Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Prechl, J.
Right arrow Articles by Erdei, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prechl, J.
Right arrow Articles by Erdei, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 14, No. 3, 241-247, March 2002
© 2002 Japanese Society for Immunology

Modeling the presentation of C3d-coated antigen by B lymphocytes: enhancement by CR1/2–BCR co-ligation is selective for the co-ligating antigen

József Prechl1,2, Dana C. Baiu3, Attila Horváth1 and Anna Erdei1,2

1 Department of Immunology, Loránd Eötvös University, Pázmány Péter s. 1/C, Budapest, Hungary
2 Research Group of the Hungarian Academy of Sciences, Budapest, Hungary
3 Center of Immunology, Bucharest, Romania

Correspondence to: A. Erdei, Department of Immunology, Loránd Eötvös University, Pázmány Péter s. 1/C, Budapest, Hungary. E-mail: anna.erdai{at}freemail.hu


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
We have used a set of single-chain variable fragment antibodies (sc) genetically fused with an influenza hemagglutinin-derived peptide as a means to investigate the role of CR1 and CR2 in antigen presentation by B cells. When incubated with the B cell lymphoma 2PK3, peptide-containing sc specific for either CR1 or CR1/2 mediated activation of the hemagglutinin peptide-specific T cell line IP-12-7, as assessed by IL-2 production. Efficient presentation was dependent on the binding of the constructs to CR1/2, implying that receptor-mediated endocytosis is responsible for the effect. Cross-linkage of CR1/2 or CD19 by mAb did not increase the extent of T cell activation. However, when CR1/2 was co-ligated with the BCR—using either polyclonal goat anti-mouse IgG or recombinant protein LA—the antigen concentration required to activate T cells decreased by two orders of magnitude. Moreover, this enhancement was selective for the antigen included in these complexes and did not affect the presentation of a free peptide or of antigen bound to CR1/2 excluded from the complexes. These results suggest that B cells may bind various C3d-coated antigens at a time, but only the one which reacts with the BCR will be processed with high efficiency. This mechanism may ensure the specificity of cognate T cell help.

Keywords: antigen presentation, B lymphocytes, complement


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Activation of any pathway of complement will lead to the generation of the C3 convertase complex, hence to deposition of C3 fragments on the antigen, induction of inflammatory stimuli, and recruitment and activation of immune-competent cells. Genetic or biochemical coupling of C3 activation products to antigen and immune complexes have been shown to beneficially influence the immune response by (1,2). Various forms of complement or complement receptor deficiencies also point to the role which complement-mediated opsonization plays (3), particularly in T-dependent immune responses. These events thus form the basis of effective triggering of the adaptive arm of the immune response.

Mature murine B cells bear two receptors, both encoded by the same gene Cr2, for the activation products of C3 and C4 (4–6). CR1 (CD35, 190 kDa) binds C3b, iC3b, C3d,g, C3d, C4b and C4d (7), while CR2 (CD21, 150 kDa) binds iC3b, C3d,g and C3d (8). Complement-coated antigen can therefore bind to all mature B cells, irrespective of their clonal specificity. Antigen–C3d complexes will also be able to co-ligate the BCR and CR2 in the subset of B cells that recognizes the immune complex via their BCR. This event has been shown to decrease the affinity threshold required for signaling (9), thereby increasing the efficiency of activation of antigen-specific B cell clones. During the initial phase of an immune response, however, most B cells encountering C3d-coated antigens will not be specific for that particular antigen. Although these B cells can efficiently present antigen bound to CR2 in vitro (10–12), the in vivo relevance of this process is not known, because resting B cells express low numbers of class II MHC and co-stimulatory molecules which renders them poor antigen-presenting cells (APC).

Previously we have described a model antigen that constitutes a single-chain antibody fragment (sc) and an influenza hemagglutinin (HA)-derived overlapping B/T cell epitope (13). The sc targets the molecule to CR1/2, while the HA317–342 intersubunit peptide (IP) serves as a model antigen allowing us to assess the efficiency of internalization, processing and presentation by measuring the activation of a peptide specific T cell hybrid. Utilizing CR1- and CR1/2-specific sc and secondary antibodies or protein LA (pLA), we imitate the encounter of antigen-specific and non-specific B cells with CR1/2 ligand-bearing antigen. Our results confirm that antigen needs to be recognized by the BCR in order to achieve most efficient activation of Th cells and further suggest that this is the result of improved trafficking of antigen from the BCR–CR1/2 complexes to MHC II molecules.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cell lines and antibodies
The murine B cell lymphoma 2PK3 (ATTC TIB 203) was used for antigen presentation assays. The T cell hybridoma IP-12-7 was created from the spleen of HA317–341 peptide-immunized BALB/c mice (14). Cells were cultured in RPMI 1640 medium supplemented with 5% heat-inactivated FCS, 50 µM ß-mercaptoethanol, 100 U/ml penicillin, 100 U/ml streptomycin, 2 mM glutamine and 1 mM sodium pyruvate.

The CR1/2-specific hybridomas 7G6, 7E9 and 8C12 were a kind gift from Dr T. Kinoshita (15). The hybridoma producing the antibody against myc-tag 9E10 was a kind gift from John de Kruif (AZU, Utrecht). mAb ID3, specific for CD19, was from PharMingen (San Diego, CA). Goat anti-mouse (GAM) {gamma} and pLA were purchased from Sigma-Aldrich (Budapest, Hungary), isotype-specific GAM{gamma}1 and GAM{gamma}2a were from Southern Biotechnology (Birmingham, AL).

Generation and expression of CR1/2-specific and control constructs
The CR1-specific IP-8c12sc was generated from the hybridoma 8C12 and the influenza strain A/PR/8/34 exactly as described for IP-7G6sc (13), using the primers: rat C{kappa}, ccagttgctaactgttccg; VH3, ggaggagacggtgaccggggtccgcggccgc; VL5, ccatggacattgagctcacc; VL3, agagcc acctccgcctgaaccgcctccacctttgatttccaccttggtcc; and VH5, ggcggaggtggctctggcggtggcggatcgcaggtgcagctggaggagtcagg.

Light and heavy chain variable fragments were joined by overlap extension PCR and subcloned into the expression vector pET11c. The control sc construct IP-H22sc, specific for the human CD64 molecule, was created on the basis of the humanized m22 coding plasmids (16), a kind gift from Medarex (Milpitas, CA). The region coding for the intersubunit region of the HA (317–342) was cloned from the influenza strain A/PR/8/34, then subcloned into the N-terminal position of all the sc constructs exactly as described (13). IP-7G6sc-mycless was generated by replacing the 3' NotI–BamHI fragment, coding for the myc-tag, hexahistidine-tag and a translation stop codon, by the linker: NotHHBam, ggccgcacaccatcaccatcaccattgag; BamHHNot, gatcctcaatggtgatgg-tgatggtgtgc, which codes for a hexahistidine-tag and a translation stop codon. The absence of the myc-tag and the presence of the hexahistidine-tag was confirmed by Western blotting.

Sequences of the variable regions of 7G6 and 8C12 have been deposited at GenBank (AF214704, AF220555, AF220556 and AF220557).

The technique for refolding the sc was described in detail (13). Purity was assessed on Coomassie-stained acrylamide gels; concentration was determined by OD280 measurement using molar extinction coefficients calculated from the protein sequence.

The P4 peptide corresponding to a subdominant BALB/c T cell epitope—amino acids 317–329 of the HA of influenza strain A/PR/8/34 (VTGLRNIPSIQS)—was synthesized by Gábor Tóth (Department of Medical Chemistry, University of Szeged, Hungary).

Flow cytometry
2PK3 cells (2x105/tube) were serially incubated for 20 min on ice with sc, 9E10 hybridoma supernatant and a goat anti-mouse–biotin conjugate (Southern Biotechnology). Cells were then stained with Extravidin–phycoerythrin (Sigma-Aldrich) and analyzed on a FACSCalibur flow cytometer using CellQuest software.

Antigen presentation assay
2PK3 cells were used as APC at 2x104 cells/well in U-bottom 96-well Costar plates. Antigens were incubated at the indicated concentrations in 100 µl volume with the APC for 3 h. Cells were then washed twice and the T cell clone IP-12-7 was added at 2x104 cells/well in 100 µl. The 16–20 h culture supernatants were frozen at –20°C till IL-2 analysis. Survival of the IL-2-dependent CTLL-2 cells was measured by MTT assay. Data are expressed as the mean ± SD of triplicate or quadruplicate measurements and are representative of at least three independent experiments with essentially identical results.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
CR1/2 mediates uptake and processing of its ligands
In order to assess the role of murine CR1/2 in antigen uptake by B cells we have generated a set of sc molecules genetically coupled with an influenza HA-derived peptide. In a previous study we have shown that the T cell epitope contained in the peptide was presented after incubating a CR1/2-specific construct (IP-7G6sc) with APC (13). Here, we generated two more sc molecules, one specific for murine CR1 (IP-8C12sc) and another without murine specificity (IP-H22sc). Figure 1Go shows the binding of these constructs to the murine B cell lymphoma, 2PK3, which we used as APC. These constructs allowed the comparison of the efficiency of presentation of antigen which bound to CR1 or CR1 and CR2 or did not bind to any cell surface structure. As seen in Fig. 2(A)Go, IP-7G6sc was able to elicit activation of a peptide-specific T cell clone at concentrations two orders of magnitude lower than IP-8C12, while the control construct IP-H22 was only slightly activatory at the highest tested concentrations. Blockade of the respective receptors by sc not bearing the IP peptide abolished this advantage (shown in Fig. 2Go), indicating that CR1/2-mediated endocytosis of the constructs is responsible for the enhanced presentation.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1. Binding of sc constructs to 2PK3 cells. 2PK3 cells were incubated with secondary antibodies only (filled histogram), IP-H22sc (thin line), IP-8C12sc (dashed line) or with IP-7G6sc (thick line), 0.5 µM each. Secondary antibodies used for detection were 9E10, GAM{gamma}1–biotin and streptavidin–phycoerythrin conjugate. Live cells were gated on the basis of light scatter characteristics.

 


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. CR1 and CR2 mediates presentation of its ligands. 2PK3 cells were incubated with the indicated concentrations of antigen for 3 h, washed and mixed with IP-12-7 T cells. Supernatants from 16–20 h cultures were assayed for IL-2 content (A). To prove receptor-dependent uptake of the constructs by 2PK3 cells, we first blocked CR1/2 with 1 µM 7G6sc (B) or 8C12sc (C), then the IP carrying sc were added at the indicated concentrations.

 
Cross-linkage of CR1/2 does not influence the presentation of its ligands
Since the constructs are monovalent with respect to receptor binding, we do not expect them to have any receptor triggering ability. Consequently, the effect seen in Fig. 2Go is most probably the result of the constitutive endocytosis of CR1/2. As oligomerization may influence endocytosis or post-endocytotic sorting steps, we tested the effect of cross-linking CR1/2 by various means. In our first approach we used the mAb 9E10, which recognizes the C-terminal myc-tag of the constructs, as a primary antibody and various GAM IgG secondary antibodies. Taking advantage of the fact that 2PK3 cells carry IgG2a as surface Ig and the myc-tag directed murine mAb 9E10 is of the IgG1 subclass, by choosing an appropriate secondary antibody we could extensively cross-link CR1/2, or independently cross-link CR1/2 and the BCR, or co-ligate CR1/2 with the BCR.

Treatment of APC with 9E10 alone did improve the efficiency of presentation (Fig. 3Go). The improvement was, however, also seen in the case of the control construct IP-H22sc and found to be sensitive to FcR blockers (data not shown), suggesting that it was not a CR1/2 but rather an FcR-mediated enhancement. Extensive cross-linkage of IP-7G6sc or 8C12sc and 9E10 by the addition of IgG1-specific goat antibodies (GAM{gamma}) did not enhance antigen presentation (Fig. 3A and BGo). The finding that CR1/2-mediated uptake cannot be triggered by its ligands was strengthened by further observations with mAb 7E9 that interacts with CR1/2 outside of the binding site of 7G6 and 8C12. Moreover, mAb 1D3, recognizing CD19, the signal transducer molecule in the CR1/2/CD19/CD81 complex, was also unable to improve the presentation of the IP peptide (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3. Co-ligation of CR1 and CR2 with the BCR results in most efficient presentation. 2PK3 cells and the indicated suboptimal concentrations of IP-7G6sc (A) or IP-8C12sc (B) were incubated alone, with 9E10 or with 9E10 and GAM{gamma} antibodies of different specificities: GAM{gamma}, goat anti-mouse IgG; GAM{gamma}1, goat anti-mouse IgG1; GAM{gamma}2a, goat anti-mouse IgG2a. Activation of T cells was measured as described for Fig. 2Go.

 
Co-ligation of the BCR significantly enhances presentation of CR1 and CR1/2 ligands
Next we investigated the cooperation between the BCR and CR1/2. Evidence that loaded CR1/2 co-caps with the ligated BCR (17) and that CR1/2 is tyrosine phosphorylated upon BCR stimulus (18) suggests that CR1/2 complexes inducibly associate with the BCR complex. Therefore we cross-linked, independent of CR1/2, surface Ig of 2PK3 cells by GAM{gamma}2a antibody. This treatment did not improve presentation of CR1/2 targeted constructs (Fig. 3A and BGo).

Then we tested GAM{gamma} antibodies, which recognize epitopes common to both the surface IgG and 9E10, and are therefore capable of co-ligating sc loaded CR1/2 and the BCR. Addition of GAM{gamma} stimulated the presentation of both complement receptor-specific constructs in the presence of the anti-myc antibody, inducing IL-2 production at antigen concentrations that were otherwise not stimulatory (Fig. 3A and BGo).

Since 9E10 can bind to Fc{gamma}RII, we aimed to exclude the possibility that the presence of this receptor in the co-ligated BCR–CR1/2 complex is required for enhanced antigen presentation. We therefore also tested the influence of recombinant pLA on the efficiency of antigen presentation. pLA has four {kappa} chain variable regions and four heavy chain binding sites, and is therefore capable of linking the sc constructs and the BCR. As expected, addition of pLA to IP-7G6sc significantly improved the activation of T cells (Fig. 4AGo). The efficiency of presentation of IP-8C12sc, however, was not affected (Fig. 4BGo)—an observation that may reflect the different binding affinity of pLA to various {kappa} chain subclasses.



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 4. The effect of pLA on antigen presentation. To exclude the participation of Fc{gamma}R in antigen uptake, recombinant pLA was also tested as a co-ligating agent for IP-8C12sc (A) or IP-7G6sc (B). To examine the effect of BCR–CR1/2 co-ligation on the presentation of the free peptide, 2PK3 cells were loaded with P4 peptide with or without pretreating the cells with 7G6sc and pLA (C). Activation of T cells was measured as described for Fig. 2Go.

 
BCR–CR1/2 co-ligation only affects the fate of antigen included in the receptor complex
The above results might be the outcome of increased expression of MHC II and co-stimulatory molecules, induced by BCR–CR1/2 co-ligation. If this was the sole reason, a general improvement in antigen presentation efficiency, regardless of the source of antigen, would be observed. To test this, we compared the ability of untreated and BCR–CR1/2 co-ligated 2PK3 cells to present the peptide P4, which—by virtue of its ability to associate with MHC II—is a good activator of the IP-12-7 T cell clone. Treatment of APC with 7G6sc and pLA did not alter the efficiency of presentation (Fig. 4CGo), suggesting that mechanisms other than increased MHC II or B7 expression are responsible for the effects of co-ligation.

To investigate the influence of BCR–CR1/2 co-ligation on the fate of antigens bound to CR1/2 outside the clustered complex, we generated IP-7G6sc-mycless. This construct lacks the C-terminal myc-tag and is therefore not recruited to the BCR by the addition of 9E10 and GAM{gamma}. Thus, loading the B cells with 7G6sc (a construct that lacks the antigenic peptide IP but carries a myc-tag) and adding 9E10 and GAM{gamma} will result in the co-ligation of BCR and those CR1/2 that do not carry the antigen, leaving IP-7G6sc-mycless carrying CR1/2 outside the receptor clusters (Fig. 5AGo). Figure 5(B)Go shows that co-ligation of BCR and CR1/2 does not affect the fate of CR1/2 ligands not recruited to the BCR.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5. Co-ligation of BCR and CR1/2 only affects the fate of antigen within the complex. (A) Schematic representation of the experimental set-up for examining the fate of ligands on free CR1/2 with concomitant BCR–CR1/2 co-ligation. Constructs carrying the model antigen IP are not included in the co-ligated BCR–CR1/2 complexes. (B) 2PK3 cells were loaded with IP-7G6sc-mycless, with or without equimolar amounts of 7G6sc and the indicated secondary antibodies. Activation of T cells was measured as described for Fig. 2Go.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
We have used antigenized, murine CR1/2 targeted sc to model the events following encounter of complement opsonized antigen by B cells. The I-Ed-restricted T cell epitope, corresponding to the influenza virus HA317–329 sequence, was engineered to complement receptor-specific (7G6, 8C12) and a control (IP H22) sc by an identical linker sequence in all three constructs. Therefore differences in the efficiency of peptide presentation by the CR1/2+ murine B cell line 2PK3 can be ascribed to differences in the kinetics and/or means of cellular entry. Our data show that CR1/2 targeted antigens have an advantage in entering MHC II+ vesicles over antigens taken up in a non-specific fashion by the B cell (Fig. 2Go). The sequence of the cytoplasmic domain of murine CR1/2 (4,19) contains a YxxO endosomal targeting motif (i.e. amino acids 733–735 of CR2: YNPA) which is presumably responsible for the intracellular targeting of the receptor and its ligands. Yet, cross-linking CR1/2 by various means did not enhance the presentation of its ligands (Fig. 3Go), a fact implying that the role of these receptors is not antigen uptake.

The different performance of CR1 targeted IP-8C12sc and CR1/2 targeted IP-7G6sc, and also of the two parental antibodies (20,21), can be caused either by differences in cell surface density or function of CR1 and CR2 or by factors intrinsic to the interaction of the antibodies with the receptors, such as binding site and/or affinity. The finding that both CR1 and CR2 are tyrosine phosphorylated after BCR cross-linkage (18) and that both CR1 and CR2 associate with murine CD19 (22) strengthens the assumption that the two receptors—except for the factor I cofactor activity of CR1—function in an identical way. Thus IP-8C12sc is presumably less efficient due to its lower affinity or the weaker expression of CR1, as implied by Fig. 1Go.

By virtue of its FcR binding ability mAb 9E10 can target the constructs to Fc{gamma}RII expressed by 2PK3 cells. Although this is an inhibitory receptor that hinders BCR-mediated antigen uptake (23,24), enhancement of BCR-independent antigen presentation by Fc{gamma}RII has also been reported (25) and may be responsible for our present observation.

Human CR2 has also been shown to be capable of mediating internalization of its ligand and directing it to MHC II+ organelles (26), resulting in efficient presentation of complement-opsonized antigen (11,27). Although all B cells were able to present antigen–C3d complexes to T cell lines, only those specific for the antigen became antibody producing cells, confirming the need for BCR-mediated activation of B cells in order to receive help from T cells (28). The suggested role of non-specific antigen uptake via the CR2 was the activation of memory T cells. In vivo, however, it is the antigen-specific B cells that migrate to the edge of follicles and have a chance of interacting with activated T cells (29). BCR triggering therefore seems necessary both to render a particular B cell sensitive to chemokines which orchestrate cell movement during an immune response, and to up-regulate MHC II and co-stimulatory molecules. Furthermore, BCR clustering results in redistribution of the MHC class II molecules, an event that presumably aims the effective MHC class II coupling and subsequent presentation of the BCR ligand (30,31). Complement-coupled antigen is more efficient in triggering B cells specific for the antigen, by its ability to co-ligate CR2 and the BCR, and thereby lowering the threshold for effective BCR-mediated activation (9,32). Simultaneous recognition by the BCR and CR1/2 will thus result in both efficient triggering of the B cell, and acquisition and presentation of the ligand. We show that by co-ligating CR1/2 with the BCR via the sc–peptide construct, i.e. modeling recognition of C3d-coated antigen by a specific B cell, the antigen will be at least 100-fold more efficiently presented, compared to antigens bound solely to CR1/2. Co-ligation of the BCR with CR1/2 augments signaling via the BCR (9) by stabilizing it in lipid rafts (33).

The observation that the efficiency of presentation of the free peptide P4 could not be improved by BCR–CR1/2 co-ligation may be unique to our experimental system as 2PK3 cells have an activated phenotype. Indeed, in a recent study Cherukuri et al. (34) showed that CH27 cells present antigen taken up by fluid-phase pinocytosis when the BCR and CR1/2 were co-ligated. Besides up-regulation of MHC II and co-stimulatory molecules, a different way of enhancing the presentation of BCR–CR1/2 bound antigen could be the selective, improved trafficking and processing inside the B cell. This mechanism is suggested by findings that when encountering antigen which co-engaged the BCR and CR1/2, cells showed an increase in the absolute number of antigenic peptide–MHC II complexes (34). As B cells may capture several different C3d-coated antigens at a time, a particular B cell encountering an antigen that reacts with its BCR may already bear others on its CR1/2. Our results with IP-7G6sc-mycless, however, suggest that only the antigen that physically co-ligates the BCR and CR1/2 will be presented with preference. This observation also implies that CR1/2 exists in the membrane in a monomeric form, since dimers or oligomers bearing both 7G6sc and IP-7G6sc-mycless would have recruited the antigen to the BCR. These data indicate that BCR–CR1/2 co-ligation improves antigen presentation by selective trafficking of the BCR–CR1/2 ligand to MHC II vesicles. As BCR–CR1/2 co-ligation is thought to be a crucial activatory signal for resting B cells to become potent APC, we assume that in vivo CR1/2-mediated antigen uptake only plays a role in antigen presentation if the BCR is also engaged, i.e. in the case of antigen-specific B cells.


    Acknowledgments
 
The excellent technical assistance of Zsuzsa Szabó and Erzsébet Veress is acknowledged. The authors also wish to thank Éva Rajnavölgyi and István Kurucz for helpful discussions, and Bence Réthy for the IL-2-dependent cell line. This work was supported in part by grants OTKA T034876 and OTKA T030813, and from the Copernicus Fixed Contribution Contract CIPA CT 94-0152.


    Abbreviations
 
APC antigen-presenting cell
GAM goat anti-mouse
HA hemagglutinin
IP intersubunit peptide
pLA protein LA
sc single-chain variable fragment antibody
Received 9 September 2001, accepted 16 November 2001.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Dempsey, P. W., Allison, M. E. D., Akkaraju, S., Goodnow, C. C. and Fearon, D. T. 1996. C3d of complement as a molecular adjuvant: bridging innate and acquired immunity. Science 271:348.[Abstract]
  2. Villiers, M., Villiers, C. L., Laharie, A. and Marche, P. N. 1999. Amplification of the antibody response by C3b complexed to antigen through an ester link. J. Immunol. 162:3647.[Abstract/Free Full Text]
  3. Carroll, M. C. and Fischer, M. B. 1997. Complement and the immune response. Curr. Opin. Immunol. 9:64.[Web of Science][Medline]
  4. Fingeroth, J. D., Benedict, M. A., Levy, D. N. and Strominger, J. L. 1989. Identification of murine complement receptor type 2. Proc. Natl Acad. Sci. USA 86:242.[Abstract/Free Full Text]
  5. Kurtz, C. B., O'Tool, E., Christensen, S. M. and Weis, J. H. 1990. The murine complement receptor gene family(IV). Alternative splicing of Cr2 gene transcripts predicts two distinct products that share homologous domains with both human CR2 and CR1. J. Immunol. 144:3581.[Abstract]
  6. Molina, H., Kinoshita, T., Inoue, K., Carel, J. C. and Holers, V. M. 1990. A molecular and immunochemical characterization of mouse CR2. J. Immunol. 145:2974.[Abstract]
  7. Molina, H., Kinoshita, T., Webster, C. B. and Holers, V. M. 1994. Analysis of C3b/C3d binding sites and factor I cofactor regions within mouse complement receptors 1 and 2. J. Immunol. 153:789.[Abstract]
  8. Pramoonjago, P., Takeda, J., Kim, Y. U., Inoue, K. and Kinoshita, T. 1993. Ligand specificities of mouse complement receptor type 1 (CR1) and 2 (CR2) purified from spleen cells. Int. Immunol. 5:337.[Abstract/Free Full Text]
  9. Fearon, D. T. and Robert, H. C. 1995. The CD19/CR2/TAPA-1 complex of B lymphocytes: linking natural to acquired immunity. Annu. Rev. Immunol. 13:127.[Web of Science][Medline]
  10. Boackle, S. A., Holers, V. M. and Karp, D. R. 1997. CD21 augments antigen presentation in immune individuals. Eur. J. Immunol. 27:122.[Web of Science][Medline]
  11. Thornton, B. P., Vetvicka, V. and Ross, G. D. 1994. Natural antibody and complement-mediated antigen processing and presentation by B lymphocytes. J. Immunol. 152:1727.[Abstract]
  12. Baiu, D. C., Prechl, J., Tchorbanov, A., Molina, H. D., Erdei, A., Sulica, A., Capel, P. J. A. and Hazenbos, W. L. W. 1999. Modulation of the humoral immune response by antibody-mediated antigen targeting to complement receptors and Fc receptors. J. Immunol. 162:3125.[Abstract/Free Full Text]
  13. Prechl, J., Tchorbanov, A., Horváth, A., Baiu, D. C., Hazenbos, W. L. W., Kurucz, I., Rajnavölgyi, É., Capel, P. J. A. and Erdei, A. 1999. Targeting of influenza epitopes to murine CR1/2 using single chain antibodies. Immunopharmacology 42:159.[Web of Science][Medline]
  14. Rajnavölgyi, É., Nagy, Z., Kurucz, I., Gogolák, P., Tóth, G. K., Váradi, Gy., Penke, B., Tigyi, Z., Hollósi, M. and Gergely, J. 1994. T cell recognition of the posttranslationally cleaved intersubunit region of influenza virus hemagglutinin. Mol. Immunol. 31:14403.
  15. Kinoshita, T., Thyphronitis, G., Tsokos, G. C., Finkelman, F. D., Hong, K., Sakai, H. and Inoue, K. 1990. Characterization of murine complement receptor type 2 and its immunological cross-reactivity with type 1 receptor. Int. Immunol. 2:651.[Abstract/Free Full Text]
  16. Graziano, R. F., Tempest, P. R., White, P., Keler, T., Deo, Y., Ghebremariam, H., Coleman, K., Pfeffercorn, L. C., Fanger, M. W. and Guyre, P. M. 1995. Construction and characterization of a humanized anti-{gamma}-Ig receptor type I (Fc{gamma}RI) monoclonal antibody. J. Immunol. 155:4996.[Abstract]
  17. Tsokos, G. C., Kinoshita, T., Thyphronitis, G., Patel, A. D., Dickler, H. B. and Finkelman, F. D. 1990. Interactions between murine B lymphocyte surface membrane molecules. Loaded but not free receptors for complement and the Fc portion of IgG co-cap independently with cross-linked surface Ig. J. Immunol. 144:239.[Abstract]
  18. Venkataraman, C., Lu, P., Buhl, A. M., Chen, C., Cambier, J. C. and Bondada, S. 1998. CD72-mediated B cell activation involves recruitment of CD19 and activation of phosphatidylinositol 3-kinase. Eur. J. Immunol. 28:3003.[Web of Science][Medline]
  19. Kurtz, C. B., Paul, M. S., Aegerter, M., Weis, J. J. and Weis, J. H. 1989. Murine complement receptor gene family (II). Identification and characterization of the murine homolog (Cr2) to human CR2 and its molecular linkage to crry. J. Immunol. 143:2058.[Abstract]
  20. Heyman, B., Wiersma, E. J. and Kinoshita, T. 1990. In vivo inhibition of the antibody response by a complement-receptor specific monoclonal antibody. J. Exp. Med. 172:665.[Abstract/Free Full Text]
  21. Wiersma, E. J., Kinoshita, T. and Heyman, B. 1991. Inhibition of immunological memory and T-independent responses by monoclonal antibodies specific for murine complement receptors. Eur. J. Immunol. 21:2501.[Web of Science][Medline]
  22. Krop, I., Shaffer, A. L., Fearon, D. T. and Schlissel, M. S. 1996. The signaling activity of murine CD19 is regulated during B cell development. J. Immunol. 157:48.[Abstract]
  23. Minskoff, S. A., Mater, K. and Mellman, I. 1998. Fc{gamma}RII-B1 regulates the presentation of B cell receptor-bound antigens. J. Immunol. 161:2079.[Abstract/Free Full Text]
  24. Wagle, N. M., Faassen, A. E., Kim, J. H. and Pierce, S. K. 1999. Regulation of B cell receptor-mediated MHC class II antigen processing by Fc{gamma}RIIB1. J. Immunol. 162:2732.[Abstract/Free Full Text]
  25. Berg, M., Uellner, R. and Langhorne, J. 1997. Fc{gamma} receptor II dependency of enhanced presentation of major histocompatibility complex class II peptides by a B cell lymphoma. Eur. J. Immunol. 27:1022.[Web of Science][Medline]
  26. Hess, M. W., Schwendinger, M. G., Eskelinen, E., Pfaller, K., Pavelka, M., Dierich, M. P. and Prodinger, W. M. 2000. Tracing uptake of C3dg-conjugated antigen into B cells via complement receptor type II (CR2, CD21). Blood 95:2617.[Abstract/Free Full Text]
  27. Boackle, S. A., Morris, M. A., Holers, V. M. and Karp, D. R. 1998. Complement opsonization is required for presentation of immune complexes by resting peripheral blood B cells. J. Immunol. 161:6537.[Abstract/Free Full Text]
  28. Thornton, B. P., Vetvicka, V. and Ross, G. D. 1996. Function of C3 in a humoral response: iC3b/C3dg bound to an immune complex generated with natural antibody and a primary antigen promotes antigen uptake and the expression of co-stimulatory molecules by all B cells, but only stimulates immunoglobulin synthesis by antigen-specific B cells. Clin. Exp. Immunol. 104:531.[Web of Science][Medline]
  29. Garside, P., Ingulli, E., Merica, R. R., Johnson, J. G., Noelle, R. J. and Jenkins, M. K. 1998. Visualization of specific B and T lymphocyte interactions in the lymph node. Science 281:96.[Abstract/Free Full Text]
  30. Siemasko, K., Eisfelder, B. J., Williamson, E., Kabak, S. and Clark, M. R. 1998. Signals from the B Lymphocyte antigen receptor regulate MHC class II containing late endosomes. J. Immunol. 160:5203.[Abstract/Free Full Text]
  31. Zimmermann, V. S., Rovere, P., Trucy, J., Serre, K., Machy, P., Forquet, F., Leserman, L. and Davoust, J. 1999. Engagement of B cell receptor regulates the invariant chain-dependent MHC class II dependent presentation pathway. J. Immunol. 162:2495.[Abstract/Free Full Text]
  32. Tedder, T. F., Inaoki, M. and Sato, S. 1997. The CD19–CD21 complex regulates signal transduction thresholds governing humoral immunity and autoimmunity. Immunity 6:107.[Web of Science][Medline]
  33. Cherukuri, A., Cheng, P. C., Sohn, H. W. and Pierce, S. K. 2001. The CD19/CD21 complex functions to prolong B cell antigen receptor signaling from lipid rafts. Immunity 14:169.[Web of Science][Medline]
  34. Cherukuri, A., Cheng, P. C. and Pierce, S. K. 2001. The role of the CD19/CD21 complex in B cell processing and presentation of complement-tagged antigens. J. Immunol 167:163.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Int ImmunolHome page
S. L. Brown, D. V. Barrault, A. Phythian-Adams, and A. M. Knight
Lack of induced co-stimulation as a result of complement receptor 2 (CR2) ligation on mouse splenic B cells
Int. Immunol., January 1, 2006; 18(1): 69 - 78.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
K. Li, H. Patel, C. A. Farrar, R. E.G. Hargreaves, S. H. Sacks, and W. Zhou
Complement Activation Regulates the Capacity of Proximal Tubular Epithelial Cell to Stimulate Alloreactive T Cell Response
J. Am. Soc. Nephrol., September 1, 2004; 15(9): 2414 - 2422.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. V. Barrault and A. M. Knight
Distinct Sequences in the Cytoplasmic Domain of Complement Receptor 2 Are Involved in Antigen Internalization and Presentation
J. Immunol., March 15, 2004; 172(6): 3509 - 3517.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
G. Greicius, L. Westerberg, E. J. Davey, E. Buentke, A. Scheynius, J. Thyberg, and E. Severinson
Microvilli structures on B lymphocytes: inducible functional domains?
Int. Immunol., February 1, 2004; 16(2): 353 - 364.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M.-B. Villiers, P. N. Marche, and C. L. Villiers
Improvement of long-lasting response and antibody affinity by the complexation of antigen with complement C3b
Int. Immunol., January 1, 2003; 15(1): 91 - 95.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (18)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Prechl, J.
Right arrow Articles by Erdei, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prechl, J.
Right arrow Articles by Erdei, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?