, we examined a series of increasingly shorter constructs. We observed ~4- to 5-fold induction by T-bet in IFN-{gamma} reporter constructs containing as little as 80 bp of the upstream promoter sequence (Fig. 3B). However, truncation of the promoter to only 59 bp of the upstream sequence showed no induction by T-bet (Fig. 3B, IFN-{gamma} H). This suggested that T-bet-responsive elements reside within the very proximal regions of the IFN-{gamma} promoter.

Identification of monomeric Brachyury elements in the proximal IFN-{gamma} promoter
In considering possible target elements for the induction of the IFN-{gamma} promoter by T-bet, we reviewed the sequences of elements shown to be responsive to Brachyury transcription factors (Table 3). Tada and Smith reviewed binding sites in the regulatory elements of several target genes of Brachyury family proteins, indicating two modes of binding for T-box proteins to targets sequences—a dimeric mode where regulatory elements contain two closely spaced elements and a monomeric mode where a single binding element is evident (27). Since the IFN-{gamma} P reporter, containing only 80 bp of the upstream promoter, was responsive to T-bet, we examined this region for sequences similar to Brachyury consensus sites (27). One sequence, located from –66 and –57, ACTGTGAAA, was similar to the Brachyury consensus sequence. To test whether this element was involved in T-bet-induced augmentation of the IFN-{gamma} promoter, we generated a series of mutant reporter constructs of various lengths in which the central TGT core of this element was mutated to CCC ({Delta}bra) (Fig. 4). For the shortest reporter, IFN-{gamma} P, the mutation of this sequence completely eliminated T-bet responsiveness, from ~4-fold in the wild-type to no augmentation in the {Delta}bra mutant. We also mutated this TGT to CCC in IFN-{gamma} reporters of length ranging from –154 to –2394 upstream of the transcriptional start site. In each of these reporters, a clear reduction in the level of T-bet augmentation of the mutant order was observed relative to the wild-type reporter (Fig. 4). For example, IFN-{gamma} J, which lacks the proposed TRU element (13), but contains the sequence to –468 upstream of the transcriptional start site, we observed a reduction from ~7-fold inducibility by T-bet in the wild-type reporter to <2-fold inducibility by T-bet in the mutant reporter. Thus, mutation of the central 3 nucleotides of this proximal Brachyury consensus markedly reduced T-bet inducibility even in constructs containing significantly greater upstream promoter sequence. However, in constructs containing >80 bp of promoter, we observed a persistent inducibility of ~2-fold by all mutant {Delta}bra reporter constructs. Although relatively low in activity, this suggested the possibility of additional T-bet-responsive elements in addition to the element located between –66 and –57.


View this table:
[in this window]
[in a new window]
 
Table 3. T-box binding sites in the regulatory elements of target genes
 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4. A proximal monomeric Brachyury promoter element confers T-bet responsiveness. The closed boxes in the diagram indicate the relative location of a putative TRU (13) and a monomeric Brachyury (Bra) site in the proximal IFN-{gamma} promoter (Table 3). In the indicated series of IFN-{gamma} reporters, the central wild-type TGT (–63 to –61) sequence of the Brachyury site was mutated to CCC, indicated as {Delta}bra. EL-4-OVA cells (24 x 106) were transiently transfected with 20 µg of wild-type or mutated ({Delta}bra) reporter and with either 20 µg of empty pcDNA vector (closed bars) or T-bet-pcDNA expression vector (open bars). After 12 h, cells were stimulated with PMA + ionomycin for 6 h and luciferase activities determined. Cytomegalovirus promoter-driven Renilla luciferase activity was used for normalization. Results presented are the fold induction and SD of normalized firefly luciferase activity compared to the activity of each construct measured with pcDNA. Results were similar in three independent experiments.

 
Thus, we examined this sequence of the IFN-{gamma} promoter further upstream (Fig. 5A). Three additional elements of similar sequence to the monomeric Brachyury binding sites described previously (2730) were identified, located at – 104 to –99, –140 to –131 and –263 to –254 (Fig. 5A). We then generated a series of additional mutations in which the central conserved TGT sequence of each of these additional Brachyury elements was mutated in various combinations (Fig. 5B–E). The residual T-bet responsiveness that remained in reporter constructs that contained mutations in the most proximal Brachyury element was eliminated by additional mutations in the second Brachyury element upstream (Fig. 5B). This was observed for reporter constructs of various lengths extending to –468 upstream of the promoter. There appeared to be cooperative interactions between these elements, since mutations within any two of these four elements led to a significant loss of T-bet inducibility (Fig. 5B). For example, the IFN-{gamma} B reporter, which contains 2394 bp of upstream promoter sequence and is ~7- to 8-fold responsive to T-bet, became completely T-bet unresponsive when only the first and fourth Brachyury elements were mutated (Fig. 5B). Likewise, mutation of the first and third Brachyury elements completely eliminated T-bet inducibility of the IFN-{gamma} E reporter (Fig. 5C). Notably, individual mutation of any one of these elements only slightly reduction T-bet inducibility (Fig. 5D). Mutations in the first and second elements reduced T-bet inducibility from 8- to 4-fold, whereas mutations in the third or fourth elements caused essentially no reduction in T-bet inducibility (Fig. 5D).







View larger version (70K):
[in this window]
[in a new window]
 
Fig. 5. Cooperative activity of monomeric Brachyury elements in T-bet responsiveness. (A) The closed boxes in the diagram indicate the relative locations of putative monomeric Brachyury (Bra) sequences within the proximal murine IFN-{gamma} promoter region, at –57 to –66, –99 to –104, –131 to –140 and –254 to –263, with the wild-type sequence shown beneath. The TGT sequence of each site was mutated to CCC, indicated as {Delta}1, {Delta}2, {Delta}3 and {Delta}4, in various combinations as indicated (see Methods). (B) Wild-type, {Delta}1, {Delta}1/{Delta}2 and {Delta}1/{Delta}4 mutants of the INF-{gamma} L, IFN-{gamma} F, IFN-{gamma} E, IFN-{gamma} J and IFN-{gamma} B luciferase reporters were transiently transfected into EL-4-OVA with either empty pcDNA vector (closed bars) or T-bet-pcDNA expression vector (open bars) and assayed as described in Fig. 4. (C) Wild-type, {Delta}1, {Delta}1/{Delta}3 and {Delta}1/{Delta}4 mutants of the IFN-{gamma} E luciferase reporter were transiently transfected into EL-4-OVA with either empty pcDNA vector (closed bars) or T-bet-pcDNA expression vector (open bars) and assayed as described in Fig. 4. (D) Wild-type, {Delta}1, {Delta}2, {Delta}3 and {Delta}4 mutants of the INF-{gamma} E, IFN-{gamma} J and IFN-{gamma} D luciferase reporters were transiently transfected into EL-4-OVA with either empty pcDNA vector (closed bars) or T-bet-pcDNA expression vector (open bars) and assayed as described in Fig. 4. (E) Wild-type, {Delta}1/{Delta}2/{Delta}4 or {Delta}1/{Delta}2/{Delta}4/{Delta}TDB mutants of the IFN-{gamma} B and IFN-{gamma} A luciferase reporters were transiently transfected into EL-4-OVA with either empty pcDNA vector (closed bars) or T-bet-pcDNA expression vector (open bars) and assayed as described in Fig. 4.

 
These four Brachyury elements located in the proximal 300 bp of the IFN-{gamma} promoter appear to be required for T-bet inducibility even when the proposed TDB elements (12) are present, located further upstream (Fig. 5E). Thus, even in the IFN-{gamma} A reporter, containing 3447 bp of the upstream sequence and including the TDB element (12), mutation of the first, second and fourth Brachyury elements completely eliminated all T-bet inducibility (Fig. 5E). Therefore, even if the proposed TDB elements contribute to T-bet inducibility of the IFN-{gamma} promoter, their action would require the presence of the Brachyury elements located more closely to the transcriptional start site.

T-bet augments IFN-{gamma} promoter activity independently of CEBP/AP-1 elements.
The Brachyury elements 1 and 2 are located within a region of the IFN-{gamma} promoter previously described to contain binding sites for other transcription factors (2). The proximal Brachyury element is located immediately upstream of a sequence ATACGTAAT thought to interact with CEBP/AP-1 family members (31). Therefore, we wish to investigate whether this CEBP/AP-1 element also contributed to T-bet inducibility of the IFN-{gamma} reporters. We generated mutations of this CEBP site (31) (Fig. 6), but found no reduction in T-bet inducibility. Additionally, mutation of this proximal Brachyury consensus in combination with mutations adjacent to the second Brachyury element located upstream completely eliminated responsiveness of the IFN-{gamma} F reporter to T-bet.



View larger version (10K):
[in this window]
[in a new window]
 
Fig. 6. T-bet augments IFN-{gamma} promoter activity independently of the proximal AP-1 site. Clustered point mutations were introduced into the IFN-{gamma} F reporter, indicated by asterisks beneath the sequence. The wild-type IFN-{gamma} F reporter or indicated mutants were transiently transfected into EL-4-OVA with either empty pcDNA vector (closed bars) or T-bet-pcDNA expression vector (open bars) and assayed as described in Fig. 4. Results are presented as the fold induction over activity determined in the presence of the pcDNA control vector and were similar in three independent experiments.

 
Finally, we asked if inhibitors of various signaling molecules influenced T-bet inducibility of the IFN-{gamma} promoter (Fig. 7). As a control, we examined inhibition of the IL-2 reporter for these same inhibitors. As expected, inhibition of calcineurin, PKC (25) and c-Jun (24) all reduced the activity of the IL-2 reporter. In contrast, none of the inhibitors significantly reduced the level of T-bet-induced IFN-{gamma} promoter activity.

Since the proximal Brachyury element appeared important for cooperative T-bet inducibility of the IFN-{gamma} promoter, we generated a series of clustered mutations surrounding this element to define its boundaries (Fig. 8). We found that 9 bp, ACTTGTAAA, were critically important for T-bet inducibility by this Brachyury element. Importantly, this sequence is highly conserved in the IFN-{gamma} promoter between several species and is immediately upstream of a conserved CEBP/AP-1 element (31,32) (Fig. 9), arguing for functional conservation.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 8. Mapping the boundaries of the proximal Brachyury IFN-{gamma} promoter element. A series of clustered point mutations (pm-1 to pm-7) was introduced into the IFN-{gamma} P (–80) reporter, indicated beneath the sequence as described in Methods. Either 20 µg of wild-type IFN-{gamma} P reporter or the indicated mutants pm-1 to pm-7 were transiently transfected into EL-4-OVA with either empty pcDNA vector (closed bars) or T-bet-pcDNA expression vector (open bars) and assayed as described in Fig. 4. Results are averages of triplicate determinations. Similar results were obtained in two experiments.

 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 9. Conservation of Brachyury elements in the proximal IFN-{gamma} promoter. IFN-{gamma} promoter sequences of the indicated species expression in mammalian genes are aligned: a consensus GATA motif (32) in the reverse orientation (TATCT), an element interacting with the YY1 repressor (35) (GTGACCATCT) and a CEBP-interacting element (31) (ATGCAAAT). The overlapping monomeric Brachyury elements within these regions are underlined.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
This study was primarily directed at identifying the cis-acting elements within the IFN-{gamma} gene that mediate the observed activation by T-bet of IFN-{gamma} reporters. In two previous studies (12,13), T-bet-mediated activation of IFN-{gamma} reporters was demonstrated, but the specific sequences responding to T-bet were not precisely defined. In the present study, we observed a similar degree of augmentation of the various IFN-{gamma} reporter constructs upon T-bet co-expression, and, consistent with an earlier report (12), we confirmed activation of both unstimulated and PMA + ionomycin-stimulated reporter activity. Two closely adjacent dimeric Brachyury (TDB) elements were previously noted to reside ~2 kb upstream of the IFN-{gamma} promoter and suggested as potential targets of T-bet-dependent reporter activation. However, both by 5' truncation and internal deletion of the TDB elements, we found that T-bet can utilize other sites for augmenting IFN-{gamma} reporter activity. Likewise, the suggested TRU (13), located between –497 and –446 bp relative to the IFN-{gamma} transcriptional start site, was similarly examined by reporter constructs in which TRU was truncated and internally deleted. Again, we observed similar levels of T-bet-dependent augmentation of IFN-{gamma} reporter activity in constructs lacking the proposed TRU. In summary, while the proposed TDB and TRU elements represented possible T-bet target sites, our data suggested at least the presence of additional T-bet-responsive cis-acting elements.

To characterize T-bet-responsive cis-acting elements, we carried out successive truncation of the reporter first to identify a minimal T-bet-responsive region. We observed slight reductions in T-bet responsiveness in truncating sequences from –468 to –80 bp relative to the IFN-{gamma} transcriptional start site, being from 6- to 4-fold T-bet responsive. However, even in the IFN-{gamma} P reporter, containing just 80 bp of the upstream promoter, there was clearly significant maintenance of T-bet responsiveness. Surprisingly, deleting the sequences between –80 and –59 bp relative to the transcriptional start site completely eliminated T-bet-dependent promoter activation.

In examining this relatively short sequence for potential interactions with T box family member proteins, we noted some similarities to other recognized monomeric Brachyury sequences (Table 3). One of these, located between –66 and –57 bp, appeared to be functionally important for T-bet-dependent promoter activation, since a mutation of its central TGT motif ({Delta}bra) led to a complete lack of T-bet responsiveness in short reporters. Indeed, this most proximal Brachyury element appears important, since this {Delta}bra mutation caused a significant decrease in T-bet responsiveness even in constructs containing much greater amounts of upstream promoter sequence.

Because a reduced, but some residual, although weak, T-bet responsiveness was maintained by reporters that lacked this proximal Brachyury element, we searched for additional T-bet-responsive elements. We observed three additional regions with similarity to monomeric Brachyury elements that were located 300 bp proximal of the promoter. Using combinatorial mutations of these individual sites, we found that mutating these additional upstream Brachyury elements, in addition to the most proximal element, completely eliminated T-bet responsiveness of the IFN-{gamma} reporter. However, mutation of only a single one of these upstream Brachyury elements did not significantly inhibit IFN-{gamma} reporter activity. These results suggest the most promoter-proximal Brachyury element is the most important functionally, but that it requires cooperation with one or more of the other upstream Brachyury elements. Further, these upstream Brachyury elements exert less significant individual effects on T-bet-dependent reporter activation.

We have not been able to demonstrate direct binding of the elements identified functionally to factors in an electromobility shift assay (EMSA), despite significant effort to do so. Our inability to show T-bet binding by EMSA is not unique, as other studies showing T-bet’s functional effect on IFN-{gamma} reporters have also not presented corroborating EMSA data (12,13). We suspect that the monomeric nature of these individual cooperative Brachyury elements may indicate that the sites alone are not robust targets for stable T-bet binding and that it may be necessary to incorporate multiple monomeric sites in adjacent positions to enable evidence of direct T-bet binding. Nonetheless, in their native configuration, these elements do not appear to be capable of robust EMSA binding as isolated monomeric cis elements.

The nature of the augmentation of reporter activity by T-bet is pharmacologically distinct from the type of activation exerted by NF-AT on the IL-2 promoter. First, the IL-2 reporter is completely inhibited by the calcineurin inhibitor CsA, as expected. In contrast, T-bet-activated IFN-{gamma} reporter activity was not affected by CsA, as we previously demonstrated (5). MAPK and Jun kinase inhibitors significantly decreased IL-2 reporter activity (Fig. 7), as expected, but did not diminish T-bet-activated IFN-{gamma} reporter activity. To date, the mapping of T-bet-responsive cis-acting elements has been carried out in the context of transient transfections and not in the context of developmental regulation of the IFN-{gamma} locus in vivo. Therefore, the augmentation of constitutive promoter activity is subject to some interpretation and could, for example, reflect an inherent capacity to increase general accessibility of DNA to transcriptional machinery, rather than as a direct induction of transcription itself. In such an interpretation, the in vivo role of T-bet could be to induce an accessible chromatin configuration in CD4+ T cells which have previously undergone a developmental silencing process of IFN-{gamma} locus. Thus, if this same process of IFN-{gamma} silencing did not occur in other cell types, such as CD8+ T cells, this might explain the observed lack of requirement of T-bet for IFN-{gamma} expression in CD8+ T cells (14). Alternately, CD8+ T cells could express an additional factor in addition to T-bet, which functionally substitutes for T-bet in driving IFN-{gamma} expression, generating an appearance of T-bet-independent IFN-{gamma} production. In any case, the identification of specific T-bet responsive promoter elements in this study should facilitate the analysis of these elements in the more difficult setting of integrated IFN-{gamma} reporters placed in the germline and examined developmentally.


    Acknowledgements
 
We thank Drs Jianfei Yang and Wenjun Ouyang for the gift of valuable reagents and assistance. This work was supported in part by grants from the NIH. K. M. M. is an investigator of the Howard Hughes Medical Institute.


    Abbreviations
 
AS—anti-sense

CsA—cyclosporin A

EMSA—electromobility shift assay

PKC—protein kinase C

PMA—phorbol 12-myristate 13-acetate

S—sense


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Stark, G. R., Kerr, I. M., Williams, B. R., Silverman, R. H. and Schreiber, R. D. 1998. How cells respond to interferons. Annu. Rev. Biochem. 67:227.[CrossRef][Web of Science][Medline]
  2. Murphy, K. M., Ouyang, W., Farrar, J. D., Yang, J., Ranganath, S., Asnagli, H., Afkarian, M. and Murphy, T. L. 2000. Signaling and transcription in T helper development. Annu. Rev. Immunol. 18:451.[CrossRef][Web of Science][Medline]
  3. Glimcher, L. H. and Murphy, K. M. 2000. Lineage commitment in the immune system: the T helper lymphocyte grows up. Genes Dev. 14:1693.[Free Full Text]
  4. Szabo, S. J., Sullivan, B. M., Peng, S. L. and Glimcher, L. H. 2003. Molecular mechanisms regulating Th1 immune responses. Annu. Rev. Immunol. 21:713.[CrossRef][Web of Science][Medline]
  5. Yang, J., Murphy, T. L., Ouyang, W. and Murphy, K. M. 1999. Induction of interferon-gamma production in Th1 CD4+ T cells: evidence for two distinct pathways for promoter activation. Eur. J. Immunol. 29:548.[CrossRef][Web of Science][Medline]
  6. Yang, J., Zhu, H., Murphy, T. L., Ouyang, W. and Murphy, K. M. 2001. IL-18-stimulated GADD45 beta required in cytokine-induced, but not TCR-induced, IFN-gamma production. Nature 2:157.
  7. Sica, A., Tan, T. H., Rice, N., Kretzschmar, M., Ghosh, P. and Young, H. A 1992. The c-rel protooncogene product c-Rel but not NF-kappa B binds to the intronic region of the human interferon-gamma gene at a site related to an interferon-stimulable response element. Proc. Natl Acad. Sci. USA 89:1740.[Abstract/Free Full Text]
  8. Campbell, P. M., Pimm, J., Ramassar, V. and Halloran, P. F. 1996. Identification of a calcium-inducible, cyclosporine sensitive element in the IFN-gamma promoter that is a potential NFAT binding site. Transplantation 61:933.[CrossRef][Web of Science][Medline]
  9. Sica, A., Dorman, L., Viggiano, V., Cippitelli, M., Ghosh, P., Rice, N. and Young, H. A. 1997. Interaction of NF-kappaB and NFAT with the interferon-gamma promoter. J. Biol. Chem. 272:30412.[Abstract/Free Full Text]
  10. Rooney, J. W., Hodge, M. R., McCaffrey, P. G., Rao, A. and Glimcher, L. H. 1994. A common factor regulates both Th1- and Th2-specific cytokine gene expression. EMBO J. 13:625.[Web of Science][Medline]
  11. Robinson, D., Shibuya, K., Mui, A., Zonin, F., Murphy, E., Sana, T., Hartley, S. B., Menon, S., Kastelein, R., Bazan, F. and O’Garra, A. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-gamma production and activates IRAK and NFkappaB. Immunity 7:571.[CrossRef][Web of Science][Medline]
  12. Szabo, S. J., Kim, S. T., Costa, G. L., Zhang, X. K., Fathman, C. G. and Glimcher, L. H. 2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655.[CrossRef][Web of Science][Medline]
  13. Soutto, M., Zhang, F., Enerson, B., Tong, Y., Boothby, M. and Aune, T. M. 2002. A minimal IFN-gamma promoter confers Th1 selective expression. J. Immunol. 169:4205.[Abstract/Free Full Text]
  14. Szabo, S. J., Sullivan, B. M., Stemmann, C., Satoskar, A. R., Sleckman, B. P. and Glimcher, L. H. 2002. Distinct effects of T-bet in TH1 lineage commitment and IFN-gamma production in CD4 and CD8 T cells. Science 295:338.[Abstract/Free Full Text]
  15. Peng, S. L., Szabo, S. J. and Glimcher, L. H. 2002. T-bet regulates IgG class switching and pathogenic autoantibody production. Proc. Natl Acad. Sci. USA 99:5545.[Abstract/Free Full Text]
  16. Fields, P. E., Kim, S. T. and Flavell, R. A. 2002. Cutting edge: changes in histone acetylation at the IL-4 and IFN-gamma loci accompany Th1/Th2 differentiation. J. Immunol. 169:647.[Abstract/Free Full Text]
  17. Avni, O., Lee, D., Macian, F., Szabo, S. J., Glimcher, L. H. and Rao, A. 2002. TH cell differentiation is accompanied by dynamic changes in histone acetylation of cytokine genes. Nat. Immunol. 3:643.[Web of Science][Medline]
  18. Szabo, S. J., Gold, J. S., Murphy, T. L. and Murphy, K. M. 1993. Identification of cis-acting regulatory elements controlling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc [published erratum appears in Mol. Cell. Biol. 13:5928]. Mol. Cell. Biol. 13:4793.[Abstract/Free Full Text]
  19. Ranganath, S., Ouyang, W., Bhattarcharya, D., Sha, W. C., Grupe, A., Peltz, G. and Murphy, K. M. 1998. GATA-3-dependent enhancer activity in IL-4 gene regulation. J. Immunol. 161:3822.[Abstract/Free Full Text]
  20. Afkarian, M., Sedy, J. R., Yang, J., Jacobson, N. G., Cereb, N., Yang, S. Y., Murphy, T. L. and Murphy, K. M. 2002. T-bet is a STAT1-induced regulator of IL-12R expression in naive CD4+ T cells. Nat. Immunol. 3:549.[CrossRef][Web of Science][Medline]
  21. Zhu, H., Yang, J., Murphy, T. L., Ouyang, W., Wagner, F., Saparov, A., Weaver, C. T. and Murphy, K. M. 2001. Unexpected characteristics of the IFN-gamma reporters in nontransformed T cells. J. Immunol. 167:855.[Abstract/Free Full Text]
  22. Pang, L., Sawada, T., Decker, S. J. and Saltiel, A. R. 1995. Inhibition of MAP kinase kinase blocks the differentiation of PC-12 cells induced by nerve growth factor. J. Biol. Chem. 270:13585.[Abstract/Free Full Text]
  23. Cuenda, A., Rouse, J., Doza, Y. N., Meier, R., Cohen, P., Gallagher, T. F., Young, P. R. and Lee, J. C. 1995. SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin. FEBS Lett. 364:229.[CrossRef][Web of Science][Medline]
  24. Bennett, B. L., Sasaki, D. T., Murray, B. W., O’Leary, E. C., Sakata, S. T., Xu, W., Leisten, J. C., Motiwala, A., Pierce, S., Satoh, Y., Bhagwat, S. S., Manning, A. M. and Anderson, D. W. 2001. SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc. Natl Acad. Sci. USA 98:13681.[Abstract/Free Full Text]
  25. Hamilton, M., Liao, J., Cathcart, M. K. and Wolfman, A. 2001. Constitutive association of c-N-Ras with c-Raf-1 and protein kinase C epsilon in latent signaling modules. J. Biol. Chem. 276:29079.[Abstract/Free Full Text]
  26. Zhou, M., Ouyang, W., Gong, Q., Katz, S. G., White, J. M., Orkin, S. H. and Murphy, K. M. 2001. Friend of GATA-1 represses GATA-3-dependent activity in CD4+ T cells. J. Exp. Med. 194:1461.[Abstract/Free Full Text]
  27. Tada, M. and Smith, J. C. 2001. T-targets: clues to understanding the functions of T-box proteins. Dev. Growth Differ. 43:1.[CrossRef][Web of Science][Medline]
  28. Kispert, A. and Herrmann, B. G. 1993. The Brachyury gene encodes a novel DNA binding protein. EMBO J. 12:3211.[Web of Science][Medline]
  29. Casey, E. S., Tada, M., Fairclough, L., Wylie, C. C., Heasman, J. and Smith, J. C. 1999. Bix4 is activated directly by VegT and mediates endoderm formation in Xenopus development. Development 126:4193.[Abstract]
  30. Carreira, S., Liu, B. and Goding, C. R. 2000. The gene encoding the T-box factor Tbx2 is a target for the microphthalmia-associated transcription factor in melanocytes. J. Biol. Chem. 275:21920.[Abstract/Free Full Text]
  31. Penix, L. A., Sweetser, M. T., Weaver, W. M., Hoeffler, J. P., Kerppola, T. K. and Wilson, C. B. 1996. The proximal regulatory element of the interferon-gamma promoter mediates selective expression in T cells. J. Biol. Chem. 271:31964.[Abstract/Free Full Text]
  32. Penix, L., Weaver, W. M., Pang, Y., Young, H. A. and Wilson, C. B. 1993. Two essential regulatory elements in the human interferon gamma promoter confer activation specific expression in T cells. J. Exp. Med. 178:1483.[Abstract/Free Full Text]
  33. Di Gregorio, A. and Levine, M. 1999. Regulation of Ci-tropomyosin-like, a Brachyury target gene in the ascidian, Ciona intestinalis. Development 126:5599.[Abstract]
  34. Casey, E. S., O’Reilly, M. A., Conlon, F. L. and Smith, J. C. 1998. The T-box transcription factor Brachyury regulates expression of eFGF through binding to a non-palindromic response element. Development 125:3887.[Abstract]
  35. Ye, J., Cippitelli, M., Dorman, L., Ortaldo, J. R. and Young, H. A. 1996. The nuclear factor YY1 suppresses the human gamma interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element. Mol. Cell Biol. 16:4744.[Abstract]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
FASEB J.Home page
A. C. Liberman, J. Druker, D. Refojo, F. Holsboer, and E. Arzt
Glucocorticoids inhibit GATA-3 phosphorylation and activity in T cells
FASEB J, May 1, 2009; 23(5): 1558 - 1571.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. R. Podojil and S. D. Miller
Cross-Linking of CD80 on CD4+ T Cells Activates a Calcium-Dependent Signaling Pathway
J. Immunol., January 15, 2009; 182(2): 766 - 773.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Bandyopadhyay, M. Long, H. Z. Qui, A. T. Hagymasi, A. M. Slaiby, M. A. Mihalyo, H. L. Aguila, R. S. Mittler, A. T. Vella, and A. J. Adler
Self-Antigen Prevents CD8 T Cell Effector Differentiation by CD134 and CD137 Dual Costimulation
J. Immunol., December 1, 2008; 181(11): 7728 - 7737.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. D. Lewis, S. A. Miller, M. M. Miazgowicz, K. M. Beima, and A. S. Weinmann
T-bet's Ability To Regulate Individual Target Genes Requires the Conserved T-Box Domain To Recruit Histone Methyltransferase Activity and a Separate Family Member-Specific Transactivation Domain
Mol. Cell. Biol., December 15, 2007; 27(24): 8510 - 8521.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. K. Hamalainen-Laanaya, J. J. Kobie, C. Chang, and W.-p. Zeng
Temporal and Spatial Changes of Histone 3 K4 Dimethylation at the IFN-{gamma} Gene during Th1 and Th2 Cell Differentiation
J. Immunol., November 15, 2007; 179(10): 6410 - 6415.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. C. Liberman, D. Refojo, J. Druker, M. Toscano, T. Rein, F. Holsboer, and E. Arzt
The activated glucocorticoid receptor inhibits the transcription factor T-bet by direct protein-protein interaction
FASEB J, April 1, 2007; 21(4): 1177 - 1188.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. L. Matsuda, T. C. George, J. Hagman, and L. Gapin
Temporal Dissection of T-bet Functions
J. Immunol., March 15, 2007; 178(6): 3457 - 3465.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Wittmann, C. Killig, M. Bruder, R. Gutzmer, and T. Werfel
Critical involvement of IL-12 in IFN-{gamma} induction by calcineurin antagonists in activated human lymphocytes
J. Leukoc. Biol., July 1, 2006; 80(1): 75 - 86.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
F. Zhang and M. Boothby
T helper type 1-specific Brg1 recruitment and remodeling of nucleosomes positioned at the IFN-{gamma} promoter are Stat4 dependent
J. Exp. Med., June 12, 2006; 203(6): 1493 - 1505.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. M. Beima, M. M. Miazgowicz, M. D. Lewis, P. S. Yan, T. H-M. Huang, and A. S. Weinmann
T-bet Binding to Newly Identified Target Gene Promoters Is Cell Type-independent but Results in Variable Context-dependent Functional Effects
J. Biol. Chem., April 28, 2006; 281(17): 11992 - 12000.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Long, A. M. Slaiby, A. T. Hagymasi, M. A. Mihalyo, A. C. Lichtler, S. L. Reiner, and A. J. Adler
T-bet Down-Modulation in Tolerized Th1 Effector CD4 Cells Confers a TCR-Distal Signaling Defect That Selectively Impairs IFN-{gamma} Expression
J. Immunol., January 15, 2006; 176(2): 1036 - 1045.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. L. Shinohara, M. Jansson, E. S. Hwang, M. B. F. Werneck, L. H. Glimcher, and H. Cantor
T-bet-dependent expression of osteopontin contributes to T cell polarization
PNAS, November 22, 2005; 102(47): 17101 - 17106.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
E. S. Hwang, J.-H. Hong, and L. H. Glimcher
IL-2 production in developing Th1 cells is regulated by heterodimerization of RelA and T-bet and requires T-bet serine residue 508
J. Exp. Med., November 7, 2005; 202(9): 1289 - 1300.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. T. Lin, S. L. Martin, L. Xia, and J. D. Gorham
TGF-{beta}1 Uses Distinct Mechanisms to Inhibit IFN-{gamma} Expression in CD4+ T Cells at Priming and at Recall: Differential Involvement of Stat4 and T-bet
J. Immunol., May 15, 2005; 174(10): 5950 - 5958.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. L. Reiner
Epigenetic control in the immune response
Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R41 - R46.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. Grenningloh, B. Y. Kang, and I-C. Ho
Ets-1, a functional cofactor of T-bet, is essential for Th1 inflammatory responses
J. Exp. Med., February 22, 2005; 201(4): 615 - 626.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Y. Tong, T. Aune, and M. Boothby
T-bet antagonizes mSin3a recruitment and transactivates a fully methylated IFN-{gamma} promoter via a conserved T-box half-site
PNAS, February 8, 2005; 102(6): 2034 - 2039.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Shnyreva, W. M. Weaver, M. Blanchette, S. L. Taylor, M. Tompa, D. R. Fitzpatrick, and C. B. Wilson
Evolutionarily conserved sequence elements that positively regulate IFN-{gamma} expression in T cells
PNAS, August 24, 2004; 101(34): 12622 - 12627.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Cho, J. Y.
Right arrow Articles by Murphy, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cho, J. Y.
Right arrow Articles by Murphy, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?