Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wang, Y.-D.
Right arrow Articles by Zhang, X.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, Y.-D.
Right arrow Articles by Zhang, X.-G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 14, No. 6, pp. 599-603, June 2002
© 2002 Japanese Society for Immunology

gp130-linked signal transduction promotes the differentiation and maturation of dendritic cells

Yue-Dan Wang1, Zong-Jiang Gu1, Jian-An Huang1,1, Yi-Bei Zhu1, Zhao-Hua Zhou1, Wei Xie1, Ying Xu1, Yu-Hua Qiu1 and Xue-Guang Zhang1

1 Department of Immunology, Soochow (Suzhou) University, 48 Renmin Road, Suzhou, China 215007 2 Department of Respiratory Medicine, The First Affiliated Hospital of Soochow University, 96 St. Shizi, Suzhou, China 215006

The first two authors contributed equally to this work
Correspondence to: X. G. Zhang; E-mail: smbxuegz{at}public1.sz.js.cn
Transmitting editor: M. Nussenzweig


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In order to explore the role of gp130-linked signal transduction in the differentiation and maturation of dendritic cells (DC), the mAb, B-S12, an agonist of gp130, was used for the activation of gp130 on DC. The effects of cytokines and of anti-gp130 mAb on the proliferation of DC, and their expression of IL-12 and CD80 (B7-1) by DC were evaluated. DC differentiating from peripheral blood mononuclear cells did not express the IL-6 receptor {alpha} chain, but expressed gp130. Anti-gp130 mAb promoted the proliferation of DC, induced by IL-4 and granulocyte macrophage colony stimulating factor (GM-CSF), by up-regulating the GM-CSF receptor on DC. DC induced by gp130 mAb and cytokines expressed DC-derived CC chemokine, as measured by RT-PCR. Induced DC also stimulated strong proliferation of autologous T cells in mixed lymphocyte reaction since an up-regulated expression of IL-12 and CD80 (B7-1) was observed in DC activated by anti-gp130 mAb. Thus, gp130 signal transduction is important for the differentiation and maturation of DC.

Keywords: cytokines, dendritic cells, gp130 molecule, mAb


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Gp130 is a 130-kDa glycoprotein that mediates the effects of numerous cytokines. The gp130-linked signal transduction chain is shared by several cytokines including IL-6, IL-11, ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), etc. These cytokines have important functions in the regulation of the immune, hematopoietic and nervous systems (1,2). For example, the development of the hematopoietic system in gp130-deficient mice was severely affected (3). Research on the hematopoietic system suggests that gp130-linked signal transduction promotes the functions of other cytokines, such as IL-3, stem cell factor and flt-3 ligand, on hematopoietic stem cells. These cytokines enhance, through gp130, the proliferation and differentiation of stem cells and megakaryocytes, and may promote the maturation of platelets (48).

Dendritic cells (DC) as well as other cells of the immune system also express gp130 and up-regulate its expression during differentiation (9,10). However, the precise role of gp130 in DC proliferation, differentiation and function is still unclear. Here, we used an agonistic anti-gp130 mAb, B-S12 (11), to analyze the expression of gp130 on DC and to stimulate gp130-linked signal transduction in DC. Furthermore, we compared the function of B-S12 with an anti-CD40 agonistic mAb, 5C11 (12). We show that stimulation of the gp130 signaling pathway by B-S12 enhances the secretion of IL-12, the mixed lymphocyte reaction (MLR) of DC with autologous T cells and the expression of DC cell-derived CC chemokine (DC-CK1), indicating a stimulatory role of gp130 signaling as well as CD40 signaling in the differentiation and maturation of DC.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Isolation and culture of cells
Peripheral blood mononuclear cells (PBMC) were isolated by Ficoll-Hypaque (Shanghai Second Chemistry Factory, China) density gradient centrifugation of heparinized blood obtained from healthy adults’ peripheral blood (Suzhou Central Blood Bank). The PBMC were plated in 24-well plates (Corning, Corning, NY) at 3 x 106 cells/ml per well in RPMI 1640 medium supplemented with 10% human AB serum and 2 mmol/l of L-glutamine. After 2 h incubation at 37°C in an atmosphere containing 5% CO2, non-adherent cells were removed, and adherent cells cultured in RPMI 1640 containing human AB serum, 100 ng/ml of recombinant human granulocyte macrophage colony stimulating factor (GM-CSF) (R & D Systems, Minneapolis, MN) and 50 ng /ml of recombinant human IL-4 (R & D). For the stimulation of adherent cells by CD40–CD40 ligand, we used the agonist anti-CD40 mAb, 5C-11 (10 µg/ml; product of our laboratory) (12). To activate the gp130 of DC, agonist anti-gp130 mAb, B-S12, (50 µg/ml), was added to the cultures. A mouse IgG isotype control (50 µg/ml; Immunotech, Marseille, France) was added to the culture instead of B-S12 or 5C11, as a negative control in the groups without mAb. Cultures were fed with fresh, cytokine-containing medium, and cell numbers were counted on every fourth day and their morphology was monitored daily by light microscopy. Autologous T cells were isolated from non-adherent cells by the nylon feather technique. The nylon feather was placed into a 2.5 ml injector and incubated at 37°C with RPMI 1640 containing 5% human AB serum for 10 min. Then 1 ml RPMI 1640 with 5% human AB serum containing 107 non-adherent cells was placed into this injector and cultured at 37°C. After 30 min, T cells were washed out with RPMI 1640 at 37°C and stored at –80°C.

Immunostaining
On day 8, cells were stained with mAb against human CDla, CD14, CD19, CD80, CD83, CD86 (Immunotech), IL-6 receptor (80KD), gp130 (B-S12, from our hybridoma cells), GM-CSF receptor (R & D) and a mouse IgG isotype control (Immunotech), followed by FITC-labeled goat anti-mouse-Ig (Immunotech). Samples were analyzed on a cytometer (XL; Coulter, Beijing, China).

Secretion of IL-12
On day 14, the supernatant was collected and the content of IL-12, p70, was determined by ELISA analysis following manufacturer’s instructions (Immunotech).

MLR
Autologous T cells (105/well) were cultured in 96-well culture plates (Corning) with 2 x 103 DC or monocytes (day 8). [3H]Thymidine incorporation was determined in a ß-counter (Beckman, Beijing, China) on day 4 after 12 h culture in the presence of [3H]thymidine (3.7 x 104 Bq/well; Atomic Energy Institute of China).

RT-PCR
Total RNA was isolated from 106 cells (after 7 days of induction) lysed with TRIZO reagents (Takana, Dalian, China). RT-PCR was performed as described (13,14). Primer sequences were deduced from the published sequences (14). Human DC-CK1: ACAAAGAGCTCTGCTGCCTC (sense), CCCACTTCTTATGGGGTCA (anti-sense); and human ß2-microglobulin: GGGTTTCACCATCCGACAT (sense), GAT GCTGCTTACATGTCTCGA (anti-sense). Each 50 µl PCR reaction mixture contained 1.25 U AmpliTaq DNA polymerase (Sigma, St Louis, MO), 200 µmol/l of each dNTP, and 60 pmol of each oligonucleotide primer for DC-CK1 and 25 pmol for ß2-microglobulin in PCR buffer (Sigma). The reaction was amplified in a DNA thermal cycler (BioRad, Hercules, CA) for 30 cycles (5 min at 94°C pretreatment, 1 min at 60°C annealing for DC-CK1 and 55°C for ß2-microglobulin, 1 min at 72°C synthesis and 30 min at 94°C denaturation.), followed by a 5 min extension at 72°C. RT-PCR products (10 µl) were electrophoresed through a 4% acrylamide gel and stained with ethidium bromide for visualization under ultraviolet light.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Effect of anti-gp130 mAb on the proliferation of DC
The appearance of DC differentiating from adherent PBMC after treatment was the same, irrespective of whether cytokines combined with control mouse Ig or with mAb were employed as inducer. However, after 7 days of culture with the cytokines, the cells exhibited a branching ‘DC-like’ morphology. More DC appeared to be induced by the cytokines in the presence of agonistic anti-gp130 mAb, B-S12, or agonistic anti-CD40 mAb, 5C11, than in their absence. B-S12 alone was unable to affect the proliferation of DC. Furthermore, 5C-11 promoted the effect of B-S12 on the proliferation of DC (Fig. 1).



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 1. The proliferation of DC induced by cytokines with B-S12, 5C11 or control mouse Ig. Monocytes were cultured in medium containing indicated growth factors and antibodies (for details, see Methods). Cells were counted every fourth day.

 
Effect of anti-gp130 mAb on the differentiation of DC
The DC induced from PBMC by cytokines with or without antibodies were mature DC expressing antigens associated with DC differentiation, such as CD1a, CD80 and CD83 (Table 1). They did not express CD19, typical for B cell lines (Table 1). Furthermore, the DC cultured with cytokines did not express the IL-6 receptor-specific {alpha} chain of 80 kDa, but did express gp130 (Fig. 2). Compared to adding control mouse Ig, more GM-CSF receptor+ DC were found when B-S12 was added to the culture system containing GM-CSF and IL-4, while less CD14+ DC were found when 5C11 was added. Both B-S12 and 5C11 could induce an up-regulation of CD83 and CD86 expression on DC, and 5C11 also could induce an up-regulation of CD80 on DC at the same time.


View this table:
[in this window]
[in a new window]
 
Table 1.
 


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2. Expression of gp130 and the IL-6-specific receptor chain gp80 on DC. Monocytes were cultured for 7 days with 100 ng/ml GM-CSF and 50 ng/ml IL-4 with 50 µg/ml B-S12, 5C11 or control mouse Ig. Cells were labeled with the mAb of anti-CD1a, anti-CD80, anti-CD83, anti-gp130 and anti-gp80, followed by FITC-labeled goat anti-mouse Ig. Samples were analyzed by flow cytometry. The shaded part of the figure presents the cells stained by control mouse Ig. (A) DC induced by GM-CSF and IL-4 with control mouse Ig. (B) DC induced by GM-CSF and IL-4 with 50 µg/ml BS-12.

 
Effect of agonistic anti-gp130 mAb on DC function
More IL-12 released by DC was found after culture with B-S12 than in its absence examined by ELISA on day 14. Figure 3 shows the increase in IL-12 secretion in the supernatant of DC induced by cytokines and 50 µg/ml of B-S12 or 10 µg/ml of 5C11. DC induced by cytokines stimulated significantly the proliferation of autologous T cells in a MLR and B-S12 or 5C-11 mAb enhanced this ability of DC (Fig. 4). Moreover, RT-PCR assays showed that the DC induced by B-S12 expressed DC-CK1, a DC chemokine that attracts naive T cells, as well as DC induced by GM-CSF and IL-4 (Fig. 5).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3. IL-12, p70, in supernatant of DC induced by cytokines and mAb. Monocytes were cultured in medium containing different growth factors as described in Methods. On day 14, the supernatant was collected and the secretion of IL-12 was determined by ELISA analysis.

 


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4. MLR of DC and autologous T cells. Monocytes were cultured in medium containing the indicated growth factors and antibodies. DC were then co-incubated with a fixed amount of allogeneic T cells. [3H]Thymidine incorporation was determined in a ß-counter (Beckman) on day 4 after culture for 12 h in the presence of [3H]thymidine. Results are expressed as c.p.m.

 


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5. The expression of DC-CK1 RNA of DC induced by cytokines and agonist anti-gp130 mAb. Monocytes were cultured for 7 days with control mouse Ig (lane A), B-S12 (lane B), GM-CSF + IL-4 + control mouse Ig (lane C), GM-CSF + IL-4 + B-S12 (lane D), GM-CSF + IL-4 + 5C11 (lane E) or GM-CSF + IL-4 + B-S12 + 5C11 (lane F). The expression of DC-CK1 of DC was analyzed by RT-PCR. The expression of ß2-microglobulin was analyzed by RT-PCR at the same time as that of a control.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Gp130 is a 130-kDa glycoprotein that mediates the effects of numerous cytokines, including IL-6, LIF, CNTF and IL-11, etc., thereby playing an important role in the regulation of the immune, nervous and hematopoietic systems. We and other groups reported previously that gp130 is expressed on DC and their progenitors. It is up-regulated upon prolonged culture (9,10).

Both the TNF-{alpha} receptor and CD40, belonging to the same receptor family, are major factors in the signal transduction that mediates the proliferation, differentiation and maturation of DC. While promoting the maturation of DC, they also activate the NF-{kappa}B pathway and subsequently the expression of gp130 (15).

The activation of gp130 up-regulates the expression of the GM-CSF receptor (16). In our experiments, the activation of gp130 by the agonist mAb, B-S12, led to the proliferation of DC in the presence of GM-CSF. The activation of gp130 not only increased the number of DC induced by GM-CSF and IL-4, but also enhanced their ability to stimulate the proliferation of autologous T cells and promoted their IL-12 secretion. In addition, it also induced DC to express the DC-specific chemokine, DC-CK1 (17), which attracts naive T cells specifically.

Our data suggest that the gp130-linked signal transduction pathway is an alternative pathway in the development of DC differing from the CD40–CD40 ligand pathway. In our experiments, the agonistic anti-CD40 mAb, 5C-11, promoted the function of agonistic anti-gp130 mAb, B-S12, in the proliferation, differentiation and function of DC, indicating that the activation of gp130 and CD40 on DC are important for the differentiation and activation of functional DC. Compared with control mouse Ig, both B-S12 and 5C11 induced a higher expression of CD80, CD83 and CD86, and a lower expression of CD14 in DC. The expression of co-stimulatory molecule, CD80 and CD86, was a parameter for indicating the function of DC in initiating immune response, and CD83 presents the maturation of DC during the culture in vitro. However, B-S12 promoted the proliferation of DC through the up-regulation of GM-CSF receptor expression on DC since B-S12 alone could not promote DC proliferation unless GM-CSF was added in culture system (Fig. 1); while CD40 activation induced the maturation of DC by down-regulating the expression of CD14 on DC (Table 1). This observation may have potential for a bio-therapy of certain types of cancer.

Interestingly, DC did not express the IL-6 receptor {alpha} chain when cultured in vitro. In a recent report, it was shown that a fusion protein consisting of IL-6 and IL-6 receptor which activated gp130 promoted the further differentiation of DC, generated from CD34+ hematopoietic cells (18). Other reports showed that IL-6 added to the culture system reduced the CD14CD1a+ DC population in vitro (19,20). This suggests that cytokines other than IL-6 which use the gp130 signal transduction chain, such as IL-11, CNTF or LIF, or yet unidentified cytokines may activate the gp130 signal transduction chain in the proliferation and differentiation of DC.


    Acknowledgements
 
We thank Professor Howard Rickenberg for reading the manuscript and for helpful discussions. This work was supported by the Natural Science Foundation of China (grant nos 39970686, 39625024 and 3987025) and by the Ministry of Education of China (grant no. 97436)


    Abbreviations
 
CNTF—ciliary neurotrophic factor

DC—dendritic cell

DC-CK1—dendritic cell-derived CC chemokine

GM-CSF—granulocyte macrophage colony stimulating factor

LIF—leukemia inhibitory factor

MLR—mixed lymphocyte reaction

PBMC—peripheral blood mononuclear cell

TNF—tumor necrosis factor


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Taga, T. and Kishimoto, T. 1997. gp130 and the interleukine-6 family of cytokines. Annu. Rev. Immunol. 15:797.[ISI][Medline]
  2. Zhang, X. G., Gu, Z. J., Yasukawa,K., Yancopoulous, G. D., Tumer, K., Shoyab, M., Taga, T., Kishimoto, T., Bataille, R. and Klein, B. 1994. Ciliary neurotrophic factor, interleukin 11, leukemia inhibitory factor, and oncostatin M are growth factors for human myeloma cell lines using the interleukin 6 signal transducer gp130. J. Exp. Med. 179:1337.[Abstract/Free Full Text]
  3. Akira, S., Yoshida, K., Tanaka, T., Taga, T. and Kishimoto, T. 1995. Targeted disruption of the IL-6 related genes: gp130 and NF-IL-6. Immunol. Rev. 148:221.[ISI][Medline]
  4. Sui, X., Kohichiro, T., Tajima, S., Tanaka, R., Muraoka, K., Ebihara, Y., Ikebuchi, K., Yasukawa, K., Taga, T., Kishimoto, T. and Nakahata, T. 1996. Erythropoietin-independent erythrocyte production: signals through gp130 and c-kit dramatically promote erythropoiesis from human CD34+ cells. J. Exp. Med. 183:837.[Abstract/Free Full Text]
  5. Ebihara, Y., Tsuji, K., Lyman, S. D., Sui, X., Yoshida, M., Muraoka, K., Yamada, K., Tanaka, R. and Nakahata, T. 1997. Synergistic action of Flt3 and gp130 signalings in human hematopoiesis. Blood 90:4363.[Abstract/Free Full Text]
  6. Kimura, T., Sakabe, H., Tanimukai, S., Abe, T., Urata, Y., Yasukawa, K., Okano, A., Taga, T., Sugiyama, H., Kishimoto, T. and Sonoda, Y. 1997. Simultaneous activation of signals through gp130, c-kit, and interleukin-3 receptor promotes a trilineage blood cell production in the absence of terminally acting lineage-specific factors. Blood 90:4767.[Abstract/Free Full Text]
  7. Sui, X., Tsuji, K., Ebihara, Y., Tanaka, R., Muraoka, K., Yoshida, M., Yamada, K., Yasukawa, K., Taga, T., Kishimoto, T. and Nakahata, T. 1999. Soluble interleukin-6 (IL-6) receptor with IL-6 stimulates megakaryopoiesis from human CD34+ cells through glycoprotein gp130 signaling. Blood 93:2525.[Abstract/Free Full Text]
  8. Kimura, T., Wang, J., Minamiguchi, H., Fujiki, H., Harada, S., Okuda, K., Kaneko, H., Yokota, S., Yasukawa, K., Abe, T. and Sonoda, Y. 2000. Signal through gp130 activated by soluble interleukin (IL)-6 receptor (R) and IL-6 or IL-6R/IL-6 fusion protein enhances ex vivo expansion of human peripheral blood-derived hematopoietic progenitors. Stem Cells 18:444.[Abstract/Free Full Text]
  9. Gu, Z. J., Wang, Y. D., Qiu, Y. H., Zhou, Z. H., Xie, W., Zhu, H. T. and Zhang, X. G. 1999. Study on significant expression of gp130 molecule on dendritic cells. Chin. J. Immunol. 15:196.
  10. Larregina, A. T., Morelli, A. E., Kolkowski, E., Sanjuan, N., Barboza, M. E. and Fainboim, L. 1997. Pattern of cytokine receptors expressed by human dendritic cells migrated from dermal explants. Immunology 91:303.[ISI][Medline]
  11. Gu, Z. J., Vos, J. D., Rebouissou, C., Jourdan, M., Zhang, X. G., Rossi, J. F., Wijdense, J. and Klein, B. 2000. Agonist anti-gp130 transducer monoclonal antibodies are human myeloma cell survival and growth factors. Leukemia 14:188.[ISI][Medline]
  12. Zhou, Z. H., Wang, J. F., Wang, Y. D., Qiu, Y. H., Pan, J. Z., Xie, W., Jiang, L. Y., Klein, B. and Zhang, X. G. 1999. An agonist anti-human CD40 monoclonal antibody that induces dendritic cell formation and maturation and inhibits proliferation of a myeloma cell line. Hybridoma 18:471.[ISI][Medline]
  13. Gu, Z. J., Costes, V., Lu, Z. Y., Zhang, X. G., Pitard, V., Moreau, J. F., Bataille, R., Wijdense, J., Rossi, J. F. and Klein, B. 1996. Interleukin-10 is a growth factor for human myeloma cells by induction of an oncostatin M autocrine loop. Blood 88:3972.[Abstract/Free Full Text]
  14. Brossart, P., Grunebach, F., Stuhler, G., Reichardt, V. L., Mohle, R., Kanz, L. and Brugger, W. 1998. Generation of functional human dendritic cells from adherent peripheral blood monocytes by CD40 ligation in the absence of granulocyte-macrophage colony-stimulating factor. Blood 92:4238.[Abstract/Free Full Text]
  15. Tewari, M. and Dixit, V. M. 1996. Recent advances in tumor necrosis factor and CD40 signaling. Curr. Opin. Genet. Dev. 6:39.[ISI][Medline]
  16. Li, Y., Valeriote, F. and Chen, B. 1996. Regulation of granulocyte-macrophage colony-stimulating factor (GM-CSF) receptors in a GM-CSF-dependent human myeloid leukemia cell line (AML-193) by interleukin-6. Exp Hematol. 24:94.[ISI][Medline]
  17. Adema, G. J., Hartgers, F., Verstraten, E. V., Marland, G., Menon, S., Foster, J., Xu, Y., Nooyen, P., McClanahan, T., Bacon, K. B. and Figdor, C. G.1997. A dendritic-cell-derived C-C chemokine that preferentially attracts naive T cells. Nature 387:713.
  18. Bernharh, H., Lohmann, M., Batten, W. Y., Metzger, J., Lohr, H. F., Peschel, C., Buschenfelde, K. H. M. and Rose-John, S. 2000. The gp130-stimulating designer cytokine hyper-IL-6 promotes the expansion of human hematopoietic progenitor cells capable to differentiate into functional dendritic cells. Exp. Hematol. 28:365.[ISI][Medline]
  19. Mitani, H., Katayama, N., Araki, H., Ohishi, k., Kobayashi, K., Suzuki, H., Nishii, K., Masuya, M., Yasukawa, K., Minami, N and Shiku, H. 2000. Activity of interleukin 6 in the differentiation of monocytes to macrophages and dendritic cells. Br. J. Haematol. 109:288.[ISI][Medline]
  20. Chomarat, P., Banchereau, B., Davoust, J. and Palucka, K. 2000. IL-6 switches the differentiation of monocytes from dendritic cells to macrophages. Nat. Immunol. 1:510.[ISI][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Int ImmunolHome page
L. Wenxin, F. Jinxiang, W. Yong, L. Wenxiang, S. Wenbiao, and Z. Xueguang
Expression of membrane-bound IL-15 by bone marrow fibroblast-like stromal cells in aplastic anemia
Int. Immunol., April 1, 2005; 17(4): 429 - 437.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (3)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wang, Y.-D.
Right arrow Articles by Zhang, X.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, Y.-D.
Right arrow Articles by Zhang, X.-G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?