Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Corcione, A.
Right arrow Articles by Pistoia, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corcione, A.
Right arrow Articles by Pistoia, V.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 14, No. 8, pp. 883-892, August 2002
© 2002 Japanese Society for Immunology

Chemotaxis of human tonsil B lymphocytes to CC chemokine receptor (CCR) 1, CCR2 and CCR4 ligands is restricted to non-germinal center cells

Anna Corcione1, Giuseppe Tortolina2, Raffaella Bonecchi3, Nicoletta Battilana1, Giuseppe Taborelli4, Fabio Malavasi5, Silvano Sozzani3, Luciano Ottonello2, Franco Dallegri2 and Vito Pistoia1

1 Laboratory of Oncology, G. Gaslini Institute, Largo G. Gaslini 5, 16148 Genova, Italy 2 Department of Internal Medicine, University of Genova, Genova, Italy 3 Department of Immunology, Mario Negri Institute, Milano, Italy 4 Division of Otolaryngology, G. Gaslini Institute, Genova, Italy 5 Department of Genetics, Biology and Biochemistry, University of Torino, Torino, Italy

Correspondence to: A. Corcione; E-mail: annacorcione{at}ospedale-gaslini.ge.it
Transmitting editor: L. Moretta


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
We have investigated the effects of nine CC chemokines, i.e. macrophage inflammatory protein (MIP)-1{alpha}/CCL3, MIP-1ß/CCL4, MIP-3{alpha}/CCL20, MIP-5/CCL15, monocyte chemotactic protein (MCP)-1/CCL2, MCP-2/CCL8, MCP-3/CCL7, eotaxin/CCL11 and macrophage-derived chemokine (MDC)/CCL22 on the locomotion of human tonsil B lymphocytes and their subsets. Upon isolation, B cells were poorly responsive, but, following short-term culture, they displayed statistically significant chemotactic responses (P < 0.001) to MIP-1{alpha}, MIP-5, MCP-1, MCP-2, MCP-3 and MDC. CC chemokine receptor (CCR) 1 to CCR6 were up-regulated after culture. MIP-1ß, MIP-3{alpha} and eotaxin did not stimulate B cell migration. Scattered information is available on B cell subset responses to chemokines. Therefore, we investigated the effects of MIP-1{alpha}, MIP-5, MCP-1, MCP-2, MCP-3 and MDC on the in vitro locomotion of non-germinal center (GC) (CD38) and GC (CD38+) B cells. All chemokines enhanced significantly (P < 0.001) the migration of the former, but not of the latter, cells. CCR1, CCR2 and CCR4 were detected by flow cytometry on non-GC (i.e. naive and memory) B cells, whereas they were absent (CCR1 and CCR2) or poorly expressed (CCR4) on GC B cells.

Keywords: B cell subsets, chemokines, chemokine receptors, locomotion


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
During their life span, T and B lymphocytes continuously re-circulate through different lymphoid and non-lymphoid tissue compartments (1,2). Cell migration depends on the expression of specific adhesion molecules that allow selective cell homing to different anatomical districts and on the delivery of chemotactic signals that trigger cell locomotion (1,2). Furthermore, differences in leukocyte migratory behavior may be related to their stage of maturation and/or functional differentiation (35). The latter concept is well exemplified by the re-circulation pathways of the major mature B lymphocyte subsets (4,5).

Naive B cells migrate from the bone marrow to the peripheral lymphoid organs where, following re-circulation through blood, they encounter specific antigen, undergo clonal expansion and colonize the primary lymphoid follicles (4,5). Here naive B cells differentiate into germinal center (GC) cells which first proliferate, then somatically mutate Ig variable region genes and finally are positively selected according to the affinity of surface Ig for antigen presented by follicular dendritic cells (69).

GC B cells are a resident cell subset with poor propensity to migrate. Following positive selection, GC B cells differentiate into memory or effector cells (plasma cells) outside the lymphoid follicles (69).

Memory B cells home to specific anatomical sites, such as the splenic marginal zone (10) or the tonsil subepithelial criptae (11), where they settle until they interact with specific antigens. Thereafter, the majority of antigen-activated memory B lymphocytes re-circulate (9).

Chemokines represent a group of chemotactic cytokines that mobilize subsets of effector leukocytes during inflammatory reactions or regulate the constitutive homing of B cells and T cells to peripheral lymphoid organs (1217).

The best characterized B cell tropic chemokines are stromal cell derived factor (SDF)-1 (1821), secondary lymphoid tissue chemokine (SLC) (21,22), Epstein–Barr virus gene 1-ligand chemokine (ELC), also known as macrophage inflammatory protein (MIP)-3ß (21,23,24), and B cell-attracting (BCA)-1 chemokine, also known as B lymphocyte chemoattractant (BLC) (21,25,26).

SDF-1 has been reported to be a potent chemoattractant for both normal and malignant human B lymphocytes (1821,27). Furthermore, mice lacking the SDF-1 gene or the gene encoding the SDF-1 receptor, i.e. CXC chemokine receptor (CXCR) 4, show gross defects in B cell development (19,28,29).

The SLC and ELC chemokines, expressed constitutively in the thymus, lymph nodes and other lymphoid tissues, have been shown to regulate lymphocyte homing (22,30). Mice deficient for CC chemokine receptor (CCR) 7, which binds to both SLC and ELC, display a severely impaired migration of B cells to lymph nodes (LN) or Peyer’s patches (PP) (31).

BCA-1, expressed in lymphoid tissues at high levels, strongly attracts B lymphocytes (25,26). BCA-1 selectively binds to CXCR5, that is widely expressed on blood and tonsil B cells (32). Disruption of the CXCR5 gene leads to loss of B cell follicles and GC in the LN and PP, suggesting a crucial role of BCA-1–CXCR5 interactions in B lymphocyte recruitment to secondary lymphoid organs (33).

Recently, it has been shown that thymus-expressed chemokine (TECK) attracts murine pre-pro-B cells and cells capable of generating pro-B colonies in the presence of IL-7 and flt3 ligand, whereas such response is lost in later stages of B cell development (3). In contrast, human peripheral blood B cells displayed low but consistent migratory responses to TECK (21).

Finally, MIP-1{alpha} (34), IL-8 (35), growth-related oncogene (GRO)-{alpha} (35) and monocyte chemoattractant protein (MCP)-1 (36) have been reported to be chemotactic for human peripheral blood B cells and, in the case of MCP-1, also for human tonsil B cells (36).

In this study we have investigated the chemoattractant activity of 9 CC chemokines [MIP-1{alpha}/CCL3, MIP-1ß/CCL4, MIP-3{alpha}/CCL20, MIP-5/CCL15, MCP-1/CCL2, MCP-2/CCL8, MCP-3/CCL7, eotaxin/CCL11 and macrophage derived chemokine (MDC)/CCL22] on human tonsil B lymphocytes, and, in particular, on the GC and non-GC subsets, since limited information exists on the latter issue (37).


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Chemokines and antibodies
MIP-1{alpha}, MIP-1ß, MIP-3{alpha}, MIP-5, MCP-1, MCP-2, MCP-3, MDC and eotaxin were human recombinant molecules purchased from PeproTech (Rocky Hill, NJ). SDF-1, tested as positive control at the final concentration of 300 ng/ml (27), was also from PeproTech.

The following mAb were used: CD19–FITC, CD3–FITC, CD68–phycoerythrin (PE), CD56–PE, CD38–FITC and anti-HLA-DR–FITC (Becton Dickinson Immunocytometry Systems, San Jose, CA). Unconjugated CD3, CD56 and CD68 (Becton Dickinson) were used in cell separation experiments at the final concentration of 1 µg/ml. The CD39–PE mAb was from PharMingen (San Diego, CA). The CD38 mAb was produced by one of us (F. M.) (38). The unconjugated anti-IgD mAb was purchased from Dako (Glostrup, Denmark) and used at the concentration of 1 µg/ml. The unconjugated CD39 mAb was obtained from Immunotech (Marseille, France) and used at the 1 µg/ml concentration.

CCR were detected by staining B cells, either freshly isolated or 4 h cultured, in the absence of stimuli, with the following mAb: anti-CCR1–biotin (clone 53504.111), anti-CCR2-biotin (clone 48607.211), anti-CCR3–PE (clone 61828.111) and anti-CCR6–PE (clone 53103.111) from R & D Systems (Minneapolis, MN). An unconjugated anti-CCR5 mAb (clone 2D7) was from PharMingen. The anti-CCR4 mAb (clone 305L) was kindly donated by Drs Carol Raport and Pat Gray (ICOS, Bothell, WA). A mAb to CCR2 (LS132) was donated by Dr Craig La Rosa (Millennium Pharmaceuticals, Cambridge, MA) and used in blocking experiments at the concentration of 1 µg/ml. Flow cytometric analyses were performed as previously reported (27). Controls for each of the above mAb were isotype-matched mAb of irrelevant specificity conjugated with the same fluorochromes. All of the flow cytometry experiments were performed using a FACScan (Becton Dickinson).

B lymphocyte purification
Normal tonsils were obtained from patients undergoing tonsillectomy for inflammatory disorders. Mononuclear cells were isolated by Ficoll-Hypaque density gradients and depleted of lymphocytes forming rosettes with sheep red blood cells (T lymphocytes). Non-T cells were then incubated with the CD3, CD56 and CD68 mAb, treated with MACS goat anti-mouse IgG microbeads according to the instructions of the manufacturer (Milteny Biotec, Auburn, CA), and separated by applying a magnetic field. Negatively selected cells contained on average 99% B cells, as assessed by staining for CD19 (27).

Fractionation of tonsil B lymphocytes into GC and non-GC cells was performed as follows. Purified B lymphocyte suspensions were incubated first with the CD38 mAb for 30 min at 4°C and subsequently with MACS goat anti-mouse IgG microbeads. CD38+ (GC) and CD38 (non-GC) cells were separated by applying a magnetic field. Naive B lymphocytes were isolated as IgD+ cells from total B lymphocyte suspensions by immunomagnetic bead manipulation. The IgD B cell fractions were further separated into CD38+ (GC) cells and CD38(memory) cells by the same technique (11). All of the above separation procedures were performed at 4°C in order to prevent spontaneous apoptosis of GC B cells.

In some experiments, B lymphocytes were run on a discontinuous Percoll (Pharmacia, Uppsala, Sweden) density gradient consisting of 100, 60, 50, 40 and 30% Percoll dilutions respectively from the bottom to the top of the tubes, as previously reported (6,39). Cells collected from the low-density fractions of the gradient (30 and 40%) were treated with CD39 and anti-IgD mAb, and subsequently with anti-mouse IgG magnetic beads. Unbound B cells represented homogeneous populations (>98%) of GC B lymphocytes, as shown by expression of CD38, and by negative staining for IgD and CD39 (6,39).

Migration assay
Cell locomotion was studied using the leading front method in a modified Boyden chamber assay (27,40). Duplicate tests were carried out in 48-well microchemotaxis chambers (Neuro Probe, Cabin John, MA) with an 8-µm pore size cellulose ester filter (SCWPO 1300, lot. no R4MM58776; Millipore, Milano, Italy) separating the cells (4 x 105) from the chemoattractant tested at different concentrations or from medium alone (control). Cells were cultured 2 h in RPMI 1640 medium (Seromed; Biochrom, Berlin, Germany) containing 0.1% human albumin and subsequently subjected to the migration assay in the presence of the chemoattractant at 37°C for 2 h. The filters were then removed, fixed in ethanol, stained with Harris hematoxylin, dehydrated, cleared with xylene and mounted in Eukitt (Kindler, Freiburg, Germany). Duplicate chambers were run in each case and the distance (micrometers) traveled by the leading front of cells was measured at x400 magnification (40). For blocking experiments, 2-h cultured B cells were incubated for 30 min at 4°C with the anti-CCR2 mAb (1 µg/ml) or with an isotype-matched control mAb, washed and tested for migration.

Checkerboard analysis
Assays of cell migration with different doses of chemokines on both sides of the filter were performed. The results of these experiments were collected in checkerboard form by which chemokinesis (i.e. change in the intensity of random locomotion) and true chemotaxis (i.e. change in the directional response to the stimulus) were calculated according to Zigmond and Hirsch (40).

Gene expression analysis by RT-PCR
Total RNA was extracted from purified tonsil B lymphocytes by the guanidium thiocyanate method (41) and reverse transcribed into complementary DNA using Superscript Preamplification System (Gibco/BRL Life Technologies, San Giuliano Milanese, Italy). Primer sequences were as follows: hCCR1: 5'-GGAAACTCCAAACACCACAGAGG-3' and 5'-GC CTGGCATGGAAGCCAAGATG-3', amplifying a 502-bp product; hCCR2b: 5'-CAGATATCATGCTGTCCACATCTCGTTCT CGG-3' and 5'-CAGGATCCTTATAAACCAGCCGAGACTTC CTGC-3', amplifying a 1082-bp product; hCCR3: 5'-ATATCT GCGGCCGCAATGACAACCTCACTAGATACAGTTG-3' and 5'-TGAATCCTAAAACACAATAGAGAGTTCCGGC-3', amplifying a 1068-bp product; hCCR4: 5'-ATATCTGCGGCCGCAA TGAACCCCACGGATATAGCAGATAC-3' and 5'-ATCGGAT CCTACAGAGCATCATGAAGATCATG-3', amplifying a 1083-bp product; hCCR5: 5' ATATCTGCGGCCGCGATGGATTAT CAAGTGTCAAGTCCAA-3' and 5'-ATC:GGATCCTCACAAG CCCACAGATATTTCCAGC-3', amplifying a 1058-bp product; hCCR6: 5'-ATGAGCGGGGAATCAATGATTTC-3' and 5'-TCA CATAGTGAAGGACGACGCA-3', amplifying a 1124-bp product; CD3{gamma}: 5'-GGTTCGGTACTTCTGACT-3' and 5'-TGGTTTT GACTTGTTCTG-3' amplifying a 171-bp product; CD68: 5'-CATCCAACAAGCAATAGCA-3' and 5'-CTGAGCCGAGAAT GTCCACT-3' amplifying a 507-bp product; CD56: 5'-AGGG CAGATGGGAGAGGA-3' and 5'-AACCACCAGGAGCAGGA C-3' amplifying a 361-bp product; ß-actin: 5'-GGAGCAAT GATCTTGATCTTC-3' and 5'-AAGATGACCCAGATCATGTTT GAG-3' amplifying a 500-bp product.

cDNAs were amplified as follows. hCCR1 to hCCR6 and ß-actin genes: 1 cycle of 5 min at 94°C, 30 cycles of 1 min at 94°C, 1 min at 55, 58 or 60°C (depending on the primer pair) and 1 min at 72°C followed by one cycle of 10 min at 72°C. Amplification conditions for the remaining primers were the following: CD3{gamma}, 1 min at 94°C, 1 min at 48°C, 1 min at 72°C, 32 cycles; CD68, 1 min at 94°C, 1 min at 54°C, 1 min at 72°C, 32 cycles; CD56, 1 min at 94°C, 1 min at 58°C, 1 min at 72°C, 32 cycles. For semiquantitative RT-PCR, cDNAs were co-amplified using different experimental conditions to safeguard against non-linear amplification: 1 cycle of 5 min at 94°C, 25 cycles (ß-actin) and 30 cycles (CCR1, CCR3, CCR5 and CCR6) or 35 cycles (CCR2 and CCR4) of 1 min at 72°C, followed by one cycle of 10 min at 72°C.

The PCR products were subjected to electrophoresis through 1% agarose with ethidium bromide to confirm the base pair sequence length. In control experiments, RNA samples were subjected to PCR amplification omitting the step of reverse transcription. These experiments were addressed at investigating whether genomic DNA possibly contaminating RNA was detected using the primers specified above.

Statistical methods
Data are expressed as mean ± SD. Differences were determined by repeated measures ANOVA followed by the Bonferroni multiple comparisons post test. Differences were accepted as significant when P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Migration of tonsil B lymphocytes in response to CC chemokines
Tonsil B cells were isolated (99% average purity) and tested in a modified Boyden chamber assay for their locomotory responses to a panel of CC chemokines after 2 h culture in the absence of stimuli, as previously reported (Fig. 1). The following chemokines were tested: MIP-1{alpha}/CCL3, MIP-1ß/CCL4, MIP-3{alpha}/CCL20, MIP-5/CCL15, MCP-1/CCL2, MCP-2/CCL8, MCP-3/CCL7, eotaxin/CCL11 and MDC/CCL22, concentrations ranging from 0 to 1000 ng/ml (Fig. 1).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 1. Dose–response curves of purified tonsil B lymphocytes in response to a panel of CC chemokines. Purified B lymphocytes were tested in a modified Boyden chamber assay with or without the following chemokines: MIP-1{alpha}, MIP-1ß, MIP-3{alpha}, MIP-5, MCP-1, MCP-2, MCP-3, MDC, eotaxin and MDC (concentration range from 0 to 1000 ng/ml) or SDF-1 (300 ng/ml), as positive control (27). Results are expressed as micrometers traveled and are means ± SD from four different experiments for each chemokine.

 
A statistically significant (P < 0.001) dose-dependent locomotion to MIP-1{alpha}, MIP-5, MCP-1, MCP-2, MCP-3 and MDC with the typical bell-shaped curve was observed (Fig. 1). MIP-1ß, MIP3{alpha} and eotaxin did not increase the spontaneous motility of tonsil B cells at any concentration tested (Fig. 1). The same cell fractions migrated to SDF-1, tested as positive control (1821,27) (Fig. 1). Based upon these results, the following chemokine concentrations were used for further experiments: 100 ng/ml for MIP-1{alpha}, MIP-5 and MDC; 300 ng/ml for MCP-1, MCP-2 and MCP-3.

To investigate the nature of the CC chemokine-dependent increase in B cell locomotion, the checkerboard analysis was performed. As shown in Table 1, MIP-1{alpha}, MDC, MIP-5, MCP-1, MCP-2 and MCP-3 stimulated both the rate of cell locomotion and the true chemotaxis. In two different experiments, taking into account spontaneous migration (i.e. in the absence of chemokines above and below the filter), the following individual concentrations above and below the filter (chemokinetic conditions) enhanced cell migration as indicated (mean percent increment ± SD): MIP-1{alpha} (100 ng/ml; 33.7 ± 14.8), MDC (100 ng/ml; 31.9 ± 14.1), MIP-5 (100 ng/ml; 21.1 ± 2.1), MCP-1 (300 ng/ml; 17.8 ± 4.2), MCP-2 (300 ng/ml; 56 ± 21.3) and MCP-3 (300 ng/ml; 42.8 ± 1.4).


View this table:
[in this window]
[in a new window]
 
Table 1. Checkerboard assay of purified tonsillar B cells in response to CC chemokines
 
On the other hand, compared with B cell migration in the absence of CC chemokines above and below the filter (i.e. spontaneous migration), the above chemokine concentrations placed only below the filter (chemotactic conditions) augmented cell migration as follows (mean increment ± SD): MIP-1{alpha} (50.5 ± 5.9%), MDC (45 ± 20.5%), MIP-5 (46.7 ± 8.6), MCP-1 (25,5 ± 6.6%), MCP-2 (109.5 ± 20) and MCP-3 (77.9 ± 41.4). On the contrary, cell migration in negative gradients was consistently lower than that calculated on the basis of the expected response to absolute concentrations alone.

In conclusion, MIP-1{alpha}, MDC, MIP-5, MCP-1, MCP-2 and MCP-3 stimulated both true chemotaxis and chemokinesis, the former being predominant over the latter.

CCR expression in tonsil B lymphocytes
The CC chemokines here investigated interact with CCR1 to CCR6 (1217). Therefore, the expression of CCR1 to CCR6 mRNA was investigated in tonsil B lymphocytes by RT-PCR. Figure 2 shows the results obtained in three different experiments. CCR1 to CCR6 transcripts were consistently detected both in B cells and in control cells (i.e. monocytes for CCR1 to CCR5, dendritic cells differentiated from CD34+ hemopoietic progenitors for CCR6).



View larger version (72K):
[in this window]
[in a new window]
 
Fig. 2. CCR gene expression in human tonsil B lymphocytes. Total RNA was extracted from tonsil B cells, reverse transcribed and subjected to RT-PCR by the use of primers specific for CCR1 to CCR6. From the left to the right: negative control in which RT-PCR was performed in the absence of cDNA; three different tonsil B cell samples, indicated as donor 1–3; positive control, represented by human monocytes for CCR1 to CCR5 and by dendritic cells derived from cultured CD34+ progenitor cells for CCR6.

 
Control experiments ruled out that genomic DNA contaminated B cell RNA. Furthermore, the B cell suspensions tested did not express CD3{gamma}, CD56 or CD68 mRNA, thus ruling out the presence of contaminant T cells, NK cells or macrophages respectively (not shown).

Tonsil B cells were found to express CCR1 (7–20%), CCR2 (10–24%), CCR4 (4–35%), CCR5 (7–10%) and CCR6 (20–40%), whereas CCR3 was detected on a minor proportion of cells (3–6%) (data not shown).

Studies carried out with different human leukocyte subsets (T and NK lymphocytes, eosinophils, basophils, monocytes and dendritic cells) have demonstrated that CCR2 binds to MCP-1, MCP-2 and MCP-3 [reviewed in (42)]. However, MCP-2 and MCP-3 may utilize alternative CCR (42). Therefore, the respective contribution of MCP-1, MCP-2 and MCP-3 to the triggering of B cell-associated CCR2 was studied.

Purified tonsil B cells were pre-incubated with an anti-CCR2 blocking mAb or with an isotype-matched irrelevant mAb and were subsequently tested in the modified Boyden chamber assay in the presence of MCP-1, MCP-2 or MCP-3. In three different experiments, blocking of CCR2 inhibited significantly B cell migration in response to MCP-1 (P < 0.001) and to MCP-2 (P < 0.01), but not to MCP-3 (P > 0.05) (Fig. 3).



View larger version (38K):
[in this window]
[in a new window]
 
Fig. 3. Functional role of CCR2 in the MCP-1-, MCP-2- and MCP-3-triggered B cell migration. Purified tonsil B lymphocytes were incubated with an anti-CCR2 blocking mAb or with an isotype-matched irrelevant (control) mAb. Thereafter, cells were tested in a modified Boyden chamber assay in the presence of MCP-1, MCP-2, MCP-3 or medium alone. Results are means from three experiments. Asterisks indicate statistically significant differences in the migration of B cells exposed to chemokines in the presence versus absence of the anti-CCR2 mAb. *P < 0.01; **P < 0.001.

 
Locomotion of tonsil B lymphocyte subsets in response to CC chemokines
Tonsil B lymphocytes are comprised of three major subpopulations which are distinguished according to immunophenotype, anatomic location and functional features (69,43,44). These B cell subsets, named GC, naive and memory cells, are found in the GC, in the follicular mantle and in the subepithelial areas of the tonsil respectively (911,45). The CD38 surface marker allows us to separate GC (CD38+) from non-GC (CD38), i.e. naive and memory, B lymphocytes (6,9,11,43).

In subsequent experiments, purified tonsil B cells were fractionated into the GC and non-GC subpopulations by incubation with CD38 mAb followed by immunomagnetic bead manipulation. These B cell subsets were tested for their migratory responses to MIP-1{alpha}, MIP-5, MCP1, MCP2, MCP3 and MDC, in comparison with unfractionated B cells from the same tonsils. Positive control for the latter cells was SDF-1.

As shown in Fig. 4, non-GC B cells, as well as unfractionated B cells, migrated significantly faster in the presence that in the absence of the above CC chemokines (P < 0.001 for all chemokines). Furthermore, as expected, the same cell fractions displayed a significantly increased locomotion in response to SDF-1 (P < 0.001) (Fig. 4). In contrast, the spontaneous migration of GC B cells was not enhanced by incubation with MIP-1{alpha}, MIP-5, MCP1, MCP2, MCP3 or MDC (Fig. 4).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 4. CC chemokine-driven locomotion of GC and non-GC B lymphocytes. GC and non-GC B cells were isolated from tonsil B cell suspensions by incubation with CD38 mAb followed by immunomagnetic bead manipulation. CD38+ (GC) and CD38(non-GC) B cell subsets were subsequently tested in a modified Boyden chamber assay, together with unfractionated B cells isolated from the same tonsils, in the presence (filled bars) or absence (open bars, nil) of MIP-1{alpha}, MIP-5, MCP-1, MCP-2, MCP-3 or MDC. Positive control for unfractionated B cells was SDF-1 (300 ng/ml). Results are means from five experiments. All chemokines induced a statistically significant increase of the migration of non-GC and unfractionated B cells (P < 0.001).

 
Since GC B cells had been positively selected for CD38, the possibility existed that the in vitro migration of GC B cells was down-regulated by CD38 triggering. To test this hypothesis, GC B lymphocytes were purified using an alternative method based on their enrichment by Percoll density gradients followed by depletion of CD39+, IgD+ B cells (6,39). When tested in the Boyden chamber assay, the latter GC B cell fractions did not migrate upon exposure to any CC chemokine (data not shown), thus confirming the results shown in Fig. 4.

Control experiments ruled out that the failure of GC B lymphocytes to migrate in vitro in response to the above chemokines was related to their propensity to undergo apoptosis (9). Thus, all the separation procedures were conducted at 4°C to prevent spontaneous apoptosis, and freshly isolated GC B cells contained consistently >90% viable lymphocytes, as assessed by Trypan blue staining. An equivalent proportion of viable cells was detected after 2 h incubation for the locomotory assays.

Next, the expression of CCR1 to CCR6 was investigated by flow cytometry on naive (IgD+), GC (CD38+, IgD) and memory (CD38, IgD) B cells isolated by immunomagnetic bead manipulation. Figure 5 shows the results from three experiments. CCR1 and CCR2 were detected on naive (26–45% for CCR1 and 31–40% for CCR2) and memory (28–44% for CCR1 and 16–40% for CCR2) B cells, but not on GC B cells. CCR4 was expressed on the majority of naive (56–70%) and memory (40–73%) B cells, whereas it was found on 6–12% GC B cells (Fig. 5). Naive and memory B cells expressed CCR3 (6–10% for naive B cells and 5–12% for memory B cells) and CCR5 (9–10% for naive B cells and 3–13% for memory B cells), while these receptors were detected on 6–8% of GC B cells for CCR3 and 3–8% of the same cells for CCR5 (Fig. 5). Finally, CCR6 was detected on 18–30% of naive B cells, 20–28% of memory B cells and 2–4% of GC B cells (Fig. 5).



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 5. Flow cytometric analysis of CCR expression on naive, GC and memory B lymphocytes. Purified tonsil B cells were fractionated into the naive (IgD+), GC (CD38+, IgD) and memory (CD38, IgD) cell subsets, and stained with mAb against CCR1 to CCR6. The results of three different experiments are shown. The relative cell number on the ordinate axis is plotted versus the fluorescence intensity (log scale) on the abscissa. Controls were isotype-matched mAb of irrelevant specificity conjugated with the same fluorochromes as test mAb. The percentage of positive cells is shown in the upper right side of each histogram.

 
Since GC B cells had been positively selected, control experiments were carried out to exclude that the failure to detect surface expression of some CCR (e.g. CCR1 and CCR2) was attributable to non-specific down-regulation of such receptors upon cell incubation with the CD38 mAb. Thus, selected CD38+ tonsil B cells were stained with CD19 or with anti-HLA-DR mAb, two pan-B cell markers, following overnight incubation in the absence of stimuli. In four different experiments, all viable cultured cells stained positively for CD19 and HLA-DR (not shown). In the same experiments, expression of CD38 was heterogeneous, ranging from a minimum of 15% to a maximum of 80% (data not shown). These studies demonstrate that positive selection of GC B cells as CD38+ cells did not affect CD19 and HLA-DR expression. In contrast, the results with CD38 staining may be related to the variable kinetics of CD38 surface re-expression after antibody-induced internalization.

The results of flow cytometry experiments shown in Fig. 5 raised the possibility that CCR1 and CCR2 genes were not expressed in GC B cells. Therefore, tonsil B cells were separated into the CD38+ GC and the CD38 naive and memory subsets; these cell fractions were subjected to RNA extraction and semiquantitative RT-PCR for CCR1 to CCR6 gene expression. As shown in Fig. 6, the transcripts of all receptors were detected in both CD38+ and CD38 B cells. The CCR2, CCR3 and CCR4 amplified bands were of comparable intensity in the two cell fractions, whereas CCR1, CCR5 and CCR6 mRNA were more expressed in CD38 than in CD38+ cells (Fig. 6).



View larger version (50K):
[in this window]
[in a new window]
 
Fig. 6. Semiquantitative CCR mRNA expression in CD38+ and CD38 tonsil B cells. Total RNA was extracted from CD38+ and CD38 tonsil B cells, reverse transcribed, and subjected to semiquantitative RT-PCR by co-amplification with primers specific for ß-actin and for CCR1, CCR2, CCR3, CCR4, CCR5 or CCR6. For each transcript, semiquantitative evaluation was obtained by normalization to ß-actin mRNA. Lane (–) no template; lane (+) cDNA plasmid control. One representative experiment out the three performed with similar results is shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In this study, MIP-1{alpha}/CCL3, MIP-5/CCL15, MCP-1/CCL2, MCP-2/CCL8, MCP-3/CCL7 and MDC/CCL22 were found to enhance the in vitro locomotion of tonsil B cells, whereas MIP-1ß/CCL4, MIP-3{alpha}/CCL20 and eotaxin/CCL11 were ineffective (21,46,47). All the biologically active chemokines stimulated B cell locomotion predominantly through a chemotactic effect.

mRNA of CCR1 to CCR6 was detected in purified tonsil B cells and, accordingly, flow cytometric analyses showed the expression of the corresponding proteins on the cell surface.

Some of the CC chemokines tested bind to a single CCR, whereas others share different receptors. For example, MCP-1 binds exclusively to CCR2; this receptor binds also to MCP-2 and MCP-3. Both of the latter chemokines interact with CCR1 and CCR3; furthermore, MCP-2 interacts with CCR5 (42). In this study, treatment of B cells with a CCR2-blocking mAb inhibited significantly B cell migration induced by MCP-1 and MCP-2, but not that triggered by MCP-3. These results indicate that not only MCP-1, but also MCP-2-driven B cell migration largely depends on CCR2 engagement. It is conceivable that MCP-3 interacted predominantly with CCR1 to stimulate B cell motility, since eotaxin, that binds exclusively to CCR3 (42), was ineffective.

The same considerations apply to MIP-5, a ligand of CCR1 and CCR3 (48), that likely enhanced B cell migration by engaging CCR1.

MDC is known to interact exclusively with CCR4 (49). In this study, we provide the first evidence that MDC attracts human B lymphocytes and that CCR4 is abundantly expressed on the surface of freshly isolated B cells. Since MDC is produced in the T cell areas of secondary lymphoid organs, these observations may suggest novel B cell-tropic functions of MDC, in addition to its postulated role in attracting activated T cells and keeping them in close contact with dendritic cells (50).

MIP-1{alpha} binds to CCR5 (5153) and CCR1 (5456); since MIP-1ß, that binds predominantly to CCR5 (5052), did not enhance the locomotion of peripheral blood (46) or tonsil (this study) B cells, it is conceivable that MIP-1{alpha} increased B cell migration through CCR1 activation.

CCR6 binds to MIP-3{alpha} only and vice versa (57). In our experiments, CCR6 was strongly expressed on the surface of tonsil B cells (21,37,47), but its ligand MIP-3{alpha} had no effect on B lymphocyte migration. This result is consistent with some (21,47), but not other (37) reports; notably, in the latter study (37), MIP-3{alpha} was found to attract naive and memory, but not GC, B lymphocytes isolated from human tonsils.

Taken together, our findings suggest that the key receptors involved in tonsil B cell mobilization by MIP-1{alpha}, MIP-5, MCP-1, MCP-2 and MCP-3 are CCR1 and CCR2, while CCR4 binds to MDC only.

A recent study has addressed chemokine responsiveness of murine B cells at all stages of differentiation (3), providing important information on this issue. Some of the chemokines herein investigated were among those tested in such study: MIP-1{alpha}, MIP-1ß, MCP-1 (JE), MCP-3, MIP-3{alpha} and eotaxin (3). MIP-1{alpha}, MIP-1ß, MCP-1 (JE) and MCP-3 were found to attract early progenitor murine B cells, but not peripheral B cells; eotaxin was completely inactive versus any B cell fraction and, finally, MIP-3{alpha} stimulated the locomotion of all peripheral B cell subsets, but not that of bone marrow B cells (3). The results on murine, mature B cells differ remarkably from those obtained in this study with human B lymphocytes. Other discrepancies between the two experimental systems are (i) the failure of freshly isolated human GC B cells to migrate to SDF-1 (18,27), as opposed to their murine counterparts (3), and (ii) the failure of TECK to attract murine (3), but not human (21), mature B lymphocytes. Collectively, these findings raise a note of caution in extrapolating murine data to the human system or vice versa.

Separation of tonsil B lymphocytes in the GC and non-GC subpopulations showed that non-GC cells only were attracted by MIP-1{alpha}, MIP-5, MCP-1, MCP-2, MCP-3 and MDC. Accordingly, CCR1, CCR2 and CCR4 were detected on both naive and memory B cells.

Non-GC B cells re-circulate physiologically through blood, lymph and secondary lymphoid organs (4,5). These cells, freshly isolated from human tonsils, have been shown to migrate in vitro in response to various chemoattractants, such as tumor necrosis factor (57), C5a (58) and SDF-1 (18). The present results are therefore in line with the well-characterized locomotory activity of non-GC B cells, both in vivo (4,5) and in vitro (18,58,59).

In contrast, most GC B lymphocytes are resident cells that complete their life cycle in the GC, where they die by apoptosis (59). The poor propensity of human GC B cells to migrate has been related to the low expression of CD62 ligand (43), that is instrumental for cell interaction with high endothelial venules (60), and of CD44 (43,61). Furthermore, in vitro studies have demonstrated that freshly isolated GC B cells are not attracted by various stimuli (18,58,59,62).

In human GC B cells, two different patterns of chemoattractant receptor expression have been described: (i) GC B cells do not express such receptors at the cell surface, as in the case of TNF or C5a receptors, and therefore are not responsive to their specific ligands (58,59); and (ii) GC B cells express chemoattractant receptors, such as CXCR4 that binds to SDF-1 but does not trigger cell migration due to delayed internalization of the receptor–ligand complex (18).

Consistently with this scheme, staining of GC B cells for CCR1 and CCR2 was negative (although their transcripts were detected in the same cells), whereas CCR3, CCR4, CCR5 and CCR6 were on a minor proportion of cells. Thus, the failure of GC B cells to migrate in response to MIP-1{alpha}, MIP-5, MCP-1, MCP-2 and MCP-3 is related to the absence of the relevant receptors, i.e. CCR1 and CCR2. In contrast, CCR4, although expressed on a minor but sizeable proportion of GC B cells, was ineffective at delivering stimulatory signals to the same cells following interaction with MDC.

In conclusion, this study demonstrates that, in addition to chemokines synthesized constitutively in the secondary lymphoid tissues, inducible chemokines produced at the periphery may also stimulate B cell locomotion. A major functional difference between the two groups of chemokines is that the former regulate B cell homing to lymphoid follicles, whereas the latter mobilize effector cells to sites of inflammation (12).

In pathological conditions, human B lymphocytes may cross the vascular endothelium and migrate to inflamed tissues. For example, in rheumatoid arthritis and Sjögren’s syndrome, B cells infiltrate the synovial membrane or the salivary glands respectively, where they often cluster in newly formed lymphoid follicles (63,64). The present results support the hypothesis that some CC chemokines synthesized on demand at the site of an inflammatory process generate chemotactic gradients that contribute to promote extravasation of B cells, in particular of the memory subset, and their tissue localization. Notably, the B cells themselves can produce certain CC chemokines, such as MIP-1{alpha} (65) and MDC (66), which may amplify B cell recruitment to inflammatory foci through paracrine and/or autocrine interactions.


    Acknowledgements
 
The Authors wish to thank Drs Carol Raport and Pat Gray (ICOS) for the generous gift of the anti-CCR4 mAb, Dr Greg LaRosa (Millenium Pharmaceuticals) for the gift of the anti-CCR2 mAb, and Dr Alberto Mantovani for encouragement and discussion. The authors also acknowledge the excellent secretarial assistance of Mrs Eliana Campochiaro. This work has been supported by grants from Associazione Italiana per la Ricerca sul Cancro and Ministero della Sanità, Progetti di Ricerca Corrente and Progetti di Ricerca Finalizzata 1997 to V. P., and from the University of Genova to F. D.


    Abbreviations
 
BCA—B cell-attracting

BLC—B lymphocyte chemoattractant

CCR—CC chemokine receptor

CXCR—CXC chemokine receptor

ELC—Epstein–Barr virus gene 1-ligand chemokine

GC—germinal center

GRO—growth-related oncogene

LN—lymph node

MCP—monocyte chemoattractant protein

MDC—macrophage-derived chemokine

MIP—macrophage inflammatory protein

PP—Peyer’s patch

SDF—stromal cell derived factor

SLC—secondary lymphoid tissue chemokine

TECK—thymus-expressed chemokine


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Butcher, E. C. and Picker, L. J. 1996. Lymphocyte homing and homeostasis. Science 272:60.[Abstract]
  2. Springer, T. A. 1995. Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annu. Rev. Physiol. 57:827.[Web of Science][Medline]
  3. Bowman, E. P., Campbell, J. J., Soler, D., Dong, Z., Manlongat, N., Picarella, D., Hardy, R. R. and Butcher, E. C. 2000. Developmental switches in chemokine response profiles during B cell differentiation and maturation. J. Exp. Med. 191:1303.[Abstract/Free Full Text]
  4. MacLennan, I. C. and Chan, E. 1993. The dynamic relationships between B-cell populations in adults. Immunol. Today 14:29.[Web of Science][Medline]
  5. Liu, Y. J. and Bancherau, J. 1996. The paths and molecular controls of peripheral B cell development. Immunologist 4:55.
  6. Liu, Y. J., Joshua, D. E., Williams, G. T., Smith, C. A., Gordon, J. and MacLennan, I. C. M. 1989. Mechanisms of antigen-driven selection in germinal centers. Nature 342:929.[Medline]
  7. Berek, C., Berger, A. and Apel, M. 1991. Maturation of immune responses in germinal centers. Cell 67:1121.[Web of Science][Medline]
  8. Leanderson, T., Kallberg, E. and Gray, D. 1992. Expansion, selection and mutation of antigen-specific B cells in germinal centers. Immunol. Rev. 126:47.[Web of Science][Medline]
  9. MacLennan, I. C. 1994. Germinal centers. Annu. Rev. Immunol. 12:117.[Web of Science][Medline]
  10. Liu, Y. J., Oldfield, S. and MacLennan, I. C. 1988. Memory B cells in T cell-dependent antibody responses colonize the splenic marginal zones. Eur. J. Immunol. 18:355.[Web of Science][Medline]
  11. Liu, Y. J., Barthelemy, C., de Buoteiller, O., Arpin, C., Durand, I. and Banchereau, J. 1995. Memory B cells from human tonsils colonize mucosal epithelium and directly present antigen to T cells by rapid up-regulation of B7-1 and B7-2. Immunity 2:239.[Web of Science][Medline]
  12. Baggiolini, M. 1998. Chemokines and leukocyte traffic. Nature 392:565.[Medline]
  13. Cyster, J. G. 1999. Chemokines and cell migration in secondary lymphoid organs. Science 286:2098.[Abstract/Free Full Text]
  14. Kim, C. H. and Broxmeyer, H. E. 1999. Chemokines: signal lamps for trafficking of T and B cells for development and effector function. J. Leuk. Biol. 65:6.[Abstract]
  15. Sallusto, F., Lanzavecchia, A. and Mackay, C. R. 1998. Chemokines and chemokine receptors in T-cell priming and Th1/Th2-mediate responses. Immunol. Today 19:568.[Web of Science][Medline]
  16. Zlotnik, A., Morales, J. and Hedrick, J. A. 1999. Recent advances in chemokines and chemokine receptors. Crit. Rev. Immunol. 19:1.[Web of Science][Medline]
  17. Rollins, B. J. 1997. Chemokines. Blood 90:909.[Free Full Text]
  18. Bleul, C. C., Schultze, J. L. and Springer, T. A. 1998. B lymphocyte chemotaxis regulated in association with microanatomic localization, differentiation state, and B cell receptor engagement. J. Exp. Med. 187:753.[Abstract/Free Full Text]
  19. Ma, Q., Jones, D. and Springer, T. A. 1999. The chemokine receptor CXCR4 is required for the retention of B lineage and granulocytic precursors within the bone marrow microenvironment. Immunity. 10:463.[Web of Science][Medline]
  20. Vicente Manzanares, M., Montoya, M. C., Mellado, M., Frade, J. M., del Pozo, M. A., Nieto, M., de Landazuri, M. O., Martinez-A, C. and Sanchez-Madrid, F. 1998. The chemokine SDF-1{alpha} triggers the chemotactic response and induce cell polarization in human B lymphocytes. Eur. J. Immunol. 28:2197.[Web of Science][Medline]
  21. Brandes, M., Legler, D. F., Spoerri B., Schaerli P. and Moser, B. 2000. Activation-dependent modulation of B lymphocyte migration to chemokines. Int. Immunol. 12:1285.[Abstract/Free Full Text]
  22. Nagira, M., Imai, T., Yoshida, R., Takagi, S., Iwasaki, M., Baba, M., Tabira, Y., Akagi, J., Nomiyama, H. and Yoshie, O. 1998. A lymphocyte-specific CC chemokine, secondary lymphoid tissue chemokine (SLC) is a highly efficient chemoattractant for B cells and activated T cells. Eur. J. Immunol. 28:1516.[Web of Science][Medline]
  23. Ngo, V. N., Tang, H. L. and Cyster, J. G. 1998. Epstein–Barr virus-induced molecule 1 ligand chemokine is expressed by dendritic cells in lymphoid tissues and strongly attracts naive T cells and activated B cells. J. Exp. Med. 188:181.[Abstract/Free Full Text]
  24. Kim, C. H., Pelus, L. M., White, J. R., Applebaum, E., Johanson, K. and Broxmeyer, H. E. 1998. CKß-11 macrophage inflammatory protein-3ß EB1-ligand chemokine is an efficacious chemoattractant for T and B cells. J. Immunol. 160:2418.[Abstract/Free Full Text]
  25. Legler, D. F., Loetscher, R. S., Roos, R. S., Clark-Lewis, I., Biaggiolini, M. and Moser B. 1998. B cell-attracting chemokine 1, a human CXC chemokine expressed in lymphoid tissues, selectively attracts B lymphocytes via BLR1/CXCR5. J. Exp. Med. 187:655.[Abstract/Free Full Text]
  26. Gunn, M. D., Ngo, V. N., Ansel, K. M., Ekland, E. H., Cyster, J. G. and Williams, L. T. 1998. A B-cell-homing chemokine made in lymphoid follicles activates Burkitt’s lymphoma receptor-1. Nature 391:799.[Medline]
  27. Corcione, A., Ottonello, L., Tortolina, G., Facchetti, P., Airoldi, I., Guglielmino, R., Dadati, P., Truini, M., Sozzani, S., Dallegri, F. and Pistoia, V. 2000. Stromal cell-derived factor-1 as a chemoattractant for follicular center lymphoma B cells. J. Natl Cancer Inst. 92:628.[Abstract/Free Full Text]
  28. Nagasawa, T., Hirota, S., Tachibana, K., Takakura, N., Nishikawa, S., Kitamura, Y., Yoshida, N., Kikutani, H. and Kishimoto, T. 1996. Defects of B-cell lymphopoiesis and bone marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 382:635.[Medline]
  29. Ma, Q., Jones, D., Borghesani, P. R., Segal, R. A., Nagasawa, T., Kishimoto, T., Bronson, R. T. and Springer, T. A. 1998. Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4- and SDF-1-deficient mice. Proc. Natl Acad. Sci. USA. 95:9448.[Abstract/Free Full Text]
  30. Gunn, M. D., Tangemann, K., Tam, C., Cyster, J. G., Rosen, S. D. and Williams, L. T. 1998. A chemokine expressed in lymphoid high endothelial venules promotes the adhesion and chemotaxis of naive T lymphocytes. Proc. Natl Acad. Sci. USA 95:258.[Abstract/Free Full Text]
  31. Förster, R., Schubel, A., Breitfeld, D., Kremmer, E., Renner-Muller, I., Wolf, E. and Lipp M. 1999. CCR7 coordinates the primary immune response by establishing functional microenvironments in secondary lymphoid organs. Cell 99:23.[Web of Science][Medline]
  32. Förster, R., Emrich, T., Kremmer, E. and Lipp, M. 1994. Expression of the G-protein-coupled receptor BLR-1 defines mature, recirculating B cells and a subset of T-helper memory cells. Blood 84:830.[Abstract/Free Full Text]
  33. Förster, R., Mattis, A. E., Kremmer, E., Wolf, E., Brem, G. and Lipp, M. 1996. A putative chemokine receptor, BLR-1, directs B cell migration to defined lymphoid organs and specific anatomic compartments of the spleen. Cell 87:1037.[Web of Science][Medline]
  34. Schall, T. J., Bacon, K., Camp, R. D. R., Kaspary, J. W. and Goeddel, D. W. 1993. Human macrophage inflammatory protein {alpha} (MIP-1{alpha}) and MIP-1ß chemokines attract distinct populations of lymphocytes. J. Exp. Med. 177:1821.[Abstract/Free Full Text]
  35. Jinquan, T., Moller, B., Storgaard, M., Mukaida, N., Bonde, J., Grunnet, N., Black, F. T., Larsen, C. G., Matsushima, K. and Thestrup-Pedersen, K. 1997. Chemotaxis and IL-8 receptor expression in B cells from normal and HIV-infected subjects. J. Immunol. 158:475.[Abstract]
  36. Frade, J. M. R., Mellado, M., del Real, G., Gutierrez-Ramos, J. C., Lind, P. and Martinez, C. 1997. Characterization of the CCR2 chemokine receptor: functional CCR receptor expression in B cells. J. Immunol. 159:5576.[Abstract]
  37. Krzysiek, R., Lefevre, E. A., Bernard, J., Foussat, A., Galanaud, P., Louache, F. and Richard, Y. 2000. Regulation of CCR6 chemokine receptor expression and responsiveness to macrophage inflammatory protein-3{alpha}/CCL20 in human B cells. Blood 96:2338.[Abstract/Free Full Text]
  38. Malavasi, F., Caligaris-Cappio, F., Dellabona, P., Richiardi, P. and Carbonara, A. O., 1984. Characterization of a murine monoclonal antibody specific for human early lympho-hemopoietic cells. Hum. Immunol. 9:9.[Web of Science][Medline]
  39. Corcione, A., Baldi, L., Zupo, S., Dono, M., Rinaldi, G. B., Roncella, S., Taborelli, G., Truini, M., Ferrarini, M. and Pistoia, V. 1994. Spontaneous production of granulocyte-macrophage colony-stimulating factor in vitro by human B-lineage lymphocytes is a distinctive marker of germinal center cells. J. Immunol. 153:2868.[Abstract]
  40. Zigmond, S. H. and Hirsch, J. G. 1973. Leukocyte locomotion and chemotaxis. New methods for evaluation, and demonstration of a cell-derived chemotactic factor. J. Exp. Med. 137:387.[Abstract]
  41. Chomczynsky, P. and Sacchi, N. 1987. Single step method of RNA isolation by acid guanidium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162:156.[Web of Science][Medline]
  42. Van Coillie, E., Van Damme, J. and Opdenakker, G. 1999. The MCP/eotaxin subfamily of CC chemokines. Cytokine Growth Factor Rev. 10:61.[Web of Science][Medline]
  43. Lagresle, C., Bella, C. and Defrance, T. 1993. Phenotypic and functional heterogeneity of the IgD B cell compartment: identification of two major tonsillar B cell subsets. Int. Immunol. 5:1259.[Abstract/Free Full Text]
  44. Pascual, V., Liu, Y. J., Magalski, A., de Bouteiller, O., Banchereau, J. and Capra, J. D. 1994. Analysis of somatic mutation in five B cell subsets of human tonsil. J. Exp. Med. 180:329.[Abstract/Free Full Text]
  45. Szakal, A. K. H., Kosko, M. and Tew, J. G. 1989. Microanatomy of lymphoid tissues during humoral immune responses: structure function relationships. Annu. Rev. Immunol. 7:91.[Web of Science][Medline]
  46. Schall, T. J., Bacon, K., Camp, R. D. R., Kaspari, J. W. and Goeddel, D. V. 1993. Human macrophage inflammatory protein-{alpha} (MIP-1{alpha}) and MIP-1ß chemokines attract distinct population of lymphocytes. J. Exp. Med. 77: 1821.
  47. Fang, L., Rabin., R. L., Smith, C. S., Sharma, G., Nutman, T. B. and Farber, J. M. 1999. CC-chemokine receptor 6 is expressed on diverse memory subsets of T cells and determines responsiveness to macrophage inflammatory protein 3{alpha}. J. Immunol. 162:186.[Abstract/Free Full Text]
  48. Coulin, F., Power, C. A., Alouani, S., Peitsch, M. C., Schroeder, J. M., Moshizuki, M., Clark-Lewis I. and Wells, T. N. 1997. Characterisation of macrophage inflammatory protein-5/human CC cytokine-2, a member of the macrophage-inflammatory-protein family of chemokines. Eur. J. Biochem. 248:507.[Web of Science][Medline]
  49. Imai, T., Chantry, D., Raport, C. J., Wood, C. L., Schweickart, V. L., Epp, A., Smith, A., Syine, J. T., Walton, K., Tjoelker, L., Godiska, R. and Gray, P. W. 1998. Macrophage-derived chemokine is a functional ligand for the CC chemokine receptor 4. J. Biol. Chem. 273:1764.[Abstract/Free Full Text]
  50. Melchers, F., Rolink, A. G. and Schaniel, C. 1999. The role of chemokines in regulating cell migration during humoral immune responses. Cell 99:351.[Web of Science][Medline]
  51. Alkhatib, G., Combadiere, C., Broder, C. C., Feng, Y., Kennedy, P. E., Murphy, P. M. and Berger, E. A. 1996. CC CKR5: a RANTES, MIP-1{alpha}, MIP-1ß receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272:1955.[Abstract]
  52. Samson, M., Labbe, O., Mollereau, C., Vassart, G. and Parmentier, M. 1996. Molecular cloning and functional expression of a new human CC-chemokine receptor gene. Biochemistry 35:3362.
  53. Combadiere, C., Ahuja, S. K., Tiffany, H. L. and Murphy, P. M. 1996. Cloning and functional expression of CC CKR5, a human monocyte CC chemokine receptor selective for MIP-1(alpha), MIP-1(beta), and RANTES. J. Leuk. Biol. 60:147.[Abstract]
  54. Gao, J. L., Kuhns, D. B., Tiffany, H. L., McDermott, D., Li, X., Francke, U. and Murphy P. M. 1993. Structure and functional expression of the human macrophage inflammatory protein 1 alpha/RANTES receptor. J. Exp. Med. 177:1421.[Abstract/Free Full Text]
  55. Neote, K., DiGregorio, D., Mak, J. Y., Horuk, R. and Schall, T. J. 1993. Molecular cloning, functional expression and signalling characteristics of a CC chemokine receptor. Cell 72:415.[Web of Science][Medline]
  56. Wu, L., Paxton, W. A., Kassam, N., Ruffing, N., Rottman, J. B., Sullivan, N., Choe, H., Sodroski, J., Newman, W., Koup, R. A. and Mackay, C. R. 1997. CCR5 levels and expression pattern correlate with infectability by macrophage-tropic HIV-1, in vitro. J. Exp. Med. 185:1681.[Abstract/Free Full Text]
  57. Baba, M., Imai, T., Nishimura, M., Kakizaki, M., Takagi, S., Hieshima, K., Nomiyama, H. and Yoshie, O. 1997. Identification of CCR6, the specific receptor for a novel lymphocyte-directed CC chemokine LARC. J. Biol. Chem. 272:14893.[Abstract/Free Full Text]
  58. Corcione, A., Ottonello, L., Tortolina, G., Tasso, P., Ghiotto, F., Airoldi, I., Taborelli, G., Malavasi, F., Dallegri, F. and Pistoia, V. 1997. Recombinant tumor necrosis factor enhances the locomotion of memory and naive B lymphocytes from human tonsils through the selective engagement of the type II receptor. Blood 90:4493.[Abstract/Free Full Text]
  59. Ottonello, L., Corcione, A., Tortolina, G., Airoldi, I., Albesiano, E., Favre, A., D’Agostino, R., Malavasi, F., Pistoia, V. and Dallegri, F. 1999. rC5a directs the in vitro migration of human memory and naive tonsillar B lymphocytes: implications for B cell trafficking in secondary lymphoid tissues. J. Immunol. 162:6510.[Abstract/Free Full Text]
  60. Streeter, P. R., Berg, E. L., Rouse, B. M., Bargatze, R. F. and Butcher, E. C. 1988. A tissue-specific endothelial cell molecule involved in lymphocyte homing. Nature 331:41.[Medline]
  61. Gallatin, W. M., Weissman, I. L. and Butcher E. C. 1983. A cell surface molecule involved in organ-specific homing of lymphocytes. Nature 304:30.[Medline]
  62. Komai-Koma, M. and Willkinson, P. C. 1997. Locomotor properties of human germinal centre B cells: activation by anti-CD40 and IL-4 allows chemoattraction by anti-immunoglobulin. Immunology 90:23.[Web of Science][Medline]
  63. Harris, E. D., Jr. 1990. Rheumatoid arthritis: pathophysiology and implications for therapy. N. Engl. J. Med. 332:1277.
  64. Moutsopoulos, H. M. and Youinou, P. 1991. New developments in Sjögren’s syndrome. Curr. Opin. Rheumatol. 3:815.[Medline]
  65. Krzysiek, R., Lefévre, E. A., Zou, W., Foussat, A., Bernard, J., Portier, A., Galanaud, P. and Richard, Y. 1999. Antigen receptor engagement selectively induces macrophage inflammatory protein-1{alpha} (MIP-1{alpha}) and MIP-1ß chemokine production in human B cells. J. Immunol. 162:4455.[Abstract/Free Full Text]
  66. Schaniel, C. E., Pardali, E., Sallusto, F., Speletas, M., Ruedl, C., Seidl, T., Anderson, J., Melchers, F., Rolink, A. G. and Sideras, P. 1998. Activated murine B lymphocytes and dendritic cells produce a novel CC chemokine which acts selectively on activated T cells. J. Exp. Med. 188:451.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
BloodHome page
C. Calissano, R. N. Damle, G. Hayes, E. J. Murphy, M. K. Hellerstein, C. Moreno, C. Sison, M. S. Kaufman, J. E. Kolitz, S. L. Allen, et al.
In vivo intraclonal and interclonal kinetic heterogeneity in B-cell chronic lymphocytic leukemia
Blood, November 26, 2009; 114(23): 4832 - 4842.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
V. Mayer, K. L. Hudkins, F. Heller, H. Schmid, M. Kretzler, U. Brandt, H.-J. Anders, H. Regele, P. J. Nelson, C. E. Alpers, et al.
Expression of the chemokine receptor CCR1 in human renal allografts
Nephrol. Dial. Transplant., June 1, 2007; 22(6): 1720 - 1729.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Teleshova, J. Kenney, G. Van Nest, J. Marshall, J. D. Lifson, I. Sivin, J. Dufour, R. Bohm, A. Gettie, and M. Robbiani
Local and Systemic Effects of Intranodally Injected CpG-C Immunostimulatory-Oligodeoxyribonucleotides in Macaques
J. Immunol., December 15, 2006; 177(12): 8531 - 8541.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J.-I. Han, N.-N. Huang, D.-U. Kim, and J. H. Kehrl
RGS1 and RGS13 mRNA silencing in a human B lymphoma line enhances responsiveness to chemoattractants and impairs desensitization
J. Leukoc. Biol., June 1, 2006; 79(6): 1357 - 1368.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
N. Teleshova, J. Kenney, V. Williams, G. Van Nest, J. Marshall, J. D. Lifson, I. Sivin, J. Dufour, R. Bohm, A. Gettie, et al.
CpG-C ISS-ODN activation of blood-derived B cells from healthy and chronic immunodeficiency virus-infected macaques
J. Leukoc. Biol., February 1, 2006; 79(2): 257 - 267.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Corcione, F. Benvenuto, E. Ferretti, D. Giunti, V. Cappiello, F. Cazzanti, M. Risso, F. Gualandi, G. L. Mancardi, V. Pistoia, et al.
Human mesenchymal stem cells modulate B-cell functions
Blood, January 1, 2006; 107(1): 367 - 372.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
G. R.A. Ehrhardt, J. T. Hsu, L. Gartland, C.-M. Leu, S. Zhang, R. S. Davis, and M. D. Cooper
Expression of the immunoregulatory molecule FcRH4 defines a distinctive tissue-based population of memory B cells
J. Exp. Med., September 19, 2005; 202(6): 783 - 791.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Flaishon, S. Becker-Herman, G. Hart, Y. Levo, W. A. Kuziel, and I. Shachar
Expression of the chemokine receptor CCR2 on immature B cells negatively regulates their cytoskeletal rearrangement and migration
Blood, August 15, 2004; 104(4): 933 - 941.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Corcione, S. Casazza, E. Ferretti, D. Giunti, E. Zappia, A. Pistorio, C. Gambini, G. L. Mancardi, A. Uccelli, and V. Pistoia
Recapitulation of B cell differentiation in the central nervous system of patients with multiple sclerosis
PNAS, July 27, 2004; 101(30): 11064 - 11069.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. C. Hildebrandt, U. A. Duffner, K. M. Olkiewicz, L. A. Corrion, N. E. Willmarth, D. L. Williams, S. G. Clouthier, C. M. Hogaboam, P. R. Reddy, B. B. Moore, et al.
A critical role for CCR2/MCP-1 interactions in the development of idiopathic pneumonia syndrome after allogeneic bone marrow transplantation
Blood, March 15, 2004; 103(6): 2417 - 2426.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Corcione, N. Arduino, E. Ferretti, L. Raffaghello, S. Roncella, D. Rossi, F. Fedeli, L. Ottonello, L. Trentin, F. Dallegri, et al.
CCL19 and CXCL12 Trigger in Vitro Chemotaxis of Human Mantle Cell Lymphoma B Cells
Clin. Cancer Res., February 1, 2004; 10(3): 964 - 971.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Meissner, O. Zilles, R. Varona, K. Jozefowski, U. Ritter, G. Marquez, R. Hallmann, and H. Korner
CC chemokine ligand 20 partially controls adhesion of naive B cells to activated endothelial cells under shear stress
Blood, October 15, 2003; 102(8): 2724 - 2727.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Corcione, A.
Right arrow Articles by Pistoia, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corcione, A.
Right arrow Articles by Pistoia, V.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?