International Immunology, Vol. 14, No. 9, pp. 983-991,
September 2002
© 2002 Japanese Society for Immunology
FEATURED ARTICLE OF THE MONTH |
Regulation of Ig class switch recombination by NF-
B: retroviral expression of RelB in activated B cells inhibits switching to IgG1, but not to IgE
1 Division of Immunology, Cancer Research Laboratory, Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720-3200, USA
Correspondence to: W. C. Sha; E-mail: bsha{at}uclink4.berkeley.edu
Transmitting editor: K. Murphy
| Abstract |
|---|
|
|
|---|
Mutant NF-
B-deficient B cells from knockout mice lacking RelA, p105/p50 or the transactivation domain of c-Rel exhibit distinct and selective cell-intrinsic defects in their ability to undergo class switch recombination (CSR) to specific Ig isotypes. This isotype-specific requirement for particular NF-
B transcription factors in B cells activated to undergo CSR is intriguing because the NF-
B composition in B cells is also highly regulated and can vary significantly depending upon how B cells are activated. These studies prompted us to test by retroviral transduction of normal B cells whether changes in the NF-
B composition in activated B cells could modulate cytokine-driven CSR. RelB, RelA, c-Rel, p50 and p52 were first expressed in lipopolysaccharide-activated primary B cells and then induced by cytokine addition to undergo CSR to IgG1, IgE, IgG2a, IgG2b or IgA. Surprisingly, only retroviral expression of RelB altered CSR, resulting in a 3-fold decrease in CSR to IgG1 induced by IL-4. This effect was isotype specific as RelB expression did not affect CSR to IgE within the same culture or to other isotypes tested. The transactivation domain of RelB was required for inhibition of CSR to IgG1. Expression of p50RelB or p52RelB dimers joined covalently by a flexible peptide linker also specifically inhibited IgG1 CSR. RelB-mediated inhibition of IgG1 CSR was associated with a decrease in germline
1 transcription, but not with changes in proliferation as assayed by CFSE labeling. Thus, RelB complexes can specifically inhibit CSR to IgG1, but not IgE, in activated, primary B cells.
Keywords: IL-4, isotype switching, lipopolysaccharide, retrovirus, splenic B cells
| Introduction |
|---|
|
|
|---|
Naive mature B cells express surface Ig of the IgM and IgD isotypes. Following antigenic encounter B cells can undergo class switch recombination (CSR) and utilize a different antibody isotype (1). The choice of the new Ig isotype appears to be directed largely, if not exclusively, by the cytokines to which a particular B cell is exposed. IL-4 treatment, for example, has been shown to direct isotype switching to IgG1 and IgE (2), IFN-
instructs murine B cells to switch to IgG2a or IgG3 (3,4), and transforming growth factor (TGF)-ß effects class switching to IgA or IgG2b (5,6).
There is, however, growing evidence that B cell-intrinsic properties may cooperate with cytokine signaling to regulate class switching in an isotype-specific manner. For instance, studies have shown that the number of cell divisions a B cell undergoes in conjunction with CD40 ligand and IL-4 treatment can greatly influence the ability of a B cell to undergo cytokine-directed CSR to IgG1 or IgE (7). Similarly, the absence of certain B cell-intrinsic signaling molecules that are not directly regulated by cytokines involved in CSR, such as the NF-
B family of transcription factors, has been found to prevent CSR to certain isotypes (Table 1). Mutant NF-
B-deficient B cells from knockout mice lacking RelA, p105/p50 or the transactivation domain of c-Rel exhibit distinct and selective B cell-intrinsic defects in their ability to undergo CSR to specific Ig isotypes (810).
|
These studies examining the ability of NF-
B knockout B cells to undergo CSR clearly demonstrate that NF-
B transcription factors are part of the machinery required for cytokine-driven CSR to occur to certain isotypes. However, one important unanswered question raised by these studies is whether natural differences in the cellular composition of NF-
B complexes within B cells can also modulate cytokine-driven CSR. A large body of research suggests that the cellular composition of NF-
B dimers is fluid, and reflects both the differentiation state of B cells (11,12) and the activation state of B cells induced by different innate and adaptive immune signaling pathways (13). Thus, if natural changes in the composition of NF-
B transcription factors within B cells participate in the regulation of CSR, the involvement of NF-
B factors in CSR may reflect not simply a hard-wired component activating the CSR machinery, but also a more complex regulatory mechanism that allows information on the state of the B cell to be integrated with cytokine-driven CSR.
In order to test this hypothesis that differences in the cellular composition of NF-
B complexes in activated B cells modulate cytokine-directed CSR, we chose to retrovirally infect activated splenic B cells with individual NF-
B family members. Because NF-
B transcription factors also regulate other aspects of B cell differentiation including proliferation and apoptosis, retroviral infection of wild-type B cells has several advantages over the analysis of mutant knockout B cells for specifically focusing on the regulation of cytokine-driven CSR. Mutant B cells from NF-
B-deficient mice may possess either subtle developmental differences that may accentuate defects in assays of CSR or long-term compensatory changes in function that may mask the particular roles of individual NF-
B family members in regulating CSR (14). For example, both p50- and RelB-deficient mice have been shown to have defects in marginal zone B cell development (15,16). Thus, the B cell-intrinsic defects in CSR reported in NF-
B-deficient B cells (see Table 1) may also reflect differences in the populations of splenic B cells used for these studies. These issues are more carefully controlled in the setting of transient expression of NF-
B members in wild-type B cells.
Although we hypothesized that the cellular NF-
B dimer composition might alter cytokine-driven CSR, we observed that RelA, c-Rel, p50 and p52 expression in lipopolysaccharide-activated primary B cells did not alter IL-4-driven CSR to IgG1 and IgE, IFN-
-driven CSR to IgG2a, TGF-ß-driven CSR to IgG2b, TGF-ß-, IL-4- and IL-5-driven CSR to IgA or CSR to IgG3. Surprisingly, only retroviral expression of RelB altered CSR, resulting in a 3-fold decrease in CSR to IgG1 induced by IL-4. This effect was isotype specific as RelB expression did not affect CSR to IgE within the same culture or to other isotypes tested. Expression of p52RelB or p50RelB dimers joined covalently by a flexible peptide linker also specifically inhibited IgG1 CSR and the transactivation domain of RelB was required for inhibition of CSR to IgG1. RelB-mediated inhibition of IgG1 CSR was associated with a decrease in germline
1 transcription, but not with changes in proliferation as assayed by CFSE labeling. Thus, although individual NF-
B family members may be required for CSR to specific isotypes, these results support only a limited role for natural differences in the cellular composition of NF-
B transcription factors within B cells as being a B cell-intrinsic regulatory mechanism for modulating cytokine-driven CSR.
| Methods |
|---|
|
|
|---|
Retroviral constructs and production
The generation of the murine stem cell virus 2.2 (MSCV) has been described elsewhere (17). The pgkneo cassette in MSCV 2.2 was excised with BglII and ClaI, and replaced with a synthetic oligonucleotide polylinker containing BglIIXhoINotIPmeISalIEcoRIHindIIIClaI. An IRESgreen fluorescent protein (GFP) cassette was inserted into the EcoRI site of this vector to generate MSCVIRESGFP. The p50 cDNA was cloned into the XhoINotI sites, RelA and c-Rel cDNAs were cloned into the NotISalI sites, the RelB cDNA was cloned as a BamHINotI insert into the BglIINotI sites, and the p52 cDNA was cloned into the NotI site of MSCVIRESGFP. Covalently linked dimers were generated by inserting an in-frame cassette encoding 10 copies of a SerGly4 linker downstream of the p50 or p52 coding regions. RelB was cloned in-frame downstream of these linked cDNAs to generate MSCVp50LRelB IRESGFP or MSCVp52LRelB IRESGFP. The MSCVIRESThy-1.1 and MSCVRelBIRESThy-1.1 constructs were provided by Dr Thomas Mitchell (University of Louisville). Then 10 µg of each retroviral construct was transfected into 4 x 106 Bosc23 packaging cells on 10-cm2 plates using calcium phosphate co-precipitation. After 8 h, media was replaced with 6 ml of fresh media and retroviral supernatants were harvested 48 h after transfection.
Reagents
Recombinant mouse IL-4 and mouse IL-5 were purchased from R & D Systems (Minneapolis, MN). TGF-ß1 was purchased from PharMingen (San Diego, CA). IFN-
was a gift of K. Murphy (Washington University, St Louis, MO). Biotinylated anti-mouse IgG1 (A85-1), IgA (R5-140), IgG2a (R19-15), IgG2b (R12-3), IgG3 (R40-82) and anti-mouse Thy-1.1 (OX-7 clone) were purchased from PharMingen. Purified anti-IgE antibody (84.1C) was a kind gift of Dr Z. Eshhar (Weizmann Institute, Rehovot, Israel) and was biotinylated using biotin sulfosuccinimidyl ester from Molecular Probes (Eugene, OR). Polyclonal anti-RelB rabbit serum and polyclonal anti-rabbit-horseradish peroxidase antibodies were purchased from Santa Cruz Biotechnologies (Santa Cruz, CA). Western blots were developed with NEN (Boston, MA) Renaissance reagents. StreptavidinTriColor was purchased from Caltag (Burlingame, CA). CFSE was purchased from Molecular Probes and used to label B cells as described in the manufacturers protocol.
Isotype switching assays
Splenocytes were harvested from C57BL6/J mice, and red blood cells were lysed in 17 mM TrisCl and 144 mM NH4Cl buffer and spun over Ficoll 1083 (Sigma, St Louis, MO). Cells at the interface were collected, washed, then stained with anti-Thy-1.2 ascites. Stained cells were then lysed in 10% rabbit complement (Accurate, Westbury, NY) in PBS for 45 min at 37°C. Cells were washed, spun over Ficoll 1119 (Sigma), stained using an anti-B220phycoerythrin antibody (PharMingen; clone RA3-6B2) and analyzed using flow cytometry (XL; Coulter, Miami, FL) to assess purity (typically >90%). B cells were then incubated in 24-well plates at 106 cells/well in media [RPMI (Gibco, Carlsbad, CA) + 10% FBS (Hyclone, Logan, UT) + 50 µM ß-mercaptoethanol] + 30 µg/ml LPS (Sigma) for 24 h. Cells were then spun over Ficoll 1119, resuspended in retroviral supernatant at 106 cells/ml and infected by spinning for 1.5 h in six-well plates at 32°C. These cells were resuspended at 106 cells/ml in media containing 30 µg/ml LPS in six-well plates and incubated for 2 days to allow expression of the retrovirus. Cells were then spun over Ficoll 1119 to remove dead cells, and diluted to 105 cells/ml in media containing 30 µg/ml LPS, 100 ng/ml IL-4 and 25 ng/ml IL-5; 2 ml of this suspension was added to each well of 24-well plates. For isotype switching to other isotypes, IL-4 was added along with or replaced by 10 U/ml IFN-
(gift of K. Murphy and R. Schreiber, Washington University, St Louis) or 10 ng/ml TGF-ß1 (PharMingen). After 4 days, these cells were spun over Ficoll 1119 and stained for flow cytometric analysis on a Coulter Epics XL. Data were plotted using the WinMDI program.
Immunoblots
Whole-cell extracts were obtained by resuspending cells in PBS + 0.5% NP-40, incubating on ice for 10 min, spinning at 30 000 g and harvesting the supernatant. The protein concentration from above was determined using BioRad (Hercules, CA) protein assay reagent. Aliquots of 5 µg from each sample were subjected to Western blotting.
Germline transcripts
Cells were treated as above in the isotype-switching assay, but were harvested after only 24 h in media containing IL-4. Cells were stained with biotinylated anti-Thy-1.1 antibody, streptavidin beads (Miltenyi, Auburn, CA) + streptavidinphycoerythrin and sorted on an AUTOMacs machine (Miltenyi). Purity was assessed by flow cytometry and was typically >90%. Total RNA was isolated using TRIzol reagent (Gibco) and 1 µg was used as template for the RT-PCR reaction. Oligo(dT)1216 was used as the primer for the reverse transcription reaction using Superscript II (Gibco). Aliquots of 2 µl (1/10) of each reaction were used for the subsequent PCR reactions. The magnesium concentrations and oligonucleotides used for each PCR reaction are listed below. For all reactions, a single PCR cycle consisted of:
GAPDH (14 cycles): 1 mM MgCl2 (150 bp amplicon)
5' oligo: TACCCCCAATGTGTCCGTCGT
3' oligo: GAAGTCGCAGGAGACAACCT
probe: GGTGAAGCAGGCATCTGAGGG
1 (18 cycles): 1 mM MgCl2 (153 bp amplicon)
5' oligo (I
1): TGGCCCTTCCAGATCTTTGAGT
3' oligo (C
1): CAGGCTGTAGGCAAGCACCTTT
probe: CAGACCAGCCCAGGCAGA
Reactions were electrophoresed on a 2% agarose TBE gel and subjected to Southern blot analysis using the 32P-labeled probes listed above. Band intensities were quantified using a Phosphorimager.
CFSE assays
Freshly purified splenic B cells were resuspended at 107 cells/ml in PBS + 0.1% BSA and CFSE was added to a final concentration of 10 nM. Reactions were incubated at 37°C for 15 min and quenched with media. Cells were plated at 2 x 106 cells/well of a 24-well plate with 30 µg/ml LPS for 12 h and analyzed by flow cytometry. At this point, cells were infected as above with MSCVIRESThy-1.1 or MSCVRelBIRESThy-1.1. Cells were plated at 105 cells/ml, 2 ml/well of a 24-well plate in media containing 30 µg/ml LPS and 100 ng/ml IL-4, and analyzed each day after infection by flow cytometry.
Luciferase assays
293T cells (106) were transfected with 10 ng each of HIVfirefly luciferase (18) and pEF1
renilla luciferase (gift of H. Kasler and A. Winoto, University of California, Berkeley) and 100 ng of control or NF-
B-encoding retroviral vectors. After 24 h, cells were lysed in 0.5 ml Passive Lysis Buffer (Promega, Madison, WI). An aliquot of 20 µl of each lysate was used per reaction. Firefly and renilla luciferase activity was assayed according to manufacturers instructions (Promega) on a Monolight 2010 luminometer (Analytical Luminescence Laboratory, San Diego, CA).
| Results |
|---|
|
|
|---|
Recombinant retroviruses were generated expressing individual NF-
B family member genes for RelB, RelA, c-Rel, p50 and p52 cloned upstream of an IRESGFP cassette in a MSCVIRESGFP retroviral vector (19). Each of these constructs was tested functionally by an NF-
B-dependent luciferase reporter assay (Fig. 3C and D). Proper expression of p50 and p52 was further confirmed by immunoblots and electrophoretic mobility shift assays (data not shown). Recently, retroviral expression of RelB, RelA and c-Rel using these constructs was shown to modulate activated T cell survival upon antigen and adjuvant challenge in vivo (20). We utilized these NF-
B retroviruses to test whether changes in the composition of NF-
B complexes in activated primary B cells modulated cytokine-directed CSR to different Ig isotypes.
|
The GFP expressed from the IRESGFP cassette provided an accurate fluorescent marker of retrovirally infected cells expressing different NF-
B family members as shown by the expression pattern of a dual marker MSCVtruncated nerve growth factor receptor (tNGFR)IRESGFP retrovirus in primary B cells (Fig. 1). Using an antibody specific for tNGFR, we monitored expression of both tNGFR and GFP simultaneously by flow cytometric analysis of retrovirally transduced B cells that were activated by LPS. Virtually all B cells that expressed tNGFR also expressed GFP and, conversely, very few B cells expressed GFP without the concomitant expression of tNGFR. These results demonstrate that GFP expression served as a stringent marker that distinguishes B cell populations expressing and not expressing genes cloned upstream of the IRES sequence within cultures of retrovirally transduced cells. Further, the relative expression levels of GFP correlated with those of tNGFR, indicating that high GFP-expressing B cells tended to also express high levels of tNGFR. These results indicate that the expression level of GFP reflected the relative expression level of the gene cloned upstream.
|
Although retroviral markers were detected as early as 24 h after infection, maximal expression of retroviral markers and the genes cloned upstream of the IRES sequence was clearly reached by 48 h after infection (data not shown). Thus, day 3, when LPS-stimulated B cells were maximally expressing transduced NF-
B subunits, was chosen as the timepoint for addition of cytokines to initiate CSR to specific isotypes and assess the ability of retroviral expression of individual NF-
B family members to modulate cytokine-directed CSR. B cells were activated to isotype switch to IgG1 and IgE via addition of IL-4, to IgG2a by adding IFN-
, to IgG2b with addition of TGF-ß, to IgA with addition of TGF-ß, IL-4 and IL-5 or to IgG3 via culturing in the absence of cytokines. On day 7, B cells were stained with isotype-specific antibodies to determine percentages of cells that had undergone CSR. As small differences in cytokine addition can cause significant changes in the percentage of cells that undergo CSR, we chose to compare the effects of NF-
B-transduced cells to internally controlled non-transduced cells within the same cultures rather than to separate control samples using GFP marker expression. Since CSR induced in ex vivo splenic B cell cultures typically occurs 34 days after cytokine addition, retroviral expression of NF-
B subunits preceded CSR in our assays. This allowed us to study how the cellular NF-
B composition of a B cell prior to cytokine exposure can affect CSR to specific Ig isotypes.
In examining IL-4 cytokine-mediated CSR, we observed that expression of RelB resulted in a 3-fold inhibition of isotype switching to IgG1, but not to IgE, relative to non-transduced cells within the same culture (Fig. 2A). This inhibitory effect of isotype switching to IgG1 was reproducible and specific for RelB, as expression of RelA, c-Rel, p50 or p52 NF-
B family members did not alter isotype switching to either IgG1 or IgE (Fig. 2B). Further, in examining IFN-
and TGF-ß cytokine-mediated CSR, neither RelB nor any of the other individual NF-
B family members affected isotype switching to IgG2a, IgG2b, IgA or IgG3 (Fig. 2C). These results indicate that alterations in NF-
B complexes in activated B cells had only a modest effect on cytokine-driven CSR and were limited to the ability of RelB expression to specifically inhibit IL-4-mediated CSR to IgG1, but not IgE.
|
Because NF-
B transcription factors function as dimers, we next sought to address whether RelB expression led to inhibition of CSR to IgG1 by functioning as dimers corresponding to p52RelB dimers normally found in B cells or by forming unnatural dimers not normally found in B cells. To test whether expression of p52RelB dimers could also lead to specific inhibition of CSR to IgG1, we created forced dimers corresponding to endogenous RelB complexes by creating a fusion protein of RelB covalently joined to either p52 or p50 by a flexible (Gly4Ser)10 linker (Fig. 3A). These p52LRelB and p50LRelB forced dimer proteins were expressed as full-length proteins within cells with minimal release of free RelB from degradation of the protein linker (Fig. 3B). Further, in transfection experiments, these p52LRelB and p50LRelB forced dimers were capable of activating transcription of an HIV-
B-dependent luciferase reporter at levels that were comparable to co-transfection of individual p50, p52 and RelB subunits (Fig. 3D). These results suggest that that the retroviral expression of p52LRelB and p50LRelB forced dimers would correspond to overexpression of endogenous p52RelB complexes. When retrovirally transduced into activated B cells, expression of both p52LRelB and p50LRelB dimers resulted in similar modulation of IL-4-driven CSR as expression of RelB alone (Fig. 4). These forced dimers specifically inhibited isotype switching to IgG1. These results indicate that retroviral expression of RelB functioned to inhibit IL-4-mediated CSR to IgG1 by dimers corresponding to endogenous p52RelB complexes rather than by generation of aberrant dimers not normally found within B cells.
|
We next sought to address whether the increases in RelB complexes led to inhibition of CSR to IgG1 by transactivation of transcription or by competitive inhibition through binding to DNA sites used by other transcription factors. If RelB was functioning to inhibit CSR to IgG1 by competitive inhibition, expression of a dominant-negative form of RelB should also lead to inhibition of CSR to IgG1. We utilized a dominant-negative RelB mutant (amino acids 103392) that retains its ability to dimerize and bind DNA, but can no longer activate transcription (21). Retroviral expression of this dominant-negative RelB did not lead to a decrease in isotype switching to IgG1, demonstrating that the transcriptional activation domain of RelB was required for inhibition of CSR to IgG1 (Fig. 4). These results were consistent with a model whereby increases in RelB complexes led to inhibition of IL-4-driven CSR to IgG1 by transactivation of RelB-regulated genes.
Because germline transcription through the switch region and the constant region of a particular isotype is always observed prior to CSR, we next sought to determine whether retroviral expression of RelB led to altered germline
1 transcription (Fig. 5). While no definitive causal relationship has been established between germline transcription and CSR, several reports have suggested that the spliced germline transcripts themselves may participate in the CSR event (22). B cells were infected with a RelB-expressing retrovirus containing an IRESThy-1.1 marker after 1 day of activation with LPS. On day 3 when RelB was expressed in activated B cells, the cytokine IL-4 was added to induce germline transcription. After 24 h, retrovirally infected cells were isolated from non-infected cells by magnetic bead selection using the Thy-1.1 marker. RNA was purified from both cell populations and RT-PCR was used to semi-quantitatively compare spliced
1 germline transcripts between B cell populations retrovirally expressing or not expressing RelB.
|
We repeatedly observed that B cells retrovirally expressing RelB showed decreased germline
1 transcription in response to IL-4 treatment in comparison to their non-transduced counterparts from the same cultures (Fig. 5). In five separate experiments, RelB-expressing cells consistently showed lower levels of spliced
1 germline transcripts in comparison to their non-transduced counterparts. This decrease was specific as controls for GAPDH transcripts were equivalent between RelB-expressing and non-expressing populations. The extent of the decrease in germline
1 transcripts was variable, ranging from a 2-fold decrease to an absence of detectable transcripts. To confirm that this reduction in germline
1 transcripts was caused by RelB expression and did not arise as an artifact of retroviral infection or magnetic bead selection, we repeated the experiments using B cells infected with a control MSCVIRESThy-1.1 vector. In contrast to infection with the MSCVRelBIRESThy-1.1 vector, no differences in germline
1 transcripts were observed between retrovirally transduced and non-transduced cell populations with the control vector within the same IL-4-transduced cultures. These data indicate that RelB expression results in decreased germline
1 transcription in LPS-activated B cells treated with IL-4.
We next sought to address whether decreases in germline
1 transcription might be related changes in the proliferation of activated B cells expressing RelB (Fig. 6). Earlier studies have suggested that B cells must undergo at least three divisions prior to isotype switching to IgG1, while five cell divisions are required prior to IgE class switching (7). These division numbers are apparently linked to the onset of germline transcription for these isotypes (23). To assess whether RelB affected proliferation of B cells in our CSR assays, we CFSE-labeled B cells, and then activated them in the presence of LPS and IL-4. Activated splenic B cells were then infected with either a control or RelB-encoding retroviruses and CFSE profiles of control or RelB-infected B cells were followed over 4 days. No differences were observed in CSFE profiles, suggesting that RelB expression did not substantially alter the proliferative behavior of activated B cells within our assays.
|
| Discussion |
|---|
|
|
|---|
The NF-
B family of transcription factors has been implicated in a broad range of processes involving innate and adaptive immunity. The phenotypes of knockout mice lacking individual and multiple genes corresponding to the five mammalian family members, RelA, RelB, c-Rel, NFKB-1 (p50 and its precursor p105) and NFKB-2 (p52 and its precursor p100), are complex, with defects in multiple hematopoietic cell lineages, including B cells where NF-
B was originally identified (24). Analyses of different knockout B cells reveal that NF-
B factors regulate B cell activation and proliferation by a variety of general B cell activators, including LPS, CD40 ligand and antigen receptor cross-linking (2528).
Studies with B cell lines and primary B cells indicate that the composition of NF-
B dimers found within B cells is variable and reflects both the activation and differentiation state of a B cell, presumably due in part to transcriptional cross-regulation of different family member genes (11,12,29). These studies showed that in pre-B cells, the major NF-
B complex consists of p50 and RelA, while the cellular NF-
B composition shifts to p50 and c-Rel in mature B cells. Intriguingly, high levels of p52RelB complexes are observed in plasma cells, suggesting a role for RelB-containing complexes in regulating terminal B cell maturation events such as plasma cell differentiation or CSR. Thus, activation of the same extracellular signaling pathways may result in the translocation of different NF-
B dimers depending upon the state of the B cell when activated. Since the pool of NF-
B dimers available for translocation likely reflects information from multiple signaling pathways, signaling by NF-
B transcription factors in B cells has the complex capacity to evoke differential transcriptional programs of gene activation that are specific to the activation state of the B cell.
Studies with knockout B cells have also revealed that NF-
B activation by general B-cell activators is critical for CSR to occur to specific isotypes (see Table 1). B cells from Rel and p50 knockout mice, for example, have distinct intrinsic defects in their ability to class switch to IgE, IgA and IgG1 (9,10,30). The involvement of NF-
B factors in signaling CSR is consistent with the identification of
B-binding sites within the germline CH promoters regulating class switching to IgG1 and IgE and within the 3' IgH enhancers that have been implicated in isotype switch regulation (3135). Taken together, these studies demonstrate that activation of NF-
B in B cells is required along with activation of cytokine signaling pathways to direct CSR to specific isotypes.
Although the precise mechanisms by which NF-
B factors regulate CSR remain to be elucidated, we sought to test whether potential natural differences that can arise in the cellular composition of NF-
B complexes in activated B cells could potentially modulate cytokine-driven CSR. If so, the involvement of NF-
B factors in CSR would reflect not simply a hard-wired signaling response activating CSR, but also a more complex regulatory mechanism that allows information on the state of the B cell to be integrated with cytokine-driven CSR.
In order to test this hypothesis that differences in the cellular composition of NF-
B complexes in activated B cells modulate cytokine-directed CSR, we chose to retrovirally infect activated splenic B cells with individual NF-
B family members. Retroviral expression of RelA, c-Rel, p50 and p52 expression in LPS-activated primary B cells, however, did not alter IL-4-driven CSR to IgG1 and IgE, IFN-
-driven CSR to IgG2a, TGF-ß-driven CSR to IgG2b, TGF-ß-, IL-4- and IL-5-driven CSR to IgA or CSR to IgG3. Surprisingly, only retroviral expression of RelB altered CSR, resulting in a 3-fold decrease in CSR to IgG1 induced by IL-4. While our data suggest that RelB may play a role in modulating IL-4-driven IgG1 isotype switching, we have not observed significant differences in RelB expression levels upon cytokine treatment or between B cell subpopulations (data not shown). Thus, although individual NF-
B family members are required for CSR to specific isotypes, these results suggest that natural alterations in the cellular composition of NF-
B transcription factors may have only a limited capacity to modulate cytokine-driven CSR in activated B cells.
The ability of RelB to inhibit IL-4-driven CSR to IgG1 in LPS-activated B cells was isotype specific as RelB expression did not affect CSR to IgE within the same culture or to other isotypes tested. Expression of p52RelB or p50RelB dimers joined covalently by a flexible peptide linker also specifically inhibited IgG1 CSR and the transactivation domain of RelB was required for inhibition of CSR to IgG1. These results are consistent with a model where increases in RelB complexes corresponding to endogenous RelB complexes are required for transcription of genes that lead to inhibition of IgG1 CSR. Although others have reported that RelB can actually increase transcription of the
1 promoter in reporter assays (32), we found that retroviral RelB expression was associated in activated primary B cells with a decrease in germline
1 transcription, but not with changes in proliferation as assayed by CFSE labeling. Since the C-terminal transactivation domain of RelB was required for inhibition of IgG1 isotype switching, it seems likely that downstream genes regulated by RelB in activated primary B cells are responsible for the inhibition of
1 germline transcripts and that this effect takes precedence over any direct transcriptional effects of RelB on the
1 germline promoter in B cells. Our results utilizing retroviral transduction highlight the need to study CSR in primary B cells where NF-
B factors regulate multiple aspects of B cell differentiation.
| Acknowledgements |
|---|
This work was supported by NIH grant AI42252 and the Pew Charitable Trusts. We would like to thank Dr Z. Eshhar (Weizmann Institute, Rehovot, Israel) for generously providing the 84.1C anti-IgE antibody.
| Abbreviations |
|---|
CSRclass switch recombination
GFPgreen fluorescent protein
LPSlipopolysaccharide
MSCVmurine stem cell virus
tNGFRtruncated nerve growth factor receptor
TGFtransforming growth factor
| References |
|---|
|
|
|---|
- Snapper, C. M., Marcu, K. B. and Zelazowski, P. 1997. The immunoglobulin class switch: beyond accessibility. Immunity 6:217.[ISI][Medline]
- Snapper, C. M., Finkelman, F. D., Stefany, D., Conrad, D. H. and Paul, W. E. 1988. IL-4 induces co-expression of intrinsic membrane IgG1 and IgE by murine B cells stimulated with lipopolysaccharide. J. Immunol. 141:489.[Abstract]
- Snapper, C. M., Peschel, C. and Paul, W. E. 1988. IFN-gamma stimulates IgG2a secretion by murine B cells stimulated with bacterial lipopolysaccharide. J. Immunol. 140:2121.[Abstract]
- Snapper, C. M., McIntyre, T. M., Mandler, R., Pecanha, L. M., Finkelman, F. D., Lees, A. and Mond, J. J. 1992. Induction of IgG3 secretion by interferon
: a model for T cell- independent class switching in response to T cell-independent type 2 antigens. J. Exp. Med. 175:1367.[Abstract/Free Full Text] - McIntyre, T. M., Kehry, M. R. and Snapper, C. M. 1995. Novel in vitro model for high-rate IgA class switching. J. Immunol. 154:3156.[Abstract]
- McIntyre, T. M., Klinman, D. R., Rothman, P., Lugo, M., Dasch, J. R., Mond, J. J. and Snapper, C. M. 1993. Transforming growth factor ß1 selectivity stimulates immunoglobulin G2b secretion by lipopolysaccharide-activated murine B cells. J. Exp. Med. 177:1031.
[Abstract/Free Full Text] - Hasbold, J., Lyons, A. B., Kehry, M. R. and Hodgkin, P. D. 1998. Cell division number regulates IgG1 and IgE switching of B cells following stimulation by CD40 ligand and IL. Eur. J. Immunol. 28:1040.[ISI][Medline]
- Horwitz, B. H., Zelazowski, P., Shen, Y., Wolcott, K. M., Scott, M. L., Baltimore, D. and Snapper, C. M. 1999. The p65 subunit of NF-
B is redundant with p50 during B cell proliferative responses, and is required for germline CH transcription and class switching to IgG3. J. Immunol. 162:1941.[Abstract/Free Full Text] - Zelazowski, P., Carrasco, D., Rosas, F. R., Moorman, M. A., Bravo, R. and Snapper, C. M. 1997. B cells genetically deficient in the c-Rel transactivation domain have selective defects in germline CH transcription and Ig class switching. J. Immunol. 159:3133.[Abstract]
- Snapper, C. M., Zelazowski, P., Rosas, F. R., Kehry, M. R., Tian, M., Baltimore, D. and Sha, W. C. 1996. B cells from p50/NF-
B knockout mice have selective defects in proliferation, differentiation, germ-line CH transcription, and Ig class switching. J. Immunol. 156:183.[Abstract]
- Grumont, R. J. and Gerondakis, S. 1994. The subunit composition of NF-
B complexes changes during B-cell development. Cell Growth Different. 5:1321.[Abstract]
- Liou, H. C., Sha, W. C., Scott, M. L. and Baltimore, D. 1994. Sequential induction of NF-
B/Rel family proteins during B-cell terminal differentiation. Mol. Cell Biol. 14:5349.[Abstract/Free Full Text] - Lin, S. C., Wortis, H. H. and Stavnezer, J. 1998. The ability of CD40L, but not lipopolysaccharide, to initiate immunoglobulin switching to immunoglobulin G1 is explained by differential induction of NF-
B/Rel proteins. Mol. Cell Biol. 18:5523.[Abstract/Free Full Text] - Weih, F., Durham, S. K., Barton, D. S., Sha, W. C., Baltimore, D. and Bravo, R. 1997. p50-NF-kappaB complexes partially compensate for the absence of RelB: severely increased pathology in p50(/)relB(/) double-knockout mice. J. Exp. Med. 185:1359.
[Abstract/Free Full Text] - Cariappa, A., Liou, H. C., Horwitz, B. H. and Pillai, S. 2000. Nuclear factor kappa B is required for the development of marginal zone B lymphocytes. J. Exp. Med. 192:1175.
[Abstract/Free Full Text] - Weih, D. S., Yilmaz, Z. B. and Weih, F. 2001. Essential role of relb in germinal center and marginal zone formation and proper expression of homing chemokines. J. Immunol. 167:1909.
[Abstract/Free Full Text] - Hawley, R. G., Lieu, F. H., Fong, A. Z. and Hawley, T. S. 1994. Versatile retroviral vectors for potential use in gene therapy. Gene Ther. 1:136.[ISI][Medline]
- Schmid, R. M., Perkins, N. D., Duckett, C. S., Andrews, P. C. and Nabel, G. J. 1991. Cloning of an NF-
B subunit which stimulates HIV transcription in synergy with p65. Nature 352:733.[Medline]
- Ranganath, S., Ouyang, W., Bhattarcharya, D., Sha, W. C., Grupe, A., Peltz, G. and Murphy, K. M. 1998. GATA-3-dependent enhancer activity in IL-4 gene regulation. J. Immunol. 161:3822.
[Abstract/Free Full Text] - Mitchell, T. C., Hildeman, D., Kedl, R. M., Teague, T. K., Schaefer, B. C., White, J., Zhu, Y., Kappler, J. and Marrack, P. 2001. Immunological adjuvants promote activated T cell survival via induction of Bcl. Nat. Immunol. 2:397.[ISI][Medline]
- Dobrzanski, P., Ryseck, R. P. and Bravo, R. 1993. Both N- and C-terminal domains of RelB are required for full transactivation: role of the N-terminal leucine zipper-like motif. Mol. Cell Biol. 13:1572.
[Abstract/Free Full Text] - Daniels, G. A. and Lieber, M. R. 1995. RNA:DNA complex formation upon transcription of immunoglobulin switch regions: implications for the mechanism and regulation of class switch recombination. Nucleic Acids Res. 23:5006.
[Abstract/Free Full Text] - McCall, M. N. and Hodgkin, P. D. 1999. Switch recombination and germ-line transcription are division-regulated events in B lymphocytes. Biochim. Biophys. Acta 1447:43.[Medline]
- Gugasyan, R., Grumont, R., Grossmann, M., Nakamura, Y., Pohl, T., Nesic, D. and Gerondakis, S. 2000. Rel/NF-
B trans cription factors: key mediators of B-cell activation. Immunol. Rev. 176:134.[ISI][Medline]
- Doi, T. S., Takahashi, T., Taguchi, O., Azuma, T. and Obata, Y. 1997. NF-
B RelA-deficient lymphocytes: normal development of T cells and B cells, impaired production of IgA and IgG1 and reduced proliferative responses. J. Exp. Med. 185:953.[Abstract/Free Full Text] - Kontgen, F., Grumont, R. J., Strasser, A., Metcalf, D., Li, R., Tarlinton, D. and Gerondakis, S. 1995. Mice lacking the c-rel proto-oncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleukin-2 expression. Genes Dev. 9:1965.
[Abstract/Free Full Text] - Sha, W. C., Liou, H. C., Tuomanen, E. I. and Baltimore, D. 1995. Targeted disruption of the p50 subunit of NF-
B leads to multifocal defects in immune responses. Cell 80:321.[ISI][Medline]
- Beg, A. A., Sha, W. C., Bronson, R. T., Ghosh, S. and Baltimore, D. 1995. Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-
B. Nature 376:167.[Medline]
- Healy, J. I., Dolmetsch, R. E., Timmerman, L. A., Cyster, J. G., Thomas, M. L., Crabtree, G. R., Lewis, R. S. and Goodnow, C. C. 1997. Different nuclear signals are activated by the B cell receptor during positive versus negative signaling. Immunity 6:419.[ISI][Medline]
- Snapper, C. M., Rosas, F. R., Zelazowski, P., Moorman, M. A., Kehry, M. R., Bravo, R. and Weih, F. 1996. B cells lacking RelB are defective in proliferative responses, but undergo normal B cell maturation to Ig secretion and Ig class switching. J. Exp. Med. 184:1537.
[Abstract/Free Full Text] - Delphin, S. and Stavnezer, J. 1995. Regulation of antibody class switching to IgE: characterization of an IL-4-responsive region in the immunoglobulin heavy-chain germline
promoter. Ann. NY Acad. Sci. 764:123.[Abstract]
- Lin, S. C. and Stavnezer, J. 1996. Activation of NF-
B/Rel by CD40 engagement induces the mouse germ line immunoglobulin C
1 promoter. Mol. Cell Biol. 16:4591603.[Abstract]
- Iciek, L. A., Delphin, S. A. and Stavnezer, J. 1997. CD40 cross-linking induces Ig
germline transcripts in B cells via activation of NF-
B: synergy with IL-4 induction. J. Immunol. 158:4769.[Abstract]
- Michaelson, J. S., Singh, M., Snapper, C. M., Sha, W. C., Baltimore, D. and Birshtein, B. K. 1996. Regulation of 3' IgH enhancers by a common set of factors, including
B-binding proteins. J. Immunol. 156:2828.[Abstract]
- Cogne, M., Lansford, R., Bottaro, A., Zhang, J., Gorman, J., Young, F., Cheng, H. L. and Alt, F. W. 1994. A class switch control region at the 3' end of the immunoglobulin heavy chain locus. Cell 77:737.[ISI][Medline]
- Weih, F., Warr, G., Yang, H. and Bravo, R. 1997. Multifocal defects in immune responses in RelB-deficient mice. J. Immunol. 158:5211.[Abstract]
- Burkly, L., Hession, C., Ogata, L., Reilly, C., Marconi, L. A., Olson, D., Tizard, R., Cate, R. and Lo, D. 1995. Expression of relB is required for the development of thymic medulla and dendritic cells. Nature 373:531.[Medline]
- Carrasco, D., Cheng, J., Lewin, A., Warr, G., Yang, H., Rizzo, C., Rosas, F., Snapper, C. and Bravo, R. 1998. Multiple hemopoietic defects and lymphoid hyperplasia in mice lacking the transcriptional activation domain of the c-Rel protein. J. Exp. Med. 187:973.
[Abstract/Free Full Text] - Caamano, J. H., Rizzo, C. A., Durham, S. K., Barton, D. S., Raventos-Suarez, C., Snapper, C. M. and Bravo, R. 1998. Nuclear factor (NF)-
B2 (p100/p52) is required for normal splenic microarchitecture and B cell-mediated immune responses. J. Exp. Med. 187:185.[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
J. R. Radke, Z. K. Siddiqui, T. A. Miura, J. M. Routes, and J. L. Cook E1A Oncogene Enhancement of Caspase-2-Mediated Mitochondrial Injury Sensitizes Cells to Macrophage Nitric Oxide-Induced Apoptosis J. Immunol., June 15, 2008; 180(12): 8272 - 8279. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bhattacharya, M. T. Cheah, C. B. Franco, N. Hosen, C. L. Pin, W. C. Sha, and I. L. Weissman Transcriptional Profiling of Antigen-Dependent Murine B Cell Differentiation and Memory Formation J. Immunol., November 15, 2007; 179(10): 6808 - 6819. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Gourzi, T. Leonova, and F. N. Papavasiliou Viral induction of AID is independent of the interferon and the Toll-like receptor signaling pathways but requires NF-{kappa}B J. Exp. Med., February 19, 2007; 204(2): 259 - 265. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pongratz, J. W. McAlees, D. H. Conrad, R. S. Erbe, K. M. Haas, and V. M. Sanders The Level of IgE Produced by a B Cell Is Regulated by Norepinephrine in a p38 MAPK- and CD23-Dependent Manner. J. Immunol., September 1, 2006; 177(5): 2926 - 2938. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Logue, S. Bakkour, M. M. Murphy, H. Nolla, and W. C. Sha ICOS-Induced B7h Shedding on B Cells Is Inhibited by TLR7/8 and TLR9 J. Immunol., August 15, 2006; 177(4): 2356 - 2364. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yamada, K. Zhang, A. Yamada, D. Zhu, and A. Saxon B Lymphocyte Stimulator Activates p38 Mitogen-Activated Protein Kinase in Human Ig Class Switch Recombination Am. J. Respir. Cell Mol. Biol., May 1, 2005; 32(5): 388 - 394. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








