Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mertsching, E.
Right arrow Articles by Hedrick, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mertsching, E.
Right arrow Articles by Hedrick, S. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 14, No. 9, pp. 1039-1053, September 2002
© 2002 Japanese Society for Immunology

A mouse strain defective for {alpha}ß versus {gamma}{delta} T cell lineage commitment

Elisabeth Mertsching1, Andrea L. Wurster5, Carol Katayama1, Jeffrey Esko3, Fred Ramsdell4, Jamey D. Marth2,3 and Stephen M. Hedrick1

1 Department of Biology and Cancer Center, 2 The Howard Hughes Medical Institute, and 3 Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, CA 92093, USA 4 Celltech Chiroscience R & D, Bothell, WA 98021, USA 5 Present address: Department of Immunology and Infectious Diseases, Harvard School of Public Health, Boston, MA 02115, USA

Correspondence to: S. M. Hendrick; E-mail: shedrick{at}ucsd.edu
Transmitting editor: M. J. Bevan


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
As a result of a transgene insertion and chromosomal deletion, a mutant mouse strain has been found that is defective in the lineage commitment step that produces a balance of {alpha}ß and {gamma}{delta} T cells. The mice produce a reduced population of {alpha}ß CD4 T cells and almost no {alpha}ß CD8 T cells. Within the CD4 and CD8 populations in the thymus there exist abnormal subsets that express the {gamma}{delta} TCR. These {gamma}{delta} TCR-expressing cells populate the peripheral lymphoid organs such that up to 75% of the CD8 T cells in the lymph nodes and spleen express a {gamma}{delta} TCR. Further analyses indicate that the regulation that prevents dual TCR expression has been impaired. The locus of insertion and deletion was mapped to chromosome 10 26 cM. We have analyzed the entire locus and, in addition, the gene expression changes in early thymocytes were analyzed by gene array technology. The analysis of this mutant strain indicates that the {alpha}ß versus {gamma}{delta} lineage decision can be profoundly disregulated independently of successful gene rearrangements.

Keywords: chromosomal deletion, development, immune response, lineage commitment, T cells


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Two distinct T cell lineages are produced in the thymus. They are distinguished by the identity of the TCR they express. However, in addition, they exhibit very different functional roles in the immune system (1). T cells expressing the {alpha}ß TCR are predominant in the lymphoid organs, and they exhibit a variety of well-characterized regulatory and cytotoxic phenotypes. With few exceptions, they have specificity for peptides bound to MHC molecules. Most T cells expressing the {gamma}{delta} TCR do not express the T cell accessory molecules CD4 and CD8{alpha}ß in adult animals (2,3), and they do not have specificity for peptide associated with MHC molecules. The characterized antigen specificities include: simple organo-pyrophosphates present in mycobacterial cultures (4), native cell-surface and viral proteins (58) and the stress-related MICA proteins (9). {gamma}{delta} T cells represent only a small fraction of the thymocytes and lymph node (LN) T cells in adult mice, but they are disproportionately represented in the epithelium of the skin, intestine, lung and reproductive organs (10,11). The immune function of {gamma}{delta} T cells, although still poorly understood, is almost certainly multifaceted. It may constitute a first line of defense, including the recognition and resolution of bacterial infections, tissue damage and stress. There may also be a role for immune regulation by {gamma}{delta} T cells (1). The weight of evidence indicates that {alpha}ß and {gamma}{delta} T cells are phenotypically distinct, and serve functionally different roles in immunity (12).

Development of the immune system depends upon the differentiation of a lymphoid-monocytic progenitor that gives rise to proportionately regulated populations of B cells, monocytes, dendritic cells, NK cells, {gamma}{delta} T cells, {alpha}ß CD4 Th cells and {alpha}ß CD8 cytotoxic T cells (1316). The fate decision that produces {gamma}{delta} T cells and {alpha}ß T cells associates the rearrangement and expression of the two TCR isoforms with the distinct phenotypes described above. To explain this concordance of phenotype with receptor expression, two mechanisms have been proposed. In one, pre-commitment to a particular lineage biases the rearrangement and expression of the {gamma}{delta} and {alpha}ß TCR genes (1721), whereas in the other, there exists a competition for receptor rearrangement in a bipotent progenitor cell and the identity of the productively rearranged receptor is instructive for continued appropriate differentiation (2226). Despite the large amount of attention given to this problem, thus far, the field has not reached a consensus.

At least three non-TCR genes have been involved in {alpha}ß versus {gamma}{delta} lineage commitment. In mice deficient for pre-T{alpha}, it was reported that {alpha}ß T cell development was blocked at the double-negative (DN) CD44 CD25+ stage in the thymus. However, a low percentage of {alpha}ß T cells still matured and the number of {gamma}{delta} T cells was found to be 3- to 10-fold increased (27). Notch has also been reported to be involved in the {alpha}ß versus {gamma}{delta} lineage commitment. An activated form of Notch favors {alpha}ß T cells to the detriment of {gamma}{delta} T cells (28). Further experiments showed that progenitors with a hemizygous deficiency in Notch are at a selective disadvantage in {alpha}ß T cell development. On the other hand, in mice deficient for Jagged2, encoding a Notch ligand expressed in the thymus, fetal {alpha}ß T cell development was reported to be normal, whereas {gamma}{delta} T cell development was deficient (29). These results imply that Notch is involved in the decision process of precursors to differentiate toward one lineage or the other. A third locus that affects {alpha}ß versus {gamma}{delta} T cell development may be Id3, a natural competitive inhibitor of basic helix–loop–helix transcription factors such as E2A (30). When overexpressed, Id3 can cause a developmental inhibition of {alpha}ß but not {gamma}{delta} T cell development (31).

In this report we describe a mutant strain of mice that arose from a chromosomal deletion associated with the incorporation of a transgene. The particular transgene consisted of the Lck proximal promoter driving the expression of the Cre recombinase. In these otherwise normal mice, the lineage decision that gives rise to {alpha}ß and {gamma}{delta} T cells is disrupted. Few T cells expressing the {alpha}ß TCR are able to develop, although the number of T cells expressing the {gamma}{delta} TCR is substantially increased. At least some T cells seem to have an indeterminate phenotype suggested by the abnormal co-expression of TCR {gamma}{delta} and the CD4 and CD8 ({alpha}ß heterodimer) co-receptors, and also by the presence of a small subset of T cells in the LN co-expressing the {gamma}{delta} and {alpha}ß TCR. We considered three hypotheses to explain the phenotypic alterations noted. (i) Cre is expressed at a high level and this somehow affects development in a consistent manner. Although a recent study showed that Cre expression can alter cellular growth patterns (32) we find that the level of Cre in these mutant mice is not substantially different than three other ostensibly normal lck–Cre transgenic lines. (ii) The insertion/deletion has induced the ectopic expression of a gene during thymus development or it has reduced or eliminated expression of a gene that is essential for regulated T cell development. The region of transgene insertion was cloned and analyzed for genomic structure. A deletion consisting of >500,000 bp was found, and the genes found in and around the lesion were mapped. We analyzed the expression levels of the nearest genes and, in addition, measured the expression of 12,000 genes by gene array techniques. The results show that none of the localized genes are altered in expression and the genes that are differentially expressed do not map to the region of insertion. (iii) The insertion or deletion has caused a large-scale or long-range disruption of gene expression in a region of the chromosome. A number of genes that map within several million bases were examined for expression and no alterations were noted. The implications for {gamma}{delta} versus {alpha}ß lineage commitment are discussed.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice
The Cre550I mice line is one founder from a series of transgenic mice in which the Cre recombinase was expressed under the control of the lck proximal promoter. pMC-Cre was blunt-end cloned as a MluI–MluI 1.1-kb fragment in the SalI site of p1017 (33). The 6.8-kb fragment consisted of the lck proximal promoter, the Cre coding region and the human growth hormone gene (hGH) contributing transcription termination signals. The transgene was excised by digestion with NotI and the linear DNA was used for pronuclear injections.

The B6-PL and RAG1–/– mice were obtained from the Jackson Laboratory (Bar Harbor, ME). The AND TCR transgenic mice and the OT-1 TCR transgenic mice (34,35) were crossed to the Cre550I mice. As controls, littermates with no copy of the transgene or age-matched C57BL/6 mice were used. Mice were typed for the presence of the transgene in tail DNA by PCR. Two sets of primers were used: one hybridizing in the transgene (in the Cre gene, Cre 5 and in the hGH 3'UT, GH 3) and the other in the deleted region flanking the transgene integration, BR1.1 and BR1.3 (see below). Using these two sets of primers we could distinguish between wild-type, hemizygous and homozygous Cre550I mice. The sequence of the primers is (5' to 3'):

Cre 5: GCTGATGATCCGAATAACTACC

GH 3: CTTACCTGTAGCCATTGCAGCTAGGTGAGC

BR1.1: ACACTGAAGGAACTCTGAGGT

BR1.3: TCTGGGCAATTGTAACTGTT

Cloning the region flanking the transgene insertion
The technique for cloning the genomic region flanking the transgene insert was based on that of Siebert et al. (36). DNA from Cre550I mice was tested for blunt enzyme sites that do not cut within the region of interest. ScaI and EcoRV were chosen using standard Southern blotting techniques. Total genomic DNA was digested to completion with the two different enzymes and the resulting fragments ligated to a double-stranded ‘walking adaptor’. This incorporates ‘suppression PCR’ to prevent non-specific amplification. The flanking regions were amplified using nested primers corresponding to the hGH sequences:

hGH1: 5'AGCCTTGTCCTAATAAAATTAAGTTGCATC3';

hGH2: 5'AATTAAGTTGCATCATTTTGTCTGACTAGG3'.

For primer sequences, see Siebert et al. (36). The amplification was carried out with a mixture of Tth and Vent polymerases with a Tth antibody to give a ‘hot start’. The PCR products were digested with NotI and cloned into pBluescriptII. We were successful only in amplifying one side of flanking sequence. The ScaI fragment gave rise to 400 bp of flanking sequence (all repetitive) and the EcoRV fragment gave rise to 1.4 kb of flanking sequence. The sequence corresponding to the other side of the transgene insertion was found on a chromosomal walk of >500,000 bases. Sequences were tested for their presence or absence in Cre550I+/+ and wild-type mice. Data on the chromosomal walk are available on request.

Real-time PCR
Total RNA from Cre550I+/–, Cre550I+/+, lck-CreLee+/+, Cre540+/–, Cre548+/+ and Cre548+/– thymuses was extracted using TRIzol (Invitrogen Life Technologies, Carlsbad, CA) following the manufacturer’s protocol. Total RNA (5 µg) was primed with oligo(dT) and reverse transcribed using AMV reverse transcriptase (Promega, Madison, WI). cDNA representing 12 ng of starting total RNA was used as template in PCR reactions using the DNA Master Sybr Green I Kit (Roche, Indianapolis, IN) (37) and analyzed in The Light Cycler (Roche) using the following primers (5' to 3'):

CRE-R: GGCAAAACAGGTAGTTATTCG

CRE-L: ACGGTGGGAGAATGTTAATC

Relative expression levels were determined by normalizing to internal GAPDH controls. Controls were carried out for GAPDH and acidic ribosomal protein housekeeping gene. The signal was checked for each sample by recording the temperature of melting. All three primers gave clean signals with a sharp melting point at the expected temperatures.

Antibodies
Prior to every staining on LN and spleen cells, the Fc receptors from antigen-presenting cells (APC) were blocked with mouse IgG serum (Sigma, St Louis, MO; I-5381). When the anti-V{alpha} antibodies were used, cells were preincubated with two isotype controls: rat IgG2{alpha} (PharMingen, San Diego, CA; 11021D) and rat IgG2ß (PharMingen; 11031D). For surface staining we used: anti-CD4 [Caltag, San Francisco, CA; phycoerythrin (PE) conjugated, RM 2504-3 or biotin conjugated, 09422D); anti-CD8 (Caltag; Tricolor conjugated, RM 2206 or FITC conjugated, RM 2201-3 or biotin conjugated, 01042D); anti-pan TCRß chain constant region (H57-597; PharMingen; CyChrome conjugated, 01308A or FITC conjugated, 01304D); anti-B220 (Caltag; FITC conjugated, RM 2601); anti-pan TCR {gamma}{delta} constant region (GL3, PharMingen; PE conjugated, 01315A); hamster antibody isotype control for GL3 (PharMingen; PE conjugated, 11145A,); anti-V{alpha}2 (B20.1; PharMingen; biotin conjugated, 01652C); anti-V{alpha}11.1, 11.2 (RR8-1; PharMingen; 01462C), anti-V{alpha}8 (B21.14; PharMingen; biotin conjugated, 01962C); anti-V{gamma}2 (UC3-10A6; PharMingen; biotin conjugated, 01472C). Biotin antibodies were revealed with streptavidin–allophycocyanin (13049A; PharMingen). To exclude dead cells from the analysis, we treated the cells with the dye 7-aminoactinomycin D (7-AAD; Molecular Probes, Eugene, OR).

Proliferation assays
Purified CD4+ or CD8+ T cells were enriched by first depleting the B cells with sheep anti-mouse IgG Dynabeads (Dynal, Lake Success, NY) for 20 min at 4°C and then depleting with anti-CD4 or CD8 Dynabeads (Dynal). The purity of the subset was analyzed by flow cytometry. Then 2–5 x 104 purified cells/well were stimulated with the specific antigen, pigeon cytochrome c (88–104) or ovalbumin (OVA) peptide (SIINFEKL, a gift from M. Bevan, University of Washington). Pigeon cytochrome c (88–104) was used at the final concentrations 0.1–10 µM and OVA peptide at 0.001–3 nM. Spleen cells, to be used as APC, were treated with 0.25mg mitomycin C for 30 min at 37°C and then added at 3 x 105 cells/well. In mixed lymphocyte reactions, spleen cells of different MHC haplotypes were mitomycin C-treated as above and added to the culture at 0.2 to 106 cells/well. Purified CD4+ T cells from Cre550I+/+ and wild-type littermates were used at the concentration of 4 x 104 cells/well. The proliferative response of CD4+ T cells was also analyzed after stimulation with phorbol myristate acetate (PMA, 524400; Calbiochem, San Diego, CA) and ionomycin (A23187; Calbiochem). PMA was used at increasing concentrations of 0.001 to 10 ng/ml and ionomycin at the constant concentration of 0.1 µg/ml final. After 48 h, 1 µCi [3H]thymidine was added to the wells and cells were harvested 12–16 h later.

Analysis of in-frame versus out-of-frame rearrangements.
{gamma} and {delta} rearrangements were amplified from sorted {alpha}ß+ {gamma}{delta} LN T cells by PCR. The following PCR primers were used (5' to 3'):

V{gamma}5: TCCACTGGTACCGATTCCAGAAA

J{gamma}1: ACCAGAGGGAATTACTATGAG

V{delta}4: CCGCTTCTGTGTGAACTTCC

J{delta}1: TCCACAGTCACTTGGGTTCC

The PCR products were then cloned with the TOPO TA cloning kit (Invitrogen, 907588-F) and fragments were sequenced with an automatic sequencer (ABI Prism, 310 Genetic Analyzer).

Interspecies hybrid mapping
The mapping of the deleted region was performed with the Jackson Laboratory Backcross DNA Panel Mapping Resource. The primers used for the PCR were BR1.1 and BR1.3. These primers revealed a polymorphism in the resulting band size between DNA from C57BL/6 and Mus spretus.

Fluorescence in situ hybridization (FISH)
Lymphocytes were isolated from the spleen of a transgenic and wild-type mouse, and cultured at 37°C in RPMI 1640 supplemented with 15% FCS, 3 µg/ml concanavalin A, 10 µg/ml lipopolysaccharide and 5 x 10–5 2-mercaptoethanol. After 44 h, the cultured lymphocytes were treated with 0.18 mg/ml BrdU for an additional 14 h. The synchronized cells were washed and recultured at 37°C for 4 h in {alpha}-MEM with thymidine (2.5 µg/ml). Chromosome slides were made by standard methods: hypotonic treatment, fixation and air dry.

The DNA probe (Cre) was biotinylated with dATP using the Gibco/BRL (Rockville, MD) BioNick labeling kit (15°C 1 h) (38). The procedure for FISH detection was performed by SeeDNA Biotech (Ontario, Canada) (38,39). After overnight hybridization slides were washed and detected. FISH signals and the DAPI banding pattern were recorded separately. Assignment of FISH signals with chromosomal bands was achieved by superimposing the FISH signals with DAPI-banded chromosomes. The slides were analyzed for 100 mitotic figures with 85 showing hybridization on one specific chromosome. There was no other positive locus detectable under the condition used.

Gene chip array
Total RNA from Cre550I+/+;RAG1–/– and Cre550I–/–;RAG1–/– thymuses was extracted by using the TRIzol reagent (Gibco/BRL) following the manufacturer’s protocol. cDNA synthesis, probe hybridization to the chips and scanning were performed in the UCSD Core facility. The GeneChips used were Mu11K subA and subB. Data analysis was carried out using GeneSpring (Silicon Genetics, Redwood City. CA).


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
T cell development is impaired in the Cre550I mice, but not in other Cre-transgenic mice
The value of the CRE–LoxP recombination system is that the CRE protein recognizes a 34 bp DNA sequence to catalyze DNA recombination in the absence of any cellular co-factors. Such a sequence would be expected at random in 1018 bp and, since the mouse genome is only 3 x 109 bp, the sequence is unlikely to occur outside the P1 phage genome (40,41). To facilitate sequence-specific recombination, a large number of transgenic mice have been produced that express the CRE recombinase under the control of different tissue-specific regulatory elements (42). None of these mice has been reported to have phenotypic or chromosomal abnormalities implying that there are no target sequences functionally similar to loxP sites in the mouse genome (41). Even when Cre is expressed in gametes (43), there have been no reported mouse abnormalities.

In the course of making transgenic mice expressing Cre under the control of the thymocyte-specific p56lck promoter (p1017) (44,45), we found that one founder line, Cre550I, showed a deficiency in CD8 thymocytes. There were no other noticeable phenotypic changes. The mice are healthy, have normal litters and the transgenic locus is transmitted at the Mendelian frequency. Using real-time PCR, the level of Cre expression in Cre550I mice was compared with that of other lines routinely used for T cell-specific loxP recombination (46,47). We found that the level of expression in Cre550I mice was only slightly higher than that of Cre540 and Cre548 lines that do not exhibit this phenotype (Fig. 1). The level is about 3 times higher than the lck–Cre mice produced by Lee et al. (47). Even though the level was lower in the Cre550I heterozygote mice than in one of the Cre548+/– mice, these Cre550I+/– mice still exhibit a distinct phenotype. Based on this observation and the vast experience of investigators who have found no phenotypic changes caused by Cre expressed in a wide variety of tissues, we concluded that the defect in Cre550I mice did not arise from the expression of CRE in early T cell development. A caveat is that Cre expression has been shown to cause growth inhibition and DNA damage in mammalian cells (48,49). We cannot rule out the possibility that Cre expression above a certain threshold and at a particular stage of development could impact subsequent T cell subsets.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 1. Thymuses from different mice were analyzed for the level of Cre mRNA using real-time PCR (see Methods). The ratio of the signal from the Cre primers to the signal from GAPDH primers was graphed for each sample.

 
The thymuses from Cre550I mice are reduced in size and contain an average of 2- to 6-fold fewer cells than the controls (Table 1). The transgenic hemizygous mice display a phenotype that is intermediate between wild-type and transgenic homozygotes. The number of T cells in peripheral lymphoid organs was also reduced 2- to 10-fold in the Cre550I mice as shown in the LN and the spleen. As depicted by the examples shown in Fig. 2(A), the percentage of single-positive (SP) CD4 and CD8 T cells in the thymus was reduced, with a preferential defect in mature CD8 thymocytes (an average of 1.2-fold for the CD4 subset and 1.9-fold for the CD8 subset). This observation was further confirmed by the results obtained in the peripheral organs. Although both CD4 and CD8 T cells were reduced, the decrease in the number of CD8 T cells was always more profound. CD8 T cells were reduced up to 90% in the LN and in the spleen. The number of total cells found in the spleen was variable and could in rare instances be equal to or higher than the number found in control organs; however, the proportion of T cells was always reduced. In contrast, the percentage of DN CD4 CD8 cells present in the thymus was increased (2–6 times), although the proportions of the different DN subsets as characterized by CD44 and CD25 expression were found to be normal (Fig. 2B).


View this table:
[in this window]
[in a new window]
 
Table 1. Total number of cells per organ in Cre550I transgenic mice
 


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 2. The T cell subsets in wild-type, hemizygous and homozygous Cre550I transgenic mice. (A) Cell suspensions from thymus, LN and spleen were stained for CD4 and CD8. The numbers indicate the percentage of cells falling into each quadrant. (B) Thymocytes were negatively gated for CD4, CD8 and CD3, and analyzed for the remaining populations that fell into the four subsets of early thymocyte development based on CD25 and CD44 expression.

 
An analysis of T cell subsets expressing the {alpha}ß and {gamma}{delta} TCR showed that there was a substantial disruption of the normal proportions. Whereas there are generally few detectable {gamma}{delta}+ T cells in the thymic CD4 and CD8 subsets, the Cre550I mice showed significant percentages in both the thymus and peripheral lymphoid organs (Fig. 3A). The CD4 T cells expressing the {gamma}{delta} TCR represent an especially rare subset that is never detected in adult wild-type mice (50). In addition, the proportion of {gamma}{delta} T cells in the DN population was enhanced in the example shown from 8.6 to 35%. A compilation of data shows that, even though the total number of thymocytes is reduced in Cre550I mice, the {gamma}{delta} T cell subset in the thymus is increased in absolute number (Fig. 3B). These {gamma}{delta}+ T cells were able to exit the thymus and were found in the LN and the spleen. Within the CD4+ T cell population in the LN, we found that 3–5% of cells expressed the {gamma}{delta} TCR. The few CD8 T cells present in the LN expressed both CD8{alpha} and CD8ß (not shown), and predominantly consisted of {gamma}{delta} T cells in most mice—up to 70% of the CD8 T cells in the LN expressed the {gamma}{delta} TCR (Fig. 3A). In transgenic hemizygous Cre550I mice, {gamma}{delta}+ T cells were found among the same subsets, but their percentage was lower than that found in transgenic homozygous mice. These observations indicate that {alpha}ß T cell development is either abated or misdirected such that the cells can productively rearrange and express a {gamma}{delta} TCR.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3. The expression of the {gamma}{delta} TCR on T cell subsets. (A) Lymphocytes from thymus and LN were gated for the expression of CD4+CD8 (CD4), CD4CD8+ (CD8) or CD4CD8 (DN) and analyzed for the expression of the {gamma}{delta} TCR. (B) The total number of {gamma}{delta} TCR+ thymocytes was plotted for wild-type and Cre550I mice.

 
We wished to determine whether the defect in T cell development noted above was intrinsic to the T cells or depended upon the environment of maturation. Bone marrow from Cre550I or wild-type mice was used to repopulate irradiated B6.PL mice. The T cells from B6.PL mice express the Thy-1.1 allele, whereas the C57BL/6 mice and Cre550I mice express Thy-1.2. In this way donor and recipient T cells could be distinguished. Analysis of the chimeras at 6 weeks indicated that CD8 cells originating from Cre550I bone marrow were deficient in the LN (Fig. 4). Within the CD8 T cell population present in the Cre550I+/+ reconstituted mice, but not wild-type reconstituted mice, there was a substantial proportion of cells that were {gamma}{delta} T cells. Thus, the defect appears to be intrinsic, at least in part, to the developing T cells.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. Development of T cells from Cre550I mice in radia tion chimeras. Bone marrow cells from Cre550I–/– (wild-type) or Cre550I+/+ mice were used to reconstitute B10.PL mice radiated at 950R. (A) At 6 weeks of age the mice were sacrificed and analyzed for the proportion of total T cells in the LN (solid squares, bone marrow from Cre550I+/+ mice; open squares, bone marrow from Cre550I–/– mice). (B) The proportions of CD4+CD8 (CD4), CD4CD8+ (CD8) or CD4CD8 (DN) T cells in LN. (C) The proportions of {gamma}{delta} T cells in the total CD8 T cell population.

 
T cells expressing both {alpha}ß and {gamma}{delta} TCR are found in the Cre550I mice
If the {alpha}ß versus {gamma}{delta} T cell fate decision is disregulated, then we reasoned that T cells might lack the controls that prevent the co-expression of {alpha}ß and {gamma}{delta} TCR. One mechanism preventing co-expression is the location of the {delta} chain locus within the {alpha} chain locus. V–J rearrangements in the {alpha} chain locus normally occur on both chromosomes and these rearrangements cause the inversion or deletion of the {delta} chain gene elements (51). However, studies show that the TCR {delta} chain sequences are retained in thymocytes and T cells in large amounts—60–70% of the signal seen in germline DNA. These sequences most likely exist as extrachromosomal circular DNA, although their transcriptional activity is unknown (52). In addition, a small percentage of T cells only rearrange one {alpha} chain locus, leaving the {delta} chain of the second chromosome intact. In such cells there is a possibility for dual expression of {alpha}ß and {gamma}{delta} TCR.

In order to investigate this issue, we carried out flow cytometry to detect LN T cells bearing both receptors. Live cells were gated by forward and side scatter as well as by staining with 7-AAD to gate out apoptotic cells that can non-specifically bind antibodies. These cells were further gated for TCR ß chain and CD8 expression. The positive cells were then analyzed for TCR {delta} chain expression. As expected, no cells expressing both TCR chains were detected in the control littermates (Fig. 5A and B). In T cells from Cre550I+/+ mice, the results showed that an average of 1–2% of the CD8+ß+ cells also express the {delta} chain. In addition, among the CD4+ ß+ LN T cells, an average of 0.5% of the cells stained positively with the anti-{delta} chain antibody. These dual expressing cells expressed high levels of the {delta} chain. No double-TCR-expressing cells could be detected among the CD4 CD8 LN cells. Another way to eliminate cells that non-specifically bind antibodies is to stain with an irrelevant antibody, and gate out positively stained cells. In order to accomplish this, viable cells were negatively gated for a B220 staining (Fig. 5C) and the same results were obtained. Finally, an isotype-specific control was found not to stain and provided a further indication that the anti-{delta} chain staining was specific (Fig. 5D).



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 5. A population of lymphocytes in Cre550I mice co-expresses the {alpha}ß and {gamma}{delta} TCR. Cells from the LN were gated as indicated in the left column and then analyzed for the expression of the TCR chains as indicated (see Methods for details). TCR {alpha} chain staining consisted of antibodies specific for V{alpha}2, V{alpha}8 and V{alpha}11. TCR co-expressing cells were not found in CD4 CD8 LN cells. (A, B, C and D) Comparison of the percentages in wild-type and Cre550I+/+ mice. (E and F) Cre550I+/+ mice were analyzed for TCR {alpha}, ß, {delta} and {gamma} chains expression.

 
We wanted to determine whether all four TCR chains were expressed on these ß+ {delta}+ cells or whether these cells were expressing abnormal TCR heterodimers (53). To this end, we used antibodies recognizing the constant region of the TCR ß chain and a pool of antibodies specific for different V{alpha} regions (V{alpha}2, V{alpha}11 and V{alpha}8). Cells that non-specifically took up antibodies were excluded by staining with either anti-B220 or 7-AAD (not shown). It has been reported that some V{alpha} genes, particularly the ones proximal to the V{delta} region, can be used indifferently as part of a functional {alpha} or {delta} chain (54,55). For this reason, we controlled in each experiment by examining CD4CD8 {delta}+ ß cells. In this population, no V{alpha} expression was detected indicating that these V{alpha} genes are rarely if ever expressed as part of a {gamma}{delta} TCR. The results shown in Fig. 5(E) indicate that TCR {delta} and {alpha} chains were co-expressed on CD8+ cells from Cre550I mice. This analysis was also carried out on the CD4+ T cells with similar results. In addition, to demonstrate the presence of the {gamma} chain on the cell surface, we used an antibody recognizing the V{gamma}2 region that is predominantly used in {gamma}{delta}+ T cells from adult mice. The results presented in Fig. 5(F) show that we could identify a subset of CD8+ T cells that express ß and {gamma} chains on the same cell. An implication of these results is that in the Cre550I mice, a small subset of cells expressing both {alpha}ß and {gamma}{delta} TCR differentiate and survive; however, in repeated attempts, the T cells expressing both {alpha}ß and {gamma}{delta} TCR exhibited a diminished capacity to grow in culture, and they do not appear to form T cell hybridomas. The combination of a small starting percentage and an inability of the double receptor-bearing cells to expand prevented us from characterizing them further. Of course it is also possible that the abnormal co-expression of {alpha}ß and {gamma}{delta} receptors occurs only in cells that have not undergone cell division since the {delta} chain genes could be located on extrachromosomal circles. In this case, as soon as the cells divide, the extrachromosomal {delta} chain gene would be lost by dilution. Either way, co-expression of {alpha}ß and {gamma}{delta} receptors does not normally occur, and the presence of such double-expressing cells is indicative of disregulated lineage commitment.

In-frame {delta} and {gamma} rearrangements are not negatively selected in the {alpha}ß+ LN T cells
The observation has been made that within the {alpha}ß T cell population there is a selection against productively rearranged {gamma} or {delta} chain genes. As discussed below, there are two interpretations of this result, but in any event it reflects regulation that prevents a single cell from expressing both the {gamma}{delta} and {alpha}ß receptor. If the regulation only selects against {alpha}ß T cells that express both a productively rearranged {gamma} and {delta} chain, then the predicted frequency of in-frame rearrangements within the {delta} chain locus should be ~20% (23,24). This is exactly what was found experimentally, at least in the {delta} chain locus and some of the {gamma} chain loci (2325). In order to determine whether Cre550I mice lack the regulation that selects against productive {gamma} and {delta} chain rearrangements in {alpha}ß T cells, we set up experiments to amplify rearranged sequences in {alpha}ß+{gamma}{delta} T cells and determine the percentage of in-frame versus out-of-frame rearrangements by cloning and sequencing.

For this analysis we focused on V{gamma}5–J{gamma}1 and V{delta}4–D{delta}–J{delta}1. DNA from purified CD4+ and CD8+ LN {alpha}ß T cells was extracted, and V–J rearrangements amplified by PCR. The products were then cloned and sequenced. Identical sequences were counted only once because in this assay, they could have arisen from the same chromosome. When cells from wild-type mice were analyzed, 20% of the V{gamma}5–J{gamma}1 sequences were in-frame (total 25), as was previously reported (Table 2). However, when cells from Cre550I mice were studied, 30.3% of the V{gamma}5–J{gamma}1 sequences (10 of 33 total) from CD8 {alpha}ß T cells were productive. When V{delta}4–D{delta}–J{delta}1 rearrangements were analyzed, 18% of the sequences from wild-type CD8 {alpha}ß-expressing LN T cells were productive, whereas this percentage was increased to 32% (14 of 44) in CD8 {alpha}ß-expressing T cells from Cre550I mice. A similar result, 29% (10 of 35), was obtained for CD4 {alpha}ß-expressing T cells.


View this table:
[in this window]
[in a new window]
 
Table 2. Proportion of in-frame {gamma}{delta} sequences in {alpha}ß T cells
 
These results show that the selection against the presence of productively rearranged {delta} and {gamma} chain genes in {alpha}ß T cells is missing in Cre550I mice; this is thus consistent with results above indicating that CD4+ and CD8+ T cells in Cre550I mice exhibit a lineage indecision in that they can co-express an {alpha}ß and {gamma}{delta} TCR.

The development and response of T cells from Cre550I–TCR transgenic mice
Although the phenotype of Cre550I mice appears to originate with development in the thymus, we wished to determine the ability of the resulting T cells to survive and proliferate in response to antigen. The LN T cells from transgenic homozygous Cre550I and wild-type mice were stained with Annexin V to reveal apoptotic cells on the basis of surface phosphatidylserine. We found that among freshly isolated CD8+ T cells, the percentage of cells undergoing apoptosis was increased by 2- to 3-fold in the Cre550I mice when compared to control littermates. This is reminiscent of the phenotype of {gamma}{delta} T cells (56,57); however, no significant difference was seen when the CD4+ T cells were studied (data not shown).

We crossed the Cre550I mice to TCR transgenic mice to study both the development of T cells in the presence of rearranged TCR {alpha} and ß chains and the response to an antigen peptide. We bred the Cre550I mice with AND TCR transgenic mice (34) in which selection is MHC class II specific and with OT-1 transgenic mice (35) in which selection is MHC class I specific.

Consistent with the analysis of non-TCR transgenic mice, the thymus size in AND;Cre550I mice was reduced (17 ± 8 versus 52 ± 18 x 106 cells). The proportion of selected CD4SP cells was likewise reduced to an average of 41 from 60% and of this subset, the percentage that was V{alpha}11hi was also reduced (82 versus 89%). The total number of LN cells was reduced to 17 ± 9 versus 29 ± 16 x 106, and again there was a decrease in the proportion that were CD4 T cells (18 versus 39%). The results shown in Fig. 6(A) indicate that the CD4+ T cells from AND+/–;Cre550I+/+ mice exhibited a 2-fold lower proliferative response after stimulation with pigeon cytochrome c peptides when compared with T cells from control littermates. Since the cultures were set up to contain equal numbers of CD4+ T cells, this small decrease appears to reflect a defect in the T cells from AND;Cre550I mice.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 6. The responsiveness of {alpha}ß LN T cells from Cre550I mice. Cells were harvested and cultured as described in the Methods. The genotype of the contributing mice is listed in each panel. The data represent the incorporation of [3H]thymidine for the last 12–16 h of culture. (A) The response of CD4 T cells from AND TCR transgenic mice to pigeon cytochrome c peptide 88–104. (B) The response of CD8 T cells from OT-1 TCR transgenic mice to the OVA peptide SIINFEKL. (C) The mixed lymphocyte response to H-2d allogeneic spleen cells. (D) The response to PMA and ionomycin as a function of PMA concentration.

 
The thymus size in OT-1;Cre550I mice was likewise diminished by more than half compared to OT-1 controls (30 ± 8 versus 77 ± 37 x 106 cells). Otherwise, the proportion of thymocyte subsets was unaffected by the Cre transgene. The CD8SP thymic subset was ~12% and of those, ~95% were V{alpha}2hi. The total LN populations were also reduced in OT-1;Cre550I mice (26 ± 3 versus 38 ± 15 x 106 cells) and the percentage of CD8 T cells was diminished by half (33 versus 65%). Thus, the presence of Cre550I substantially altered development and accumulation of CD8 T cells even in the presence of {alpha}ß TCR transgenes. Using equal numbers of CD8+ LN T cells from OT-1+/–;Cre550I+/+ mice, the proliferative response was 5-fold reduced as compared to Cre550I–/– littermates (Fig. 6B). For CD8 T cells the antigen response in OT-1;Cre550I mice appeared to be highly defective.

The percentage of {gamma}{delta} T cells in the CD8 subset from the thymus and LN was slightly increased from 0.18 (OT-1) to 0.75% (OT-1;Cre550I). There was occasionally a significant {gamma}{delta} population in the non-selected CD4 subsets, but this was extremely variable. The implication is that the transgenic {alpha}ß TCR can override the abnormal production of {gamma}{delta} T cells to some extent, but the Cre550I lesion causes abnormal T cell development even in the presence of rearranged TCR transgenes.

Similar results were found for LN cells from Cre550I mice were stimulated in a mixed lymphocyte reaction (Fig. 6C). The cells responded almost normally to PMA and ionomycin (Fig. 6D), although the small shift in response to PMA does appear to be reproducible.

The genetic basis of the lesion in Cre550I mice
In order to determine the genetic origin of the lesion in Cre550I mice we cloned a region of DNA flanking the transgene insertion. By Southern blotting we found that EcoRV and ScaI cut ~1.4 and 400 bp outside the transgene respectively. The fragments were blunt-end ligated with walking adaptors (see Methods) and amplified with nested primers complementary to the transgene and the adaptor (36). The 400- and 1.4-kb fragments were cloned and sequenced. The sequence of the 400-bp fragment consisted of repetitive line elements and was completely contained within the larger fragment. We found that 1.0 kb of the 1.4-kb sequence was unique and this was used to probe a strain 129 genomic library made in the {lambda} Fix II vector. The 1.0-kb sequence analyzed by a Blast search did not reveal any meaningful similarities. Four overlapping genomic clones spanning ~25 kb were mapped and single-copy probes were identified. Blots using DNA from homozygous, heterozygous and wild-type littermates were consistent with 3.5 copies of the transgene and a large chromosomal deletion that extended beyond 25 kb. Further analysis indicated that the Cre550I mice have a chromosomal deletion of ~500 kb (see below).

Primers were produced corresponding to the flanking deleted region and used to analyze DNA from wild-type, hemizygous and homozygous transgenic mice. In eight backcross generations to C57BL/6 mice there was a perfect concordance between the presence of the transgene, the flanking region deletion and the lymphocyte deficiencies described above. Thus, there appears to be a single insertion/deletion that selectively causes a defect in T cell development and a deficiency in T cell responsiveness.

The primers used above to identify the deleted sequence were found to amplify a single band with a size polymorphism between M. musculus and M. spretus. In order to determine the location of the chromosomal deletion, the primers were used to determine the strain distribution in the Jackson BSS interspecies-specific backcross panel (Fig. 7A). The distribution places the gene within a chromosome 10 location 26 cM from the centromere that includes D10Wsu179e, D10Bwg0791e and D10Xrf13 ESTs. We note that two of the closely mapping ESTs are known. D10Wsu179e is likely the mouse equivalent of histone deacetylase 2 and D10Xrf13 is the mouse homologue of the Saccharomyces cerevisiae suppressor of Ty 4 SUPT4H1 transcription factor. Other genes mapping to this chromosomal region include: CD24a (heat stable antigen) and two pseudogenes, Rpp2-rs1 (ribosomal protein P2-related sequence 1) and Tpi-rs6 (triosephosphate isomerase-related sequence 6).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 7. Mapping the Cre550I insertion/deletion point. (A) DNA from the BSS backcross panel was typed for M. musculus and M. spretus alleles by PCR. The strain distribution is shown at the top. This pattern shows the same distribution as the ESTs shown in bold, and there is a crossover between these and the flanking ESTs. The approximate location of these markers and other genes is illustrated in the bottom panel. (B) FISH positioning of the deleted region on chromosome 10.

 
In order to confirm the mapping data, the locus of transgene insertion was mapped by FISH. A probe from the transgenic vector including sequences from Cre (p1-6BR3) was biotinylated with dATP and the procedure for FISH was performed by SeeDNA Biotech, according to Heng et al. (38). The detection efficiency was 85 of 100 chromosomal spreads. The specific chromosomes were identified by DAPI staining. Based on a summary of 10 images, an unequivocal location was identified at chromosome 10 position A3–B1 (Fig. 7B). No other signal was found. Thus the cytogenetics correlated perfectly with the species-specific hybrid analysis performed using a probe detecting the cloned flanking region. Since the flanking region and the transgene map together, we conclude that the lesion in Cre550I mice maps to a specific region of chromosome 10.

To find the genes that map in the locus surrounding the region of insertion, we analyzed the genes present in the mouse Celera database and the human syntenic region of the Celera and public databases (Table 3). A blast analysis using the unique flanking sequence scored a unique hit at chromosome 10A4 which is within the interval 10A3–10A4–10B1, precisely where the FISH experiment mapped the transgene insert (Fig. 8). The deletion was delineated by unique flanking sequences, and the position of these borders on the sequence scaffold showed that the deletion spanned ~500,000 bp. The database was queried for genes present within the 4 Mb from chromosome 10 24–30 Mb and the known cellular genes were mapped (Fig. 8A). This region is located between c-fyn and fyn-like kinase Frk genes. The sequence corresponding to the deletion is a particularly desolate region of the genome containing no recognizable genes. The right border is ~300,000 bp from Hdac2, which corresponds to D10Wsu179e found to be linked to the insertion in the interspecies hybrid mapping experiment (Fig. 7). The region of interest is thus placed within this 1.5-Mb interval based on three lines of evidence: species-specific hybrid analysis, FISH and homology to sequences located in the mouse genome database. All known cellular genes are positioned on the 4-Mb segment and, in addition, all of the predicted genes are shown for the 1.5-Mb segment surrounding and including the insertion/deletion. The syntenic region in the human genome was also analyzed between chromosome 6; 113–115 Mb (Fig. 8B). We note that the 40s ribosomal protein, heparan sulfate D-glucosaminyl 3-O-sulfotransferase 1, histone deacetylase2 and myristoylated protein kinase C substrate were all found for both the mouse and human genomes. The only other cellular gene detected within the human chromosomal region is related to DNAJ, a chaperone. We tested for changes in expression of Hdac2 and Macs, and found no difference in Cre550I mice as measured by semi-quantitative RT-PCR (data not shown).


View this table:
[in this window]
[in a new window]
 
Table 3. Genes found within chromosome 10; 26.5–28 Mb
 


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 8. The genomic organization of the Cre550I transgene insertion/deletion point. (A) The mouse genomic region was mapped by a BLAST search using the sequences found to be surrounding the Cre550I deletion. The 4-Mb region was queried for known genes and the surrounding 1.5-Mb region was analyzed for all predicted genes. (B) The syntenic human genomic region was mapped for known cellular genes. Similar to the mouse genome, the region is flanked by c-fyn (112.073–112.206) and Frk (116.345–116.464). Frk, fyn-related kinase; coll{alpha}, collagen {alpha} chain; cp5'n, cytosolic purine 5'-nucleotidase-related; tspY, testis-specific protein Y; cell div PK, cell division protein kinase; 60sL7A, 60s ribosomal L7A; ST-r, sulfotransferase-related; rac GTPase-act1, rac GTPase-activating protein 1; crbp-r, cellular retinaldehyde-binding protein-related; Amd1, S-adenosylmethionine decarboxylase proenzyme; 40sS8, 40s ribosomal protein S8; HS3St1, heparan sulfate D-glucosaminyl 3-O-sulfotransferase 1; Hdac2, histone deacetylase2; Macs, Myristoylated protein kinase C substrate; Zincf-tf, Zinc-finger transcription factor; lamin{alpha}4, laminin {alpha}4; tubln{epsilon}, tubulin {epsilon} chain; ctgf (WISP-3), connective tissue growth factor (WISP-3); nucleophosmin; tubln{alpha}, tubulin {alpha} chain; Fyn, c-fyn.

 
We were next interested in determining the extent of changes in gene transcription accompanying the Cre550I chromosomal alteration. We reasoned that there must be biologically significant changes in early thymocyte development since the primary defect appears to occur during the {alpha}ß versus {gamma}{delta} lineage commitment step. In mice that are defective for RAG1 or RAG2, thymic development is aborted at the stage of CD25+CD44 TCR ß chain dependent expansion (58,59). Thus, in order to examine gene expression exclusively in this early thymocyte population, mice were crossed and backcrossed to RAG1-deficient mice to produce offspring that were Cre550I+/+;RAG1–/– or Cre550I–/–;RAG1–/–. RNA was pooled from 10 thymuses of each genotype and used to carry out an expression analysis using the Affymetrix Mu11K chip set. Relative expression data normalized for interchip variation was loaded into GeneSpring (Silicon Genetics) and plotted as shown in Fig. 9. Since the plot is a log10 scale, very low expression would not show up. As such, genes expressed at <1 U were set to an insignificant value equal to 1. As shown, there was a substantial number of genes that were differentially expressed in the thymocytes from the two genotypes (Fig. 9A). To get an idea of the number of differentially expressed genes, we arbitrarily set a cut-off and plotted only those genes that were either 4-fold over-expressed or 4-fold under-expressed in Cre550I mice (Fig. 9B and C). The identities of the genes were determined by querying Unigene using the GeneBank accession numbers provided by Affymetrix (Table 4).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 9. Normalized data from the Affymetrix Mu11K gene array were plotted for expression in CD4CD8 thymocytes from Cre550I+/+; RAG-1–/– (CRE550I) and Cre550I–/–;RAG-1–/– (wild-type) mice. (A) All the genes differentially expressed found. (B and C) Genes that are 4 times over-expressed in wild-type (B) or in Cre550I (C) mice.

 

View this table:
[in this window]
[in a new window]
 
Table 4. Genes that were under or overexpressed in Cre550I mice
 
We found that the disruption or disregulation of a single locus alters the transcription of dozens of genes in early thymocytes. As can be seen from the list (Table 4), none of the genes was found in the 4-Mb region of the genome surrounding the transgene insertion/deletion. Of the genes known to map to chromosome 10 around the regions of interest, Blimp1, Sim1, Fyn and CD24 were included in the Mu11K chip set. Blimp1 was identically expressed at a relatively low level (~500 on the scale shown). Sim1 was declared by Affymetrix analysis to be present in Cre550I (357) and absent in wild-type (224), but the difference would not appear to be biologically meaningful. Fyn was similarly expressed (~1100) and CD24 was similarly expressed at high levels (~26,000–29,000). These data indicate that there does not appear to be a large-scale disruption in the 26-cM region of chromosome 10 and none of these genes is responsible for the phenotypes described.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Although much has been learned concerning the timing and progression of early T cell development, little is known about the changes in gene expression that form the basis of alternative lineage differentiation (60). One of the most powerful methods of discovery in developmental biology comes from the identification of mutant animals that exhibit phenotypic changes in the process of interest. Although a genetic screen in mice is extraordinarily resource intensive, occasionally serendipitous mutants arise that can provide important insights. In this study we sought to take advantage of a mutation that appears to result in an {alpha}ß versus {gamma}{delta} lineage indecision.

The primary defect in Cre550I mice appears to be in the elaboration of T cell progenitors into the phenotypically and functionally distinct populations of {alpha}ß and {gamma}{delta} T cells. The thymocytes in Cre550I mice do not fully expand, some do not express the correct co-receptor in concert with their {gamma}{delta} TCR, they are disregulated for the proportion of CD4 and CD8 T cells, and the T cells do not respond to antigen stimulation normally. {gamma}{delta} TCR-expressing T cells were found among CD8 and even CD4 populations, and especially CD4+{gamma}{delta}+ TCR are not detectable in adult wild-type mice (50). We note that CD4+{gamma}{delta}+ T cells, although rare, have been reported in human beings (6163), in mice deficient for pre-T{alpha} or mice expressing a tailless form of pre-T{alpha} (50). The Cre550I mice also possess a population of lymphocytes that expresses both the {alpha}ß and {gamma}{delta} receptors. Such cells have not been previously reported except in TCR transgenic mice (64). Consistent with the notion that the lineage commitment is abnormal, the thymocytes in Cre550I mice do not fully expand and they are disregulated for the proportions of CD4 and CD8 T cells. Finally, the T cells expressing the {alpha}ß TCR in Cre550I mice appear to be defective in response to antigen. This could be a direct result of the genetic lesion or it could arise from a defective differentiation program. In general, {gamma}{delta} lineage T cells respond to antigen, but their response is suboptimal compared with {alpha}ß T cells. They die at a higher rate upon initial stimulation (56,57,65), and in our experience and that of others, they cannot be re-stimulated (66). If the {alpha}ß+ T cells have characteristics of {gamma}{delta} lineage cells, we thus might expect a defective response. In summary, we found that in the Cre550I mice, {alpha}ß+ T cells present functional characteristics of cells from the {gamma}{delta} lineage and {gamma}{delta} T cells present characteristics of cells from the {alpha}ß lineage. We propose that the phenotypically abnormal T cells present in Cre550I mice result from an incomplete differentiation or an incorrect differentiation.

A defect in lineage decision is supported by the results from our TCR rearrangement study. Indeed, one mechanism that regulates {alpha}ß versus {gamma}{delta} lineage commitment appears to be reflected in a selection against {alpha}ß T cells that also contain productively rearranged {gamma} and {delta} chains. As confirmed in this study, the {gamma} and {delta} chain productive rearrangements in the {alpha}ß T cells from wild-type mice are significantly less than the 33% expected at random (2325). While this was originally interpreted to be evidence for the selection of lineages based on productive rearrangements ({gamma}{delta} versus ß), a simpler explanation is that the lineages are predetermined, and productive {gamma} and {delta} chains produce a receptor that signals the exclusion of V–DJ rearrangement in the ß chain locus (19,20). This may be similar to the way that a productive ß chain causes allelic exclusion of the other chromosome and a possibility is that Cre550I lesion affects this signaling pathway. Since thymocytes expressing the {alpha}ß TCR in Cre550I mice do not show such a selection against productive {gamma}{delta} rearrangements, the result is a small population of T cells that express both an {alpha}ß and a {gamma}{delta} TCR. In preliminary studies we have found no evidence for a general lack of allelic exclusion within the ß chain locus (data not shown). In contrast, the {gamma}{delta} lineage does not show a profound exclusion of one receptor by another. In fact, in most studies, {gamma}{delta} T cells from wild-type mice show a proportion of productive ß chain rearrangements that was greater than expected at random, indicating that cells with productive ß chains either expand or they are favored for survival and continued differentiation (6769). We propose that cells that express an {alpha}ß TCR in Cre550I mice do not accomplish a normal lineage commitment, but instead take on characteristics of {gamma}{delta} T cells. As a result, the normal exclusion of the ß chain V–DJ rearrangement by the {gamma}{delta} TCR is missing and the {alpha}ß T cells display a response characteristic similar to {gamma}{delta} T cells. While there are certainly other possibilities, we feel this phenotype is most consistent with a predetermined lineage commitment independent of {gamma}{delta} versus ß chain rearrangements. We propose that lineage commitment is driving the rearrangement and expression of the TCR loci, as opposed to the rearrangement of the TCR loci determining lineage commitment.

Considering the similarity between the phenotype of Cre550I mice and that of mice with a disrupted or tailless pre-T{alpha} gene, we speculate that the Cre550I mice have a defect that impairs signaling downstream of pre-T{alpha}. The deficiency does not appear to be unique to pre-T{alpha} since there is also a paucity of CD8 T cells and a defect in the antigen response of CD8 T cells. The implication is that there is a more general defect in signaling, although the phenotype of Cre550I mice is unlike that of any of the TCR proximal signaling defects reported to date (7072). With a generalized deficiency in TCR-mediated signaling we would expect fewer thymocytes, but also an increase in the proportion of CD8+ thymocytes and decrease in the proportion of CD4+ thymocytes (73,74). Furthermore, generalized signaling defects have not been found to result in T cells expressing both {alpha}ß and {gamma}{delta} TCR.

There are three possible explanations for the phenotypes described in this report. One possibility is that the expression of the CRE recombinase above a threshold level or at a very early stage of thymocyte development is sufficient to cause a substantial and permanent alteration in T cell development. The total levels of Cre expression in Cre550I mice are similar among the four Cre transgenic lines examined and, as such, the levels of Cre expressed in the thymus do not appear to correlate with the strong phenotype noted. Still, it is possible that expression at an early stage or at a very high level in a rare subset could affect T cell development. This remains a possibility and one that is presently difficult to rule out. A second possibility is that there is a gene present in the locus of Cre550I insertion/deletion that does not show up in an analysis of both the Celera mouse and human genome databases. In this region of human chromosome 6, the Celera and public databases are in accord. Furthermore, none of the predicted genes in the region of deletion have identical coding sequence with an EST recorded in any of the human or mouse databases. If we have missed a gene, it must have an unusual structure such as those encoding RNAi. A third possibility is that the region of insertion/deletion may have misregulated gene expression at a very distant locus. We find this to be unlikely since many genes in the vicinity are expressed normally, e.g. Hdac2, Macs, Blimp1, Sim1, Fyn and CD24. As such, we are left with a strong phenotype and the only three genetic explanations seem to be unattractive. If indeed the early expression of Cre is responsible for this defect, the conclusion would be that the {alpha}ß versus {gamma}{delta} lineage commitment is determined or at least influenced prior to receptor rearrangements and the phenotype would be consistent with a TCR rearrangement-independent fate determination. As there is no other mouse mutation identified that disrupts the {alpha}ß versus {gamma}{delta} lineage decision in this manner, the Cre550I strain provides an opportunity to study the program of transcription that influences this important lineage commitment step.


    Acknowledgements
 
We acknowledge the expert assistance of Matthew Hazel and Dr William Wachsman at the UCSD Cancer Center Microarray Shared Resource/VA Gene Chip Core Lab for the gene expression experiments. We thank John Welch, Biomedical Sciences Graduate Program, for invaluable help in using GeneSpring for data analysis. We thank B. J. Fowlkes for a critical review of this manuscript. We thank Dr Craig Hauser, The Burnham Institute, for performing real-time PCR. E. M. was supported by fellowships for the League Against Cancer (France) and the Human Frontier Science Program. This work was supported by RO1-AI21372 and RO1-AI37988 to S. M. H., and PO1-HL57345 to J. D. M.


    Abbreviations
 
7-AAD—7-aminoactinomycin D

APC—antigen-presenting cell

DN—double negative

FISH—fluorescence in situ hybridization

hGH–human growth hormone

LN—lymph node

OVA—ovalbumin

PE—phycoerythrin

PMA—phorbol myristate acetate

SP—single positive


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Hayday, A. C. 2000. {gamma}{delta} Cells: a right time and a right place for a conserved third way of protection. Annu. Rev. Immunol. 18:975.[Web of Science][Medline]
  2. Lanier, L. L., Federspiel, N. A., Ruitenberg, J. J., Phillips, J. H., Allison, J. P., Littman, D. and Weiss, A. 1987. The T cell antigen receptor complex expressed on normal peripheral blood CD4, CD8 T lymphocytes. A CD3-associated disulfide-linked gamma chain heterodimer. J. Exp. Med. 165:1076.[Abstract/Free Full Text]
  3. Lew, A. M., Pardoll, D. M., Maloy, W. L., Fowlkes, B. J., Kruisbeek, A., Cheng, S. F., Germain, R. N., Bluestone, J. A., Schwartz, R. H. and Coligan, J. E. 1986. Characterization of T cell receptor gamma chain expression in a subset of murine thymocytes. Science 234:1401.[Abstract/Free Full Text]
  4. Morita, C. T., Beckman, E. M., Bukowski, J. F., Tanaka, Y., Band, H., Bloom, B. R., Golan, D. E. and Brenner, M. B. 1995. Direct presentation of nonpeptide prenyl pyrophosphate antigens to human gamma delta T cells. Immunity 3:495.[Web of Science][Medline]
  5. Bonneville, M., Ito, K., Krecko, E. G., Itohara, S., Kappes, D., Ishida, I., Kanagawa, O., Janeway, C. A., Murphy, D. B. and Tonegawa, S. 1989. Recognition of a self major histocompatibility complex TL region product by gamma delta T-cell receptors. Proc. Natl Acad. Sci. USA 86:5928.[Abstract/Free Full Text]
  6. Weintraub, B. C., Jackson, M. R. and Hedrick, S. M. 1994. Gamma delta T cells can recognize nonclassical MHC in the absence of conventional antigenic peptides. J. Immunol. 153:3051.[Abstract]
  7. Schild, H., Mavaddat, N., Litzenberger, C., Ehrich, E. W., Davis, M. M., Bluestone, J. A., Matis, L., Draper, R. K. and Chien, Y. H. 1994. The nature of major histocompatibility complex recognition by gamma delta T cells. Cell 76:29.[Web of Science][Medline]
  8. Sciammas, R. and Bluestone, J. A. 1998. HSV-1 glycoprotein I-reactive TCR gamma delta cells directly recognize the peptide backbone in a conformationally dependent manner. J. Immunol. 161:5187.[Abstract/Free Full Text]
  9. Steinle, A., Groh, V. and Spies, T. 1998. Diversification, expression, and gamma delta T cell recognition of evolutionarily distant members of the MIC family of major histocompatibility complex class I-related molecules. Proc. Natl Acad. Sci. USA 95:12510.[Abstract/Free Full Text]
  10. Stingl, G., Koning, F., Yamada, H., Yokoyama, W. M., Tschachler, E., Bluestone, J. A., Steiner, G., Samelson, L. E., Lew, A. M., Coligan, J. E., et al. 1987. Thy-1+ dendritic epidermal cells express T3 antigen and the T-cell receptor gamma chain. Proc. Natl Acad. Sci. USA 84:4586.[Abstract/Free Full Text]
  11. Goodman, T. and Lefrancois, L. 1988. Expression of the gamma-delta T-cell receptor on intestinal CD8+ intraepithelial lymphocytes. Nature 333:855.[Medline]
  12. Shires, J., Theodoridis, E. and Hayday, A. C. 2001. Biological insights into TCRgammadelta+ and TCRalphabeta+ intraepithelial lymphocytes provided by serial analysis of gene expression (SAGE). Immunity 15:419.[Web of Science][Medline]
  13. Aiba, Y. and Ogawa, M. 1997. Development of natural killer cells, B lymphocytes, macrophages, and mast cells from single hematopoietic progenitors in culture of murine fetal liver cells. Blood 90:3923.[Abstract/Free Full Text]
  14. Kawamoto, H., Ohmura, K. and Katsura, Y. 1997. Direct evidence for the commitment of hematopoietic stem cells to T, B and myeloid lineages in murine fetal liver. Int. Immunol. 9:1011.[Abstract/Free Full Text]
  15. Lacaud, G., Carlsson, L. and Keller, G. 1998. Identification of a fetal hematopoietic precursor with B cell, T cell, and macrophage potential. Immunity 9:827.[Web of Science][Medline]
  16. Michie, A. M., Carlyle, J. R., Schmitt, T. M., Ljutic, B., Cho, S. K., Fong, Q. and Zuniga-Pflucker, J. C. 2000. Clonal characterization of a bipotent T cell and NK cell progenitor in the mouse fetal thymus. J. Immunol. 164:1730.[Abstract/Free Full Text]
  17. Winoto, A. and Baltimore, D. 1989. Separate lineages of T cells expressing the alpha beta and gamma delta receptors. Nature 338:430.[Medline]
  18. Dent, A. L., Matis, L. A., Hooshmand, F., Widacki, S. M., Bluestone, J. A. and Hedrick, S. M. 1990. Self-reactive gamma delta T cells are eliminated in the thymus. Nature 343:714.[Medline]
  19. Kersh, G. J., Hooshmand, F. F. and Hedrick, S. M. 1995. Efficient maturation of alpha beta lineage thymocytes to the CD4+CD8+ stage in the absence of TCR-beta rearrangement. J. Immunol. 154:5706.[Abstract]
  20. Livak, F., Wilson, A., MacDonald, H. R. and Schatz, D. G. 1997. Alpha beta lineage-committed thymocytes can be rescued by the gamma delta T cell receptor (TCR) in the absence of TCR beta chain. Eur. J. Immunol. 27:2948.[Web of Science][Medline]
  21. Mertsching, E., Wilson, A., MacDonald, H. R. and Ceredig, R. 1997. T cell receptor alpha gene rearrangement and transcription in adult thymic gamma delta cells. Eur. J. Immunol. 27:389.[Web of Science][Medline]
  22. Petrie, H. T., Scollay, R. and Shortman, K. 1992. Commitment to the T cell receptor-alpha beta or -gamma delta lineages can occur just prior to the onset of CD4 and CD8 expression among immature thymocytes. Eur. J. Immunol. 22:2185.[Web of Science][Medline]
  23. Dudley, E. C., Girardi, M., Owen, M. J. and Hayday, A. C. 1995. Alpha beta and gamma delta T cells can share a late common precursor. Curr. Biol. 5:659.[Web of Science][Medline]
  24. Livak, F., Petrie, H. T., Crispe, I. N. and Schatz, D. G. 1995. In-frame TCR delta gene rearrangements play a critical role in the alpha beta/gamma delta T cell lineage decision. Immunity 2:617.[Web of Science][Medline]
  25. Kang, J., Baker, J. and Raulet, D. H. 1995. Evidence that productive rearrangements of TCR gamma genes influence the commitment of progenitor cells to differentiate into alpha beta or gamma delta T cells. Eur. J. Immunol. 25:2706.[Web of Science][Medline]
  26. Aifantis, I., Azogui, O., Feinberg, J., Saint-Ruf, C., Buer, J. and von Boehmer, H. 1998. On the role of the pre-T cell receptor in alphabeta versus gammadelta T lineage commitment. Immunity 9:649.[Web of Science][Medline]
  27. Fehling, H. J., Krotkova, A., Saint-Ruf, C. and von Boehmer, H. 1995. Crucial role of the pre-T-cell receptor alpha gene in development of alpha beta but not gamma delta T cells. Nature 375:795.[Medline]
  28. Washburn, T., Schweighoffer, E., Gridley, T., Chang, D., Fowlkes, B. J., Cado, D. and Robey, E. 1997. Notch activity influences the alphabeta versus gammadelta T cell lineage decision. Cell 88:833.[Web of Science][Medline]
  29. Jiang, R., Lan, Y., Chapman, H. D., Shawber, C., Norton, C. R., Serreze, D. V., Weinmaster, G. and Gridley, T. 1998. Defects in limb, craniofacial, and thymic development in Jagged2 mutant mice. Genes Dev. 12:1046.[Abstract/Free Full Text]
  30. Kee, B. L., Quong, M. W. and Murre, C. 2000. E2A proteins: essential regulators at multiple stages of B-cell development [In process citation]. Immunol. Rev. 175:138.[Web of Science][Medline]
  31. Blom, B., Heemskerk, M. H., Verschuren, M. C., van Dongen, J. J., Stegmann, A. P., Bakker, A. Q., Couwenberg, F., Res, P. C. and Spits, H. 1999. Disruption of alpha beta but not of gamma delta T cell development by overexpression of the helix-loop-helix protein Id3 in committed T cell progenitors. EMBO J. 18:2793.[Web of Science][Medline]
  32. de Alboran, I. M., O‘Hagan, R. C., Gartner, F., Malynn, B., Davidson, L., Rickert, R., Rajewsky, K., DePinho, R. A. and Alt, F. W. 2001. Analysis of C-MYC function in normal cells via conditional gene-targeted mutation. Immunity 14:45.[Web of Science][Medline]
  33. Chaffin, K. E., Beals, C. R., Wilkie, T. M., Forbush, K. A., Simon, M. I. and Perlmutter, R. M. 1990. Dissection of thymocyte signaling pathways by in vivo expression of pertussis toxin ADP-ribosyltransferase. EMBO J. 9:3821.[Web of Science][Medline]
  34. Kaye, J., Hsu, M. L., Sauron, M. E., Jameson, S. C., Gascoigne, N. R. and Hedrick, S. M. 1989. Selective development of CD4+ T cells in transgenic mice expressing a class II MHC-restricted antigen receptor. Nature 341:746.[Medline]
  35. Hogquist, K. A., Jameson, S. C., Heath, W. R., Howard, J. L., Bevan, M. J. and Carbone, F. R. 1994. T cell receptor antagonist peptides induce positive selection. Cell 76:17.[Web of Science][Medline]
  36. Siebert, P. D., Chenchik, A., Kellogg, D. E., Lukyanov, K. A. and Lukyanov, S. A. 1995. An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res. 23:1087.[Free Full Text]
  37. Higuchi, R., Fockler, C., Dollinger, G. and Watson, R. 1993. Kinetic PCR analysis: real-time monitoring of DNA amplification reactions. Biotechnology 11:1026.[Medline]
  38. Heng, H. H., Squire, J. and Tsui, L. C. 1992. High-resolution mapping of mammalian genes by in situ hybridization to free chromatin. Proc. Natl Acad. Sci. USA 89:9509.[Abstract/Free Full Text]
  39. Heng, H. H. and Tsui, L. C. 1993. Modes of DAPI banding and simultaneous in situ hybridization. Chromosoma 102:325.[Web of Science][Medline]
  40. Marth, J. D. 1996. Recent advances in gene mutagenesis by site-directed recombination. J. Clin. Invest. 97:1999.[Web of Science][Medline]
  41. Nagy, A. 2000. Cre recombinase: the universal reagent for genome tailoring. Genesis 26:99.[Web of Science][Medline]
  42. Nagy, A. and Mar, L. 2001. Creation and use of a Cre recombinase transgenic database. Methods Mol. Biol. 158:95.[Medline]
  43. Lewandoski, M., Wassarman, K. M. and Martin, G. R. 1997. Zp3-cre, a transgenic mouse line for the activation or inactivation of loxP-flanked target genes specifically in the female germ line. Curr. Biol. 7:148.[Web of Science][Medline]
  44. Chaffin, K. E. and Perlmutter, R. M. 1991. A pertussis toxin-sensitive process controls thymocyte emigration. Eur. J. Immunol. 21:2565.[Web of Science][Medline]
  45. Wildin, R. S., Garvin, A. M., Pawar, S., Lewis, D. B., Abraham, K. M., Forbush, K. A., Ziegler, S. F., Allen, J. M. and Perlmutter, R. M. 1991. Developmental regulation of lck gene expression in T lymphocytes. J. Exp. Med. 173:383.[Abstract/Free Full Text]
  46. Priatel, J. J., Chui, D., Hiraoka, N., Simmons, C. J., Richardson, K. B., Page, D. M., Fukuda, M., Varki, N. M. and Marth, J. D. 2000. The ST3Gal-I sialyltransferase controls CD8+ T lymphocyte homeostasis by modulating O-glycan biosynthesis. Immunity 12:273.[Web of Science][Medline]
  47. Lee, P. P., Fitzpatrick, D. R., Beard, C., Jessup, H. K., Lehar, S., Makar, K. W., Perez-Melgosa, M., Sweetser, M. T., Schlissel, M. S., Nguyen, S., Cherry, S. R., Tsai, J. H., Tucker, S. M., Weaver, W. M., Kelso, A., Jaenisch, R. and Wilson, C. B. 2001. A critical role for Dnmt1 and DNA methylation in T cell development, function, and survival. Immunity 15:763.[Web of Science][Medline]
  48. de, A. I. M., O‘Hagan, R. C., Gartner, F., Malynn, B., Davidson, L., Rickert, R., Rajewsky, K., DePinho, R. A. and Alt, F. W. 2001. Analysis of C-MYC function in normal cells via conditional gene-targeted mutation. Immunity 14:45.[Web of Science][Medline]
  49. Loonstra, A., Vooijs, M., Beverloo, H. B., Allak, B. A., van Drunen E., Kanaar, R., Berns, A. and Jonkers, J. 2001. Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells. Proc. Natl Acad. Sci. USA 98:9209.[Abstract/Free Full Text]
  50. Fehling, H. J., Iritani, B. M., Krotkova, A., Forbush, K. A., Laplace, C., Perlmutter, R. M. and von Boehmer, H. 1997. Restoration of thymopoiesis in pT alpha–/– mice by anti-CD3epsilon antibody treatment or with transgenes encoding activated Lck or tailless pT alpha. Immunity 6:703.[Web of Science][Medline]
  51. Malissen, M., Trucy, J., Jouvin-Marche, E., Cazenave, P. A., Scollay, R. and Malissen, B. 1992. Regulation of TCR alpha and beta gene allelic exclusion during T-cell development. Immunol. Today 13:315.[Web of Science][Medline]
  52. Livak, F. and Schatz, D. G. 1996. T-cell receptor alpha locus V(D)J recombination by-products are abundant in thymocytes and mature T cells. Mol. Cell Biol. 16:609.
  53. Hochstenbach, F. and Brenner, M. B. 1989. T-cell receptor delta-chain can substitute for alpha to form a beta delta heterodimer. Nature 340:562.[Medline]
  54. Happ, M. P. and Palmer, E. 1989. Thymocyte development: an analysis of T cell receptor gene expression in 519 newborn thymocyte hybridomas. Eur. J. Immunol. 19:1317.[Web of Science][Medline]
  55. Arden, B., Clark, S. P., Kabelitz, D. and Mak, T. W. 1995. Mouse T-cell receptor variable gene segment families. Immunogenetics 42:501.[Medline]
  56. Viney, J. L. and MacDonald, T. T. 1990. Selective death of T cell receptor gamma/delta+ intraepithelial lymphocytes by apoptosis. Eur. J. Immunol. 20:2809.[Web of Science][Medline]
  57. Janssen, O., Wesselborg, S., Heckl-Ostreicher, B., Pechhold, K., Bender, A., Schondelmaier, S., Moldenhauer, G. and Kabelitz, D. 1991. T cell receptor/CD3-signaling induces death by apoptosis in human T cell receptor gamma delta+ T cells. J. Immunol. 146:35.[Abstract]
  58. Mombaerts, P. 1995. Lymphocyte development and function in T-cell receptor and RAG-1 mutant mice. Int. Rev. Immunol. 13:43.[Medline]
  59. Rothenberg, E. V. 2000. Stepwise specification of lymphocyte developmental lineages. Curr. Opin. Genet. Dev. 10:370.[Web of Science][Medline]
  60. Rothenberg, E. V., Telfer, J. C. and Anderson, M. K. 1999. Transcriptional regulation of lymphocyte lineage commitment. BioEssays 21:726.[Web of Science][Medline]
  61. Vietor, H. and Koning, F. 1990. Gamma delta T-cell receptor repertoire in human peripheral blood and thymus. Immunogenetics 31:340.[Web of Science][Medline]
  62. Kyoizumi, S., Akiyama, M., Hirai, Y. and Kusunoki, Y. 1991. Isolation and characterization of human peripheral blood CD4+ T cell clones expressing gamma delta T cell receptors. Immunol. Lett. 29:197.[Web of Science][Medline]
  63. Spits, H., Paliard, X., Vandekerckhove, Y., van Vlasselaer, P. and de Vries, J. E. 1991. Functional and phenotypic differences between CD4+ and CD4 T cell receptor-gamma delta clones from peripheral blood. J. Immunol. 147:1180.[Abstract]
  64. Bruno, L., Fehling, H. J. and von Boehmer, H. 1996. The alpha beta T cell receptor can replace the gamma delta receptor in the development of gamma delta lineage cells. Immunity 5:343.[Web of Science][Medline]
  65. Kabelitz, D., Pechhold, K., Bender, A., Wesselborg, S., Wesch, D., Friese, K. and Janssen, O. 1991. Activation and activation-driven death of human gamma/delta T cells. Immunol. Rev. 120:71.[Web of Science][Medline]
  66. Spaner, D., Migita, K., Ochi, A., Shannon, J., Miller, R. G., Pereira, P., Tonegawa, S. and Phillips, R. A. 1993. Gamma delta T cells differentiate into a functional but nonproliferative state during a normal immune response. Proc. Natl Acad. Sci. USA 90:8415.[Abstract/Free Full Text]
  67. Dudley, E. C., Petrie, H. T., Shah, L. M., Owen, M. J. and Hayday, A. C. 1994. T cell receptor beta chain gene rearrangement and selection during thymocyte development in adult mice. Immunity 1:83.[Web of Science][Medline]
  68. Mertsching, E. and Ceredig, R. 1996. T cell receptor-gamma, delta-expressing fetal mouse thymocytes are generated without T cell receptor V beta selection. Eur. J. Immunol. 26:804.[Web of Science][Medline]
  69. Burtrum, D. B., Kim, S., Dudley, E. C., Hayday, A. C. and Petrie, H. T. 1996. TCR gene recombination and alpha beta-gamma delta lineage divergence: productive TCR-beta rearrangement is neither exclusive nor preclusive of gamma delta cell development. J. Immunol. 157:4293.[Abstract]
  70. van Oers, N. S. 1999. T cell receptor-mediated signs and signals governing T cell development. Semin. Immunol. 11:227.[Web of Science][Medline]
  71. Zhang, W. and Samelson, L. E. 2000. The role of membrane-associated adaptors in T cell receptor signalling. Semin. Immunol. 12:35.[Web of Science][Medline]
  72. Kane, L. P., Lin, J. and Weiss, A. 2000. Signal transduction by the TCR for antigen. Curr. Opin. Immunol. 12:242.[Web of Science][Medline]
  73. Itano, A., Salmon, P., Kioussis, D., Tolaini, M., Corbella, P. and Robey, E. 1996. The cytoplasmic domain of CD4 promotes the development of CD4 lineage T cells. J. Exp. Med. 183:731.[Abstract/Free Full Text]
  74. Matechak, E. O., Killeen, N., Hedrick, S. M. and Fowlkes, B. J. 1996. MHC class II-specific T cells can develop in the CD8 lineage when CD4 is absent. Immunity 4:337.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
M. Sinkora, J. Sinkorova, Z. Cimburek, and W. Holtmeier
Two Groups of Porcine TCR{gamma}{delta}+ Thymocytes Behave and Diverge Differently
J. Immunol., January 15, 2007; 178(2): 711 - 719.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H. Yang, X. Sun, E. Q. Haxhija, and D. H. Teitelbaum
Intestinal epithelial cell-derived interleukin-7: a mechanism for the alteration of intraepithelial lymphocytes in a mouse model of total parenteral nutrition
Am J Physiol Gastrointest Liver Physiol, January 1, 2007; 292(1): G84 - G91.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (4)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Mertsching, E.
Right arrow Articles by Hedrick, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mertsching, E.
Right arrow Articles by Hedrick, S. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?