Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (36)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Takahara, K.
Right arrow Articles by Inaba, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahara, K.
Right arrow Articles by Inaba, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 14, No. 5, pp. 433-444, May 2002
© 2002 Japanese Society for Immunology

Identification and expression of mouse Langerin (CD207) in dendritic cells

Kazuhiko Takahara1, Yoshiki Omatsu1, Yusuke Yashima1, Yasuhiro Maeda1, Shusaku Tanaka1, Tomonori Iyoda2, Bjöern Clusen5, Kazumi Matsubara3, John Letterio6, Ralph M. Steinman7, Yoichi Matsuda4 and Kayo Inaba1

1 Laboratory of Immunobiology, Department of Animal Development and Physiology, Division of Systemic Life Science, Graduate School of Biostudies, and 2 Department of Zoology, Graduate School of Science, Kyoto University, Kyoto 606-8502, Japan 3 Laboratory of Cytogenetics, Division of Bioscience, Graduate School of Environmental Earth Science and 4 Chromosome Research Unit, Faculty of Science, Hokkaido University, Hokkaido 060-08IO, Japan 5 Department of Cell Biology and Histology, Academic Medical Center (AMC), University of Amsterdam, 1105AZ Amsterdam, The Netherlands 6 National Cancer Institute, NIH, Bethesda, MD 20892-5055, USA 7 Laboratory of Cellular Physiology and Immunology, The Rockefeller University, New York, NY 10021-6399, USA

Correspondence to: K. Inaba; E-mail: kayo{at}lif.kyoto-u.ac.jp
Transmitting editor: T. Hirano


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
We have cloned the mouse homologue of human Langerin (h-Langerin), a type II transmembrane protein with a single external C-type lectin domain. Mouse Langerin (m-Langerin) displays 65 and 74% homologies in total amino acid and lectin domains with those of h-Langerin. The cognate mouse and rat genes were assigned to chromosome 6D1–D2 and chromosome 4q33 distal–q34.1 proximal respectively, syntenic to the h-Langerin gene on chromosome 2p13. With RT-PCR, m-Langerin transcripts were as expected detected in MHC class II+, but not MHC class II, cells from epidermis and the expression level was reduced by culture. However, m-Langerin transcripts were also expressed in spleen, lymph nodes (LN), thymus, liver, lung and even heart, but not gut-associated lymphoid tissues. In single-cell lymphoid suspensions, m-Langerin transcripts were mainly detected in the CD11c+ dendritic cells (DC), especially the CD11blow/CD8high fraction of spleen and LN. DC generated from bone marrow precursors by granulocyte macrophage colony stimulating factor (GM-CSF) expressed m-Langerin, but this was shut down during maturation with CD40 ligand or lipopolysaccharide. DC derived from blood monocytes by GM-CSF + IL-4 lacked m-Langerin unless the cultures were supplemented with transforming growth factor (TGF)-ß1. Unexpectedly, significant amounts of m-Langerin transcripts were detected in skin and LN of TGF-ß1-deficient mice, although in much lower amounts than littermate controls. Recombinant m-Langerin could form multimers and bind to mannan–agarose. These findings indicate that Langerin expression is regulated at several levels: by TGF-ß1, DC subsets, DC maturation and the tissue environment.

Keywords: Birbeck granules, C-type lectin, gene mapping, Langerhans cells, multimer, transforming growth factor-ß1


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Dendritic cells (DC) are potent antigen-presenting cells that develop from bone marrow (BM) progenitors (1,2). DC are localized as sentinels in many organs, where they endocytose foreign and self-antigens, and then migrate to secondary lymphoid organs to present antigenic peptides in the context of MHC molecules to specific T cells. A subset of DC, designated Langerhans cells (LC), is located in the epidermis of skin. An important marker to define LC is the racket-shaped cytoplasmic Birbeck granules, which can play a role in endocytosis (3). This organelle is recognized with electron microscopy, although anti-Lag (‘Langerhans-associated granule’) antibody has been established for human LC (4). Recently, a new C-type lectin called Langerin (CD207) has been cloned using the human LC-specific antibody DCGM4. This lectin binds both anti-Lag and DCGM4 mAb but via different epitopes (5,6).

LC also express E-cadherin, presumably for establishing homologous contacts with E-cadherin on keratinocytes (7). Both E-cadherin and Langerin expression depend on transforming growth factor (TGF)-ß1, using cultured monocytes and CD34+ progenitors, and even immature CD11c+ DC in peripheral blood (810). TGF-ß1-deficient mice lack LC but not other DC (11). A low level of E-cadherin expression is detected in a small fraction of lymph nodes (LN) DC, where its reduced expression is ascribed to the maturation of LC during migration from epidermis to draining node, since LC also significantly lose E-cadherin expression upon culture (7). Like E-cadherin, Langerin is also reduced upon maturation of LC (5). Langerin is a useful marker to study LC development and to identify subsets of DC, especially skin-derived LC (12). Therefore, we have independently cloned mouse Langerin (m-Langerin) cDNA. Here, we describe its chromosomal mapping, tissue distribution and down-regulation with DC maturation. Unexpectedly, m-Langerin transcripts are expressed in a variety of organs. In spleen and lymph nodes, expression appears to be restricted to the CD11blow or CD8high DC subset, though m-Langerin is not found in Peyer’s patches. In addition, we show that recombinant m-Langerin binds to mannan–agarose and can form multimers.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice
Female BALB/c and male DBA/2 mice were purchased from Japan SLC (Hamamatsu, Shizuoka, Japan). These mice were bred under specific pathogen-free condition and (BALB/c x DBA/2)F1 (CD2F1) mice were used at 8–12 weeks old. TGF-ß1-deficient mice (13) were treated with 4 µg/g of rapamycin (Sigma, St Louis, MO) 3 times a week from day 10 after birth until use. All experiments were conducted according to institutional guidelines.

Cells and cultures
For all cell cultures, RPMI 1640 containing 10% FCS, 50 µM ß-mercaptoethanol and antibiotics was used, unless otherwise indicated. BM-DC were prepared as described (14). To obtain fully mature late-stage BM-DC, aggregates of growing DC were collected at day 6, transferred into new plates at a cell density of <5 x 105 cells/ml and re-cultured in the presence of baculovirus-expressed soluble CD40 ligand (sCD40L, x100 dilution) or lipopolysaccharide (LPS, 1 µg/ml; Sigma) for another 2 days. BM-DC of early, intermediate and late stage were sorted using a FACStar Plus (Becton Dickinson, Mountain View, CA) based on the expression levels of CD86 and MHC class II. Monocyte-derived mouse DC were prepared as described (15). Briefly, white blood cells were cultured for 2 h at 37°C in 24-well plates at 2.5 x 106 cells/well. After extensive washing, adherent cells were cultured with 20 ng/ml recombinant granulocyte macrophage colony stimulating factor (rGM-CSF) and 400 U/ml rIL-4 in the presence or absence of 10 ng/ml TGF-ß1. Then, cells were harvested on days 2, 4, 6 and 7. rGM-CSF was a kind gift from Kirin Brewery (Takasaki, Gunma, Japan), while the other cytokines were obtained from R & D Systems (Minneapolis, MN).

Epidermal cell suspensions (fresh) were prepared from ear halves as described (16,17) and MHC class II+ LC were positively enriched using TIB-120 mAb (M5/114.15.2; ATCC, Rockville, MD) followed by immunomagnetic beads (sheep anti-rat IgG Dynabeads; Dynal, Oslo, Norway). LN and spleen DC were prepared as previously described (18). DC were further fractionated into CD11c+CD8high (CD11c+CD11blow) and CD11c+CD8low/– (CD11c+CD11bhigh) by sorting with either FACStar Plus or Epics Altra flow cytometers (Coulter, Hialeah, FL).

Peritoneal exudate macrophages were obtained from mice that had been i.p. injected with 2 ml of 4% thioglycollate (Difco, Detroit, MI) 4 days previously. Macrophages were prepared as adherent cells by incubating for 2 h. T cells were purified as CD3+ cells using FITC-conjugated anti-mouse CD3{epsilon} (PharMingen, San Diego, CA) and anti-FITC microbeads (Miltenyi Biotech) from nylon wool non-adherent spleen and LN cells depleted of MHC class II (TIB-120)+, F4/80 (HB198)+ and B220 (6B2)+ cells by sheep anti-rat Ig Dynabeads M-450 (Dynal). Naive B cells were positively enriched as B220+ cells from CD43 spleen cells.

cDNA cloning of m-Langerin
Total RNA was extracted from the mouse epidermal cells using TRIzol Reagent (Gibco/BRL, Rockville, MD) and used for making a template with Superscript II (Gibco/BRL) in accordance with the manufacturer’s protocols. The cDNA was then used in RT-PCR with Z-Taq DNA polymerase (Takara Shuzo, Kusatsu, Shiga, Japan). Several primers were designed based on h-Langerin cDNA (accession no. AJ242859). In these primers, a pair, 5'-GCTTGGAGAATATGAGCAAGTTGC-3' and 5'-GCACTTTGGACCTTGTTGAATGGC-3', amplified a 304-bp fragment under the conditions of 95°C for 2 min, 30 repeats of a cycle at 98°C for 1 s, 55°C for 5 s and 72°C for 1 min, and a final extension at 70°C for 7 min. This fragment was cloned into pCRII vector (Invitrogen, Carlsbad, CA). For 3'-rapid amplification of cDNA end (RACE), a template was prepared from the RNA with a primer 5'-TACGCCAAGCT CGAAATTAACCCTCACTAAAGGG(T)16-3'. The first PCR was done using a primer pair, 5'-TACGCCAAGCTCGAAATT AACCCTC-3' and 5'-CTCGGGGAACTTCTATTACTTTTC-3', under the conditions of 95°C for 2 min, 30 repeats of a cycle at 98°C for 1 s and 68°C for 1 min, and a final extension at 70°C for 7 min. The second PCR was done using a primer pair, 5'-TCGAAATTAACCCTCACTAAAGGG-3' and 5'-ACGCACC CCAAAGACCTGGTACAG-3', under the same conditions as above.

For 5'-RACE, the SMART PCR cDNA library construction kit (Clontech, Palo Alto, CA) was used for making a template. With this template, the first PCR was done using the primer pair, 5'-TACGGCTGCGAGAAGACGACAGAA-3' and 5'- CTGTGT GGAATTCCATCTGCTGCC-3', under the same conditions. The second PCR was done using the primer pair, 5'-GGCTGCGAGAAGACGACAGAAGGG-3' and 5'-GCCTT GTAGAGAAACTTTTGTTCC-3', also under the same conditions. Entire cDNA was finally amplified again with PfuTurbo DNA polymerase (Stratagene, La Jolla, CA) for sequencing.

RT-PCR
Total RNA was extracted using TRIzol Reagent (Gibco/BRL) and used for making templates with Sensiscript (Qiagen, Valencia, CA) or SuperScript II (Gibco/BRL) in accordance with the manufacturer’s protocols. Primers for m-Langerin (5'-ACGCACCCCAAAGACCTGGTACAG-3', 5'-AGACACCC TGATATTGGCACAGTG-3'), ß-actin (5'-CAGGAGATGG CCACTGCCGCA-3', 5'-CTCCTTCTGCATCCTGTCAGCA-3'), MIP-3{alpha} (5'-CGTCTGCTCTTCCTTGCTTTG-3', 5'-TTGACTCT TAGGCTGAGGAGG-3'), CCR6 (5'-GGTACATTGCCATCG TCCAG-3', 5'-CCAAAGAACAGCTCCAGTCC-3'), TGF-ß1 (5'-TTTCGATTCAGCGCTCACTGCTCTTGTGAC-3', 5'-ATG TTGGACAACTGCTCCACCTTGGGCTTGC-3') and E-cadherin (5'-TGCTCAGCCAGGATCCTGAG-3', 5'-GGTCTGGATC CAAGATGGTGC-3') were used under the conditions of 95°C for 2 min, 30 repeats of a cycle at 98°C for 1 s, 64°C for 5 s and 72°C for 10 s, and a final extension at 70°C for 7 min.

Northern blot analysis
Poly(A)+ RNA was purified from s.c. LN by FastTrack 2.0 (Invitrogen) in accordance with the manufacturer’s protocols. The RNA (2 µg) was separated on 1.2% formaldehyde–agarose gel electrophoresis and transferred to Hybond N+ membrane (Amersham Pharmacia Biotech, Piscataway, NJ). A cDNA fragment (1 kbp), which included the entire coding sequence, was labeled by [32P]dCTP using the Prime-It II random primer labeling kit (Stratagene) and hybridized with the filter in Rapid-hyb hybridization solution (Amersham Pharmacia Biotech) at 68°C for 1 h. The filter was washed twice in 2 x SSC/0.1% SDS at 68°C for 15 min and then twice in 0.2 x SSC/0.1% SDS at 68°C for 15 min.

Chromosome preparation and fluorescence in situ hybridization (FISH)
The direct R-banding FISH method was used for chromosomal assignment of the Langerin gene to mouse and rat chromosome. Preparation of R-banded chromosomes and FISH were performed as described previously (19). As a probe, 1.4-kbp cDNA fragment was amplified using a primer pair, 5'-ATGCCAGAGGCAGAGATGAAGGA-3' and 5'-TACCAT GAGGTGTTCTAATAC-3' under conditions of 95°C for 2 min, 30 repeats of a cycle at 98°C for 1 s, 62°C for 5 s and 72°C for 1 min, and a final extension at 70°C for 7 min. The amplified fragment was purified with agarose gel electrophoresis.

Expression of N-terminal-tagged m-Langerin protein and binding assay with mannan–agarose
A coding sequence of m-Langerin was amplified with KlenTaq DNA polymerase (Sigma) and cloned into pcDNA4/HisMax TOPO TA (Invitrogen) according to the manufacturer’s protocols. Then human 293-based cell line Phoenix (a kind gift from G. Nolan) was transfected using Lipofectamine 2000 (Gibco/BRL). After 48 h, cells (5 x 106) were harvested and lysed in 1 ml of lysis buffer 1 (50 mM Tris–HCl (pH 7.6), 150 mM NaCl, 25 mM CaCl2, 0.5% Triton X-100, 1 mM PMSF and 20 µg/ml aprotinin) for 30 min on ice. The lysate was collected after centrifugation at 12,000 g for 20 min and diluted 10-fold with binding buffer (lysis buffer 1 without Triton X-100). Then 1 ml of the lysate was incubated with 20 µl of mannan–agarose beads (Sigma). After 12 h incubation at 4°C, the agarose beads were washed by 1 ml of the binding buffer that included 0.05% Triton X-100 5 times with or without 25 mM EDTA. Bound proteins to the agarose beads were separated on 12% SDS–PAGE under denaturing conditions and transferred to Immobilon-P membranes (Millipore, Bedford, MA). The membrane was probed with a horseradish peroxidase-labeled anti-Xpress antibody (Invitrogen) and visualized by LumiGLO chemiluminescent substrate (Cell Signaling Technology, Beverly, MA) according to the manufacturer’s protocols.

Analysis of multimer formation of m-Langerin molecules
The lysate of m-Langerin-transfected 293 cells was analyzed by 10% SDS–PAGE under native or denaturing conditions followed by immunoblotting as described above. For cross-linking experiment, bis-(sulfosuccinimidyl)suberate (BS3; Pierce, Rockford, IL) was used in accordance with the manufacturer’s protocol. Briefly, cell lysate was prepared using lysis buffer 2 (20 mM sodium phosphate buffer, pH 7.6, 150 mM NaCl, 0.5% Triton X-100, 1 mM PMSF and 20 µg/ml aprotinin). The lysate of 20 µl was diluted 10-fold with PBS (20 mM sodium phosphate buffer, pH 7.6 and 150 mM NaCl) and various concentrations of BS3 added. After 2 h incubation at 24°C, the reactions were quenched with glycine (final 50 mM) for 1 h at 24°C and analyzed by 7.5% SDS–PAGE under reducing conditions followed by immunoblotting as described above.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Identification of m-Langerin cDNA
Primer pairs constructed from the lectin part of h-Langerin cDNA amplified a 304-bp fragment from epidermal cell cDNA. As a result of 5'- and 3'-RACE, a 1.5-kb cDNA sequence (accession no. AY026050) was obtained. The cDNA contained a short 5'-non-coding region, a 996-bp open reading frame, a 497-bp entire 3'-non-coding region with a polyadenylation signal (AATAAA) at position 1453 bp, followed by a poly(A) tail (data not shown). The open reading frame encoded a 331-amino-acid polypeptide that showed 65% identity in overall domains and 74% identify in the lectin domain with those of h-Langerin (Fig. 1A). Like h-Langerin, the putative m-Langerin was a type II transmembrane protein, with a single C-type lectin carbohydrate recognition domain (CRD) containing a EPN-motif to bind mannose. m-Langerin also contained two potential N-glycosylation sites in the neck domain and a proline-rich motif as a potential signal transduction site in the intracellular domain (20). Furthermore, heptad repeats (see Fig. 5B), possibly forming an {alpha}-helical coiled-coil stalk (21) for dimerization/multimerization, were found in the neck domain.




View larger version (125K):
[in this window]
[in a new window]
 
Fig. 1. Analysis of the m-Langerin gene. Alignments of predicted amino acid sequences of m-Langerin and h-Langerin. Box 1: proline-rich putative signal transduction site; underline 2: transmembrane region; box 3: potential N-glycosylation site; arrow 4: lectin domain start site; box with asterisk: two cysteine forming disulfide bridge; box 5: EPN motif suggesting mannose-type specificity. (B) Alignment of CRD domain of mouse C-type lectins using CLUSTALW. Amino acids of m-Langerin and Kupffer cell receptor (Kupffer c. r.) are shown in red. Blue: common amino acids in all lectins; violet: common amino acids except for m-Langerin and Kupffer cell receptor; yellow: common amino acids in m-Langerin, Kupffer cell receptor and other lectins. Accession numbers for Kupffer cell receptor, asialoglycoprotein receptor (ASGPR1), asialoglycoprotein receptor 2 (ASGPR2), macrophage galactose/N-acetylgalactosamine-specific C-type lectin (MGL), Fc{epsilon}RII (CD23), dendritic cell immunoreceptor (DCIR), dendritic cell-associated C-type lectin-1 (Dectin1), dectin-2 {alpha} isoform (Dectin2), CD69 antigen (CD69), macrophage C-type lectin (Mpcl) and macrophage-inducible C-type lectin (Mincle) are D88577, U08372, NM_007493, AF132744, M99371, AJ133533, AF262985, AF240357, L23638, NM_010819 and AB024717.

 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5. Binding to mannan–agarose and possible formation of multimers of m-Langerin. (A) Cell lysates of parental cells (Cell), control plasmid-transfected cells (Vector) and m-Langerin-transfected cells were incubated with mannan–agarose beads. After washing with the binding buffer, bound fractions were analyzed by immunoblotting. EDTA: addition of 25 mM EDTA during the washing step. (B) Helical wheel diagram of the neck domain. (C) Cell lysates of m-Langerin-transfected cells were separated on native or denatured SDS–PAGE and detected by immunoblotting. (D) Chemical cross-linking experiment. The lysate of m-Langerin-transfected cells was subjected treatment with 2-fold serial dilutions of BS3 from 30 µM (designated ‘1’).

 
Comparison of the amino acid sequence of the CRD domain of m-Langerin revealed significant homology with several C-type lectins having a single CRD in the type II membrane protein. Among them, m-Langerin displayed the highest homology with mouse Kupffer cell receptor at 46.6%. Degree of homology of m-Langerin and other lectins ranged from 40.2% with m-Mincle to 24.6% with m-Dectin 1 (Fig. 1B).

Expression and distribution of m-Langerin transcripts
h-Langerin has been shown to encode a molecule associated with the Birbeck granules of epidermal LC (5). Thus, we first examined the expression of putative m-Langerin transcripts in mouse epidermal MHC class II+ cells by comparing with MHC class II cells and other cell types. Tissue distribution was also studied. As shown in Fig. 2(A), m-Langerin transcripts were largely detected in epidermis, although relatively low but significant levels of expression were also seen in dermis. m-Langerin-expressing cells in epidermal cell suspension were MHC class II+ LC. Other cell types including macrophages, T and B cells, and tumor cell lines, such as B16 melanoma and TSA mammary adenocarcinoma, were all detected as negative. The level of m-Langerin expression was substantially diminished during cell maturation in 3-day cultured LC. In contrast to h-Langerin which is expressed in lung, skin and tonsil, but not other non-lymphoid tissues (5,6), m-Langerin transcripts were detected not only in skin and lung, but also heart, liver and various lymphoid tissue, such as spleen, thymus and LN. Furthermore, the small intestine expressed no m-Langerin transcripts, whereas mesenteric LN, which drains gut-associated mucosal tissue, did express m-Langerin. With Northern blot analysis, ~1.8-kb m-Langerin transcripts were detected in s.c. LN (Fig. 2B), and a similar size transcript was seen in spleen and thymus (data not shown). Interestingly, there were no m-Langerin transcripts in Peyer’s patches, although expression of E-cadherin, MIP-3{alpha} and TGF-ß1 was detected (Fig. 2C).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 2. Expression of m-Langerin transcripts. (A) Expression pattern of m-Langerin in dermis and epidermis, epidermal MHC class II+ cells (LC), macrophages (M{phi}), T cells, B cells and other cell lines, and several organs. EC: epidermal cells prepared with trypsinization; S. Intestine: small intestine. (B) Northern blot analysis of m-Langerin transcripts in s.c. LN. (C) Differential expression of m-Langerin transcripts between Peyer’s patches and mesenteric LN. (D) Exclusive expression of m-Langerin in CD11c+ cells of spleen. For preparation of CD11c cells, spleen cells were depleted with anti-CD11c microbeads twice. (E) m-Langerin expression in DC subsets. CD11c+ cells were positively selected by anti-CD11c microbeads from low-density cells negative for Thy-1, B220 and F4/80. CD11c+ fractions were further fractionated into CD11blow and CD11bhigh (spleen) or CD8high and CD8low (LN) using flow cytometry. For RT-PCR of T, B cells (A) and sorted cells (E), Sensiscript was used with 50 ng of total RNA. For others, SuperSccript II was used with 5 µg of total RNA to synthesize a template cDNA.

 
To further define the cell types expressing m-Langerin, we first examined CD11c+ DC and CD11c non-DC from spleen, since spleen should not contain any skin-derived DC, except in the aly mouse that lacks LN and Peyer’s patches (22). The results shown in Fig. 2(D) demonstrated that CD11c+ spleen DC expressed m-Langerin. Then, we fractionated CD11c+ DC from spleen and LN into CD11blow CD8{alpha}high cells and CD11bhigh CD8{alpha}–/low cells and found that m-Langerin transcripts were predominantly detected in the former population (Fig. 2E).

Chromosomal mapping and genomic structure of the Langerin gene
The above results on the tissue distribution of m-Langerin transcripts were somewhat different from that of h-Langerin. Therefore, we attempted to define its localization on mouse chromosomes by the direct R-banding FISH method. As shown in Fig. 3(A), m-Langerin was mapped to the D1–D2 band of mouse chromosome 6 and rat Langerin gene to the q33 distal–q34.1 proximal band of chromosome 4. These regions are syntenic with human chromosome 2p13, where h-Langerin has been mapped (6,23). Therefore, the cloned mouse gene is a mouse counterpart of h-Langerin. In terms of genomic organization, the m-Langerin gene consists of six exons including a large exon for the neck domain and three exons for the CRD (Fig. 3B). This structure was highly comparable to the h-Langerin gene, deduced from a complete genome sequence of BAC clone RP11-50401 (accession no. AC007359), except for the length of introns and exon 6. Splice donor and acceptor sites of each intron were typical, except for the donor sites of both mouse and human intron 1, where the dinucleotide sequences of the 5'-end of mouse and human intron 1 were GC and CA respectively (data not shown).



View larger version (27K):
[in this window]
[in a new window]
 
Fig. 3. Chromosomal mapping and genomic organization of the Langerin gene. (A) The Langerin gene was mapped by FISH method in mouse (a–c) and rat (d– f). Arrows indicate the hybridization signals (c and f). The Langerin gene was localized to mouse chromosome 6 D1–D2 and rat chromosome 4q33 distal–q34.1 proximal. R- and G-banded patterns are demonstrated in (a and d) and (b and e) respectively. (B) Exon–intron structures were described from mouse genomic draft sequence AC090647 and human BAC clone sequence AC007359. Intron and exon sizes are shown in base pairs with and without parentheses respectively. TM: transmembrane domain.

 
m-Langerin expression in BM-DC and DC derived from blood adherent cells
The generation of CD1a+ DC from CD34+ precursor cells is dependent on endogenous TGF-ß1 and these cells express Langerin as well as E-cadherin (6). Therefore, we tested if BM-DC from mice expressed Langerin. To do this, the DC were sorted into early, intermediate and late stages of maturation based on the expression levels of MHC class II and CD86. Substantial amounts of E-cadherin and low levels of m-Langerin transcripts were detected in early-stage BM-DC (Fig. 4A). In the intermediate stage, m-Langerin transcripts were abundant, while maturation with LPS or sCD40L induced a dramatic decrease, as in human LC (Fig. 4A). This was also the case for E-cadherin, but some E-cadherin expression was still detected after LPS treatment.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 4. m-Langerin expression in developing BM-DC and effect of TGF-ß1. (A) m-Langerin expression during BM-DC maturation. The early (designated ‘E’) and intermediate (designated ‘I’) stages of BM-DC were sorted from day 6 BM cultures (left bottom panel). The mature (late) stage of BM-DC (designated ‘L’) was sorted from day 8 culture after stimulation with 1 µg/ml LPS (left top panel) or 1/100-fold dilution of sCD40L for the last 2 days. Expression of m-Langerin in each developmental stage was investigated by RT-PCR (right panel). (B) Adherent cells from mouse blood express m-Langerin in the presence of TGF-ß1. m-Langerin transcripts were analyzed by RT-PCR. For this experiment, Sensiscript was used with 50 ng of total RNA to synthesize a template cDNA. (C) Semiquantitative analysis of m-Langerin transcripts in skin and LN from normal and TGF-ß1-deficient mice. Skin and superficial (inguinal, brachial, axillary and cervical) LN were obtained from TGF-ß1-deficient and littermate control mice at the age of 3–4 weeks. SuperScript II was used with 5 µg of total RNA to synthesize a template cDNA.

 
These results suggest that endogenous TGF-ß1 may be produced during culture and induce the observed m-Langerin expression. Therefore, we next examined the effect of exogenous TGF-ß1 on the development of monocyte-derived DC, using adherent cells in the blood. First, we confirmed that the adherent fraction of blood cells expressed no detectable m-Langerin transcripts by RT-PCR (data not shown). Then adherent cells were cultured with GM-CSF and rIL-4 in the presence or absence of 10 ng/ml TGF-ß1 for 7 days. Regardless of the presence or absence of TGF-ß1, DC-like cells developed without significant proliferation (data not shown). In contrast to the case of BM-DC, m-Langerin transcripts were undetectable throughout the culture period in the absence of TGF-ß1 (Fig. 4B). m-Langerin transcripts were not detected in day 2 cultures even in the presence of TGF-ß1, but gradually increased thereafter and reached a maximum at day 6. By day 7, however, m-Langerin was reduced in association with spontaneous maturation of the DC.

TGF-ß1 is not indispensable for the expression of m-Langerin transcripts
To examine the possibility that TGF-ß1 plays an essential role to induce m-Langerin transcripts, we studied TGF-ß1-deficient mice that are known to lack LC but not other DC populations (24). We stained epidermal sheets with anti-MHC class II mAb to confirm that there were no typical LC (data not shown). As shown in Fig. 4(C), both skin and LN cells in TGF-ß1-deficient mice expressed small but significant amounts of m-Langerin transcripts, although the levels were less than 1/16 of littermates.

Binding to mannan–agarose and possible multimer formation of m-Langerin
Based on the primary structure of m-Langerin and the down-regulation of h-Langerin from the cell surface by mannan treatment (6), we analyzed the binding capacity of m-Langerin to mannan. To do this, N-terminal-tagged recombinant m-Langerin was expressed in 293 cells and the cell lysates were incubated with mannan–agarose. As shown in Fig. 5(A), the recombinant m-Langerin bound mannan–agarose and this binding was completely inhibited by EDTA, demonstrating m-Langerin is capable of capturing mannan.

As mentioned above, m-Langerin may form multimers due to heptad repeats of hydrophobic residues in the neck domain (Fig. 5B), since some of the tagged-m-Langerin migrated more slowly (~100 and >175 kDa) on native SDS–PAGE than m-Langerin (~47 kDa) on the denatured SDS–PAGE (Fig. 5C). In order to examine this possibility, we cross-linked molecules using BS3. The results shown in Fig. 5(D) revealed that m-Langerin possibly formed dimers and multimers, as has been reported for other lectins, like asialoglycoprotein receptor (25), CD23 (26), pulmonary surfactant protein D (27), DC-specific intercellular adhesion molecule-3-grabbing non-integrin (DC-SIGN) and DC-SIGN receptor (28).


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
It has been reported that h-Langerin is an LC-restricted type II lectin that plays a role as an endocytic receptor (3). Here we have identified m-Langerin through the use of primers derived from the functional lectin domain of h-Langerin. The deduced amino acid sequence of m-Langerin showed a high degree of homology with that of h-Langerin (Fig. 1A). Nevertheless, the expression patterns between m- and h-Langerin are different (5,6) (Fig. 2A). Therefore, we identified the Langerin genes on mouse and rat chromosomes in a syntenic position to h-Langerin (Fig. 3A). The genomic structures of m- and h-Langerin are closely related (Fig. 3B). These results demonstrate that our gene is a real counterpart of h-Langerin. Interestingly, the 5'-ends of mouse and human intron 1 are not ‘GT’. These unusual splice donor sites suggest a potential regulation of Langerin mRNA splicing.

A comparison of m-Langerin with several type II lectins in amino acid sequence indicates that m-Langerin has a high degree of homology with Kupffer cell receptor (Fig. 1B). Based on the database analysis, m-Langerin and Kupffer cell receptor genes are located in a single genomic clone (accession no. AC090647) within ~200 kb proximity. However, sugar-binding specificities of these lectins are different: Langerin can bind mannose, whereas Kupffer cell receptor binds fucose and galactose. The close genomic linkage of these two endocytic lectins may indicate that these genes are generated by gene duplication.

In contrast to h-Langerin, m-Langerin was detected broadly in mouse tissues. Langerin expression in various lymphoid tissues also was of interest (Fig. 2). LC migrate from epidermis to draining s.c. LN (12). In addition, LC have been reported to express CD8{alpha} in LN, following injection into CD8{alpha}-deficient mice (29). Henri et al. have also reported similar observations demonstrating Langerin expression on CD8{alpha}low/moderate DC subset in LN using specific mAb (12). Taking consideration of these studies and the demonstration that cultured LC still express some m-Langerin transcripts, CD8{alpha}+ LN DC with m-Langerin transcripts are possibly derived from LC. On the other hand, BM-DC activated by LPS or sCD40L abolished m-Langerin expression (Fig. 4A). Thus, strong activation signals seem to be required to shut off the synthesis of m-Langerin.

In Peyer’s patches, m-Langerin transcripts were not detected even though there was significant expression of E-cadherin (Fig. 2C). This was also the case in small intestine (Fig. 2A). Furthermore, no m-Langerin transcripts was detected in CD11c+ cells from Peyer’s patches, even though there was LC-associated chemokine receptor, CCR6, transcripts in these CD11c+ cells (data not shown). Nevertheless, it has been documented that CCR6+CD11b+ DC are localized in Peyer’s patches, especially in the subepithelial dome region where MIP-3{alpha}/CCL20 is produced to attract LC (30). MIP-3{alpha}/CCL20 is known to be required for attraction of LC (31). In addition, CCR6 expression is shown to be restricted to LC or direct precursor of LC in DC populations, and to be induced by TGF-ß1 and IL-10 (32,33). It is known that TGF-ß1 and IL-10 are abundant in gut-associated mucosal tissue. Thus, it might be speculated that DC in mucosal tissue are not identical to epidermal LC.

Even though Peyer’s patches and small intestine are negative for m-Langerin, mesenteric LN that drain these tissue do express Langerin transcripts. In earlier electron microscopic studies, LC and cells containing Birbeck granule-like structures were shown to be increased in number only after challenge with 2,4-dinitro-1-chlorobenzene (34). Taking into account this observation, Langerin-expressing cells in mesenteric LN may not be migratory DC from mucosal tissue. This possibility may also be supported by the results that a major population expressing Langerin was CD11blow/CD8{alpha}+, but not CD11bhigh/CD8{alpha}, DC in mesenteric LN, spleen and liver (Fig. 2 and data not shown). Therefore, it is possible that Langerin-expressing DC in these organs originate from separate precursors other than authentic LC. Alternatively, Langerin-expressing cells in s.c. LN might consist of LC- and non-LC-derived DC.

Langerin transcripts expression in thymus should be also taken into consideration. DC from thymus have CD11blow/CD8{alpha}+ cells as a major population and CD11bhigh/CD8{alpha} cells as a minor population (18,35). It has been reported that typical Birbeck granules are present in medulla of rat and human thymus (3639). Thymic DC are known to express another C-type lectin called DEC-205/CD205 that is a potent endocytic receptor for antigen-presenting function (40). The presence of these lectins raises the interesting possibility that T cell selection is influenced by antigen presentation via endocytic lectin receptors on DC for self-antigens.

LC development is known to depend on TGF-ß1, since TGF-ß1-deficient mice lack LC, but not other DC (11,24). As expected, BM-DC at the intermediate stage of maturation expressed m-Langerin transcripts, as well as E-cadherin, possibly due to endogenous TGF-ß1 production, which acts on developing progenitor cells in a paracrine and/or autocrine manner (Fig. 4A) (8). Differentiation of LC from blood monocytes also allowed m-Langerin expression in the presence of exogenous TGF-ß1, along with GM-CSF and IL-4, as in the case of human LC (9,10,41). Unexpectedly, Langerin transcripts persisted in skin and lymph nodes of TGF-ß1-deficient mice, although at markedly reduced levels (Fig. 4C). In addition, BM-DC of TGF-ß1-deficient mice also expressed Langerin transcripts without exogenous TGF-ß1 (data not shown). These results seem to indicate that Langerin expression per se does not depend solely on TGF-ß1. Larregina et al. have recently reported that CD14+ immediate LC precursors in dermis of human skin express Langerin, but not E-cadherin (42). We also detected Langerin transcripts in dermis, although relatively low amounts compared with epidermis (Fig. 2A). Therefore, cells expressing Langerin transcripts in the skin of TGF-ß1-deficient mice are likely to be immediate precursors of LC in dermis. On the other hand, CD11c+ cells in Peyer’s patches did not express Langerin transcripts even when likely exposed to abundant intestinal TGF-ß1. Taken together, synthesis of Langerin transcripts may be regulated at additional levels to TGF-ß1. Cytokine(s) including the other TGF-ß family members involved in the induction and/or regulation of m-Langerin synthesis remain to be investigated in the future study.

The genomic regions encoding the CRD of m- and h-Langerin consist of three exons. This organization is well conserved in other type II lectins. However, their neck domains show broad diversity in terms of length and number of repeat units. This diversity may generate specific functions of each lectin. For instance, it is thought that a long neck domain of human DC-SIGN facilitates initial contact with ICAM-3 on naive T cells to increase antigen presentation efficiency (43). Another example is dimer/multimer formation of lectin molecules using a heptad repeat in the neck domain (2528). These examples suggest the functional importance of the neck domain.

The coiled-coil neck domain with a 7-amino-acid heptad repeat, (a-b-c-d-e-f-g)n, including leucine, isoleucine and other hydrophobic amino acids at the a and d positions, indicates a possibility to form multimers for m-Langerin (Fig. 5B). In fact, m-Langerin could form dimers/tetramers. The results shown in Fig. 5(D) also demonstrate that monomers first form dimers and then further dimerize to a tetramer, since trimer forms of the molecule were not detected by SDS–PAGE. Such tetrameric extracellular clusters may allow the CRD to augment the affinity for glycans on molecules targeted by m-Langerin.

Langerin is a molecule associated with the subcellular structure, called Birbeck granules, a form of endocytic compartment (3,5,44). Along with maturation, LC are known to lose antigen-presenting capacity (45) and this is accompanied by the disappearance of acidic organelles, including Birbeck granules (46). As mentioned above, activated BM-DC lose Langerin transcripts expression, but cultured LC keep expressing it to some extent, suggesting that Langerin-expressing DC in s.c. and mesenteric LN and spleen are not fully activated, and rather in an intermediate stage or maturing state.

Like h-Langerin, m-Langerin is predicted to bind mannose-containing oligosaccharides because of its EPN motif in the CRD domain. This was confirmed by the experiment showing capability of binding to mannan–agarose by recombinant m-Langerin molecules, probably in their tetrameric form (Fig. 5A and C). It has been reported that the {alpha}-C region of the macrophage scavenger receptor exhibits a pH-dependent conformational change and possibly controls ligand release (47). This pH dependency is ascribed to the structure of the acidic amino acids stretch at adjacent positions to the hydrophobic core of the heptad repeat. The helical wheel diagram of m-Langerin reveals two stretches containing acidic and basic amino acids at position b and e (Fig. 5B). Although we have no direct evidence to anticipate pH-dependent multimer formation/degradation of the m-Langerin molecule, these stretches might be involved in antigen processing and in shaping the formation of the Birbeck granules in LC.

Collectively, Langerin is a unique marker for DC subsets including LC. However, the molecular regulation of its transcripts and protein expression requires further elucidation.


    Acknowledgements
 
We thank Drs Muneo Inaba and Susumu Ikehara (Kansai Medical University, Moriguchi, Osaka, Japan) for helpful advice in cell preparation and critical reading of the manuscript. This work was supported by grants from the Ministry of Education, Science, Sports and Culture of Japan [Grant-in-Aid for Scientific Research on Priority Areas (C: 12204062, A: 11140232), 10770096, 11470085, through Special Coordination Funds of the Science and Technology Agency of the Japanese Government], The Naito Foundation, Uehara Memorial Foundation and grant AI13013 from the NIH (R. M. S.).


    Abbreviations
 
BM—bone marrow

BM-DC—bone marrow-derived dendritic cells

BS3—bis-(sulfosuccinimidyl)suberate

CRD—carbohydrate recognition domain

DC—dendritic cell

DC-SIGN—DC-specific intercellular adhesion molecule-3-grabbing non-integrin

FISH—fluorescence in situ hybridization

GM-CSF—granulocyte macrophage colony stimulating factor

Lag—Langerhans-associated granule

LC—Langerhans cell

LN—lymph node

LPS—lipopolysaccharide

RACE—rapid amplification of cDNA end

sCD40L—soluble CD40 ligand


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Banchereau, J. and Steinman, R. M. 1998. Dendritic cells and the control of immunity. Nature 392:245.[Medline]
  2. Banchereau, J., Briere, F., Caux, C., Davoust, J., Lebecque, S., Liu, Y. J., Pulendran, B. and Palucka, K. 2000. Immunobiology of dendritic cells. Annu. Rev. Immunol. 18:767.[Web of Science][Medline]
  3. Takigawa, M., Iwatsuki, K., Yamada, M., Okamoto, H. and Imamura, S. 1985. The Langerhans cell granule is an adsorptive endocytic organelle. J. Invest. Dermatol. 85:12.[Web of Science][Medline]
  4. Kashihara-Sawami, M., Horiguchi, Y., Ikai, K., Takigawa, M., Ueda, M., Hanaoka, M. and Imamura, S. 1988. Letterer–Siwe disease: immunopathologic study with a new monoclonal antibody. J. Am. Acad. Dermatol. 18:646.[Web of Science][Medline]
  5. Valladeau, J., Duvert-Frances, V., Pin, J. J., Dezutter-Dambuyant, C., Vincent, C., Massacrier, C., Vincent, J., Yoneda, K., Banchereau, J., Caux, C., Davoust, J. and Saeland, S. 1999. The monoclonal antibody DCGM4 recognizes Langerin, a protein specific of Langerhans cells, and is rapidly internalized from the cell surface. Eur. J. Immunol. 29:2695.[Web of Science][Medline]
  6. Valladeau, J., Ravel, O., Dezutter-Dambuyant, C., Moore, K., Kleijmeer, M., Liu, Y., Duvert-Frances, V., Vincent, C., Schmitt, D., Davoust, J., Caux, C., Lebecque, S. and Saeland, S. 2000. Langerin, a novel C-type lectin specific to Langerhans cells, is an endocytic receptor that induces the formation of Birbeck granules. Immunity 12:71.[Web of Science][Medline]
  7. Borkowski, T. A., Van Dyke, B. J., Schwarzenberger, K., McFarland, V. W., Farr, A. G. and Udey, M. C. 1994. Expression of E-cadherin by murine dendritic cells: E-cadherin as a dendritic cell differentiation antigen characteristic of epidermal Langerhans cells and related cells. Eur. J. Immunol. 24:2767.[Web of Science][Medline]
  8. Caux, C., Massacrier, C., Dubois, B., Valladeau, J., Dezutter-Dambuyant, C., Durand, I., Schmitt, D. and Saeland, S. 1999. Respective involvement of TGF-beta and IL-4 in the development of Langerhans cells and non-Langerhans dendritic cells from CD34+ progenitors. J. Leuk. Biol. 66:781.[Abstract]
  9. Geissmann, F., Prost, C., Monnet, J. P., Dy, M., Brousse, N. and Hermine, O. 1998. Transforming growth factor beta1, in the presence of granulocyte/macrophage colony-stimulating factor and interleukin 4, induces differentiation of human peripheral blood monocytes into dendritic Langerhans cells. J. Exp. Med. 187:961.[Abstract/Free Full Text]
  10. Ito, T., Inaba, M., Inaba, K., Toki, J., Sogo, S., Iguchi, T., Adachi, Y., Yamaguchi, K., Amakawa, R., Valladeau, J., Saeland, S., Fukuhara, S. and Ikehara, S. 1999. A CD1a+/CD11c+ subset of human blood dendritic cells is a direct precursor of Langerhans cells. J. Immunol. 163:1409.[Abstract/Free Full Text]
  11. Borkowski, T. A., Letterio, J. J., Farr, A. G. and Udey, M. C. 1996. A role for endogenous transforming growth factor beta 1 in Langerhans cell biology: the skin of transforming growth factor beta 1 null mice is devoid of epidermal Langerhans cells. J. Exp. Med. 184:2417.[Abstract/Free Full Text]
  12. Henri, S., Vremec, D., Kamath, A., Waithman, J., Williams, S., Benoist, C., Burnham, K., Saeland, S., Handman, E. and Shortman, K. 2001. The dendritic cell populations of mouse lymph nodes. J. Immunol. 167:741.[Abstract/Free Full Text]
  13. Kulkarni, A. B., Huh, C. G., Becker, D., Geiser, A., Lyght, M., Flanders, K. C., Roberts, A. B., Sporn, M. B., Ward, J. M. and Karlsson, S. 1993. Transforming growth factor beta 1 null mutation in mice causes excessive inflammatory response and early death. Proc. Natl Acad. Sci. USA 90:770.[Abstract/Free Full Text]
  14. Inaba, K., Inaba, M., Romani, N., Aya, H., Deguchi, M., Ikehara, S., Muramatsu, S. and Steinman, R. M. 1992. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J. Exp. Med. 176:1693.[Abstract/Free Full Text]
  15. Schreurs, M. W., Eggert, A. A., de Boer, A. J., Figdor, C. G. and Adema, G. J. 1999. Generation and functional characterization of mouse monocyte-derived dendritic cells. Eur. J. Immunol. 29:2835.[Web of Science][Medline]
  16. Schuler, G. and Steinman, R. M. 1985. Murine epidermal Langerhans cells mature into potent immunostimulatory dendritic cells in vitro. J. Exp. Med. 161:526.[Abstract/Free Full Text]
  17. Ortner, U., Inaba, K., Koch, F., Heine, M., Miwa, M., Schuler, G. and Romani, N. 1996. An improved isolation method for murine migratory cutaneous dendritic cells. J. Immunol. Methods 193:71.[Web of Science][Medline]
  18. Crowley, M., Inaba, K., Witmer-Pack, M. and Steinman, R. M. 1989. The cell surface of mouse dendritic cells: FACS analyses of dendritic cells from different tissues including thymus. Cell. Immunol. 118:108.[Web of Science][Medline]
  19. Matsuda, Y., Harada, Y. N., Natsuume-Sakai, S., Lee, K., Shiomi, T. and Chapman, V. M. 1992. Location of the mouse complement factor H gene (cfh) by FISH analysis and replication R-banding. Cytogenet. Cell Genet. 61:282.[Web of Science][Medline]
  20. Ren, R., Mayer, B. J., Cicchetti, P. and Baltimore, D. 1993. Identification of a ten-amino acid proline-rich SH3 binding site. Science 259:1157.[Abstract/Free Full Text]
  21. Burkhard, P., Stetefeld, J. and Strelkov, S. V. 2001. Coiled coils: a highly versatile protein folding motif. Trends Cell Biol. 11:82.[Web of Science][Medline]
  22. Hemmi, H., Yoshino, M., Yamazaki, H., Naito, M., Iyoda, T., Omatsu, Y., Shimoyama, S., Letterio, J. J., Nakabayashi, T., Tagaya, H., Yamane, T., Ogawa, M., Nishikawa, S., Ryoke, K., Inaba, K., Hayashi, S. and Kunisada, T. 2001. Skin antigens in the steady state are trafficked to regional lymph nodes by transforming growth factor-ß1-dependent cells. Int. Immunol. 13:695.[Abstract/Free Full Text]
  23. Serikawa, T., Cui, Z., Yokoi, N., Kuramoto, T., Kondo, Y., Kitada, K. and Guenet, J. L. 1998. A comparative genetic map of rat, mouse and human genomes. Exp. Anim. 47:1.
  24. Borkowski, T. A., Letterio, J. J., Mackall, C. L., Saitoh, A., Wang, X. J., Roop, D. R., Gress, R. E. and Udey, M. C. 1997. A role for TGFbeta1 in langerhans cell biology. Further characterization of the epidermal Langerhans cell defect in TGFbeta1 null mice. J. Clin. Invest. 100:575.[Web of Science][Medline]
  25. Bider, M. D., Wahlberg, J. M., Kammerer, R. A. and Spiess, M. 1996. The oligomerization domain of the asialoglycoprotein receptor preferentially forms 2:2 heterotetramers in vitro. J. Biol. Chem. 271:31996.[Abstract/Free Full Text]
  26. Beavil, A. J., Edmeades, R. L., Gould, H. J. and Sutton, B. J. 1992. Alpha-helical coiled-coil stalks in the low-affinity receptor for IgE (Fc epsilon RII/CD23) and related C-type lectins. Proc. Natl Acad. Sci. USA 89:753.[Abstract/Free Full Text]
  27. Zhang, P., McAlinden, A., Li, S., Schumacher, T., Wang, H., Hu, S., Sandell, L. and Crouch, E. 2001. The amino-terminal heptad repeats of the coiled-coil neck domain of pulmonary surfactant protein d are necessary for the assembly of trimeric subunits and dodecamers. J. Biol. Chem. 276:19862.[Abstract/Free Full Text]
  28. Mitchell, D. A., Fadden, A. J. and Drickamer, K. 2001. A novel mechanism of carbohydrate recognition by the C-type lectins DC- SIGN and DC-SIGNR. Subunit organization and binding to multivalent ligands. J. Biol. Chem. 276:28939.[Abstract/Free Full Text]
  29. Merad, M., Fong, L., Bogenberger, J. and Engleman, E. G. 2000. Differentiation of myeloid dendritic cells into CD8alpha-positive dendritic cells in vivo. Blood 96:1865.
  30. Iwasaki, A. and Kelsall, B. L. 2000. Localization of distinct Peyer’s patch dendritic cell subsets and their recruitment by chemokines macrophage inflammatory protein (MIP)-3alpha, MIP-3beta, and secondary lymphoid organ chemokine. J. Exp. Med. 191:1381.[Abstract/Free Full Text]
  31. Charbonnier, A. S., Kohrgruber, N., Kriehuber, E., Stingl, G., Rot, A. and Maurer, D. 1999. Macrophage inflammatory protein 3alpha is involved in the constitutive trafficking of epidermal langerhans cells. J. Exp. Med. 190:1755.[Abstract/Free Full Text]
  32. Yang, D., Howard, O. M., Chen, Q. and Oppenheim, J. J. 1999. Cutting edge: immature dendritic cells generated from monocytes in the presence of TGF-beta 1 express functional C–C chemokine receptor 6. J. Immunol. 163:1737.[Abstract/Free Full Text]
  33. Dieu-Nosjean, M. C., Massacrier, C., Vanbervliet, B., Fridman, W. H. and Caux, C. 2001. IL-10 induces CCR6 expression during Langerhans cell development while IL-4 and IFN-gamma suppress it. J. Immunol. 167:5594.[Abstract/Free Full Text]
  34. Sonoda, Y., Miyazaki, T., Asano, S. and Sagami, S. 1985. Increased Langerhans cells and related cells in mesenteric lymph nodes of DNCB-sensitive mice. Arch. Dermatol. Res. 278:68.[Web of Science][Medline]
  35. Vremec, D., Pooley, J., Hochrein, H., Wu, L. and Shortman, K. 2000. CD4 and CD8 expression by dendritic cell subtypes in mouse thymus and spleen. J. Immunol. 164:2978.[Abstract/Free Full Text]
  36. Van Haelst, U. J. 1969. Light and electron microscopic study of the normal and pathological thymus of the rat. 3. A mesenchymal histiocytic type of cell. Z. Zellforsch. Mikrosk. Anat. 99:198.[Web of Science][Medline]
  37. Olah, I., Dunay, C., Rohlich, P. and Toro, I. 1968. A special type of cells in the medulla of the rat thymus. Acta. Biol. 19:97.[Web of Science][Medline]
  38. Kamperdijk, E. W., vd Berg, M. and Hoefsmit, E. C. 1982. The immunological significance of Birbeck granule containing cells. Adv. Exp. Med. Biol. 149:415.[Web of Science][Medline]
  39. Hoshino, T., Kukita, A. and Sato, S. 1970. Cells containing Birbeck granules (Langerhans cell granules) in the human thymus. J. Electron Microsc. 19:271.[Abstract/Free Full Text]
  40. Mahnke, K., Guo, M., Lee, S., Sepulveda, H., Swain, S. L., Nussenzweig, M. and Steinman, R. M. 2000. The dendritic cell receptor for endocytosis, DEC-205, can recycle and enhance antigen presentation via major histocompatibility complex class II-positive lysosomal compartments. J. Cell Biol. 151:673.[Abstract/Free Full Text]
  41. Strobl, H., Bello-Fernandez, C., Riedl, E., Pickl, W. F., Majdic, O., Lyman, S. D. and Knapp, W. 1997. flt3 ligand in cooperation with transforming growth factor-beta1 potentiates in vitro development of Langerhans-type dendritic cells and allows single-cell dendritic cell cluster formation under serum-free conditions. Blood 90:1425.[Abstract/Free Full Text]
  42. Larregina, A. T., Morelli, A. E., Spencer, L. A., Logar, A. J., Watkins, S. C., Thomson, A. W. and Falo, L. D., Jr. 2001. Dermal-resident CD14+ cells differentiate into Langerhans cells. Nat. Immunol. 2:1151.[Web of Science][Medline]
  43. Geijtenbeek, T. B., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Adema, G. J., van Kooyk, Y. and Figdor, C. G. 2000. Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses. Cell 100:575.[Web of Science][Medline]
  44. Ishii, M., Terao, Y., Kitajima, J. and Hamada, T. 1984. Sequential production of Birbeck granules through adsorptive pinocytosis. J. Invest. Dermatol. 82:28.[Web of Science][Medline]
  45. Romani, N., Koide, S., Crowley, M., Witmer-Pack, M., Livingstone, A. M., Fathman, C. G., Inaba, K. and Steinman, R. M. 1989. Presentation of exogenous protein antigens by dendritic cells to T cell clones. Intact protein is presented best by immature, epidermal Langerhans cells. J. Exp. Med. 169:1169.[Abstract/Free Full Text]
  46. Stossel, H., Koch, F., Kampgen, E., Stoger, P., Lenz, A., Heufler, C., Romani, N. and Schuler, G. 1990. Disappearance of certain acidic organelles (endosomes and Langerhans cell granules) accompanies loss of antigen processing capacity upon culture of epidermal Langerhans cells. J. Exp. Med. 172:1471.[Abstract/Free Full Text]
  47. Suzuki, K., Doi, T., Imanishi, T., Kodama, T. and Tanaka, T. 1997. The conformation of the alpha-helical coiled coil domain of macrophage scavenger receptor is pH dependent. Biochemistry 36:15140.[Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
H. Hemmi, J. Idoyaga, K. Suda, N. Suda, K. Kennedy, M. Noda, A. Aderem, and R. M. Steinman
A New Triggering Receptor Expressed on Myeloid Cells (Trem) Family Member, Trem-Like 4, Binds to Dead Cells and Is a DNAX Activation Protein 12-Linked Marker for Subsets of Mouse Macrophages and Dendritic Cells
J. Immunol., February 1, 2009; 182(3): 1278 - 1286.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
R. A. Joachim, B. Handjiski, S. M. Blois, E. Hagen, R. Paus, and P. C. Arck
Stress-Induced Neurogenic Inflammation in Murine Skin Skews Dendritic Cells Towards Maturation and Migration: Key Role of Intercellular Adhesion Molecule-1/Leukocyte Function-Associated Antigen Interactions
Am. J. Pathol., November 1, 2008; 173(5): 1379 - 1388.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Idoyaga, C. Cheong, K. Suda, N. Suda, J. Y. Kim, H. Lee, C. G. Park, and R. M. Steinman
Cutting Edge: Langerin/CD207 Receptor on Dendritic Cells Mediates Efficient Antigen Presentation on MHC I and II Products In Vivo
J. Immunol., March 15, 2008; 180(6): 3647 - 3650.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
F. Ginhoux, M. P. Collin, M. Bogunovic, M. Abel, M. Leboeuf, J. Helft, J. Ochando, A. Kissenpfennig, B. Malissen, M. Grisotto, et al.
Blood-derived dermal langerin+ dendritic cells survey the skin in the steady state
J. Exp. Med., December 24, 2007; 204(13): 3133 - 3146.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
D. H. Kaplan, M. O. Li, M. C. Jenison, W. D. Shlomchik, R. A. Flavell, and M. J. Shlomchik
Autocrine/paracrine TGF{beta}1 is required for the development of epidermal Langerhans cells
J. Exp. Med., October 29, 2007; 204(11): 2545 - 2552.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Pradhan, J. Genebriera, W. L. Denning, K. Felix, C. A. Elmets, and L. Timares
CD4 T Cell-Induced, Bid-Dependent Apoptosis of Cutaneous Dendritic Cells Regulates T Cell Expansion and Immune Responses
J. Immunol., November 1, 2006; 177(9): 5956 - 5967.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Iezzi, A. Frohlich, B. Ernst, F. Ampenberger, S. Saeland, N. Glaichenhaus, and M. Kopf
Lymph Node Resident Rather Than Skin-Derived Dendritic Cells Initiate Specific T Cell Responses after Leishmania major Infection
J. Immunol., July 15, 2006; 177(2): 1250 - 1256.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. M. Ward, N. S. Stambach, K. Drickamer, and M. E. Taylor
Polymorphisms in Human Langerin Affect Stability and Sugar Binding Activity
J. Biol. Chem., June 2, 2006; 281(22): 15450 - 15456.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S.-S. J. Sung, S. M. Fu, C. E. Rose Jr., F. Gaskin, S.-T. Ju, and S. R. Beaty
A Major Lung CD103 ({alpha}E)-beta7 Integrin-Positive Epithelial Dendritic Cell Population Expressing Langerin and Tight Junction Proteins
J. Immunol., February 15, 2006; 176(4): 2161 - 2172.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. S. Lam, M. K. Mansour, C. A. Specht, and S. M. Levitz
A Model Vaccine Exploiting Fungal Mannosylation to Increase Antigen Immunogenicity
J. Immunol., December 1, 2005; 175(11): 7496 - 7503.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Mao, V. Paharkova-Vatchkova, J. Hardy, M. M. Miller, and S. Kovats
Estrogen Selectively Promotes the Differentiation of Dendritic Cells with Characteristics of Langerhans Cells
J. Immunol., October 15, 2005; 175(8): 5146 - 5151.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
C. L. Bennett, E. van Rijn, S. Jung, K. Inaba, R. M. Steinman, M. L. Kapsenberg, and B. E. Clausen
Inducible ablation of mouse Langerhans cells diminishes but fails to abrogate contact hypersensitivity
J. Cell Biol., May 23, 2005; 169(4): 569 - 576.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
K. Takahara, Y. Yashima, Y. Omatsu, H. Yoshida, Y. Kimura, Y.-S. Kang, R. M. Steinman, C. G. Park, and K. Inaba
Functional comparison of the mouse DC-SIGN, SIGNR1, SIGNR3 and Langerin, C-type lectins
Int. Immunol., June 1, 2004; 16(6): 819 - 829.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
C. Galustian, C. G. Park, W. Chai, M. Kiso, S. A. Bruening, Y.-S. Kang, R. M. Steinman, and T. Feizi
High and low affinity carbohydrate ligands revealed for murine SIGN-R1 by carbohydrate array and cell binding approaches, and differing specificities for SIGN-R3 and langerin
Int. Immunol., June 1, 2004; 16(6): 853 - 866.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
N. S. Stambach and M. E. Taylor
Characterization of carbohydrate recognition by langerin, a C-type lectin of Langerhans cells
Glycobiology, May 1, 2003; 13(5): 401 - 410.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (36)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Takahara, K.
Right arrow Articles by Inaba, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahara, K.
Right arrow Articles by Inaba, K.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?