Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (10)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Hálová, I.
Right arrow Articles by Dráber, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hálová, I.
Right arrow Articles by Dráber, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 14, No. 2, 213-223, February 2002
© 2002 Japanese Society for Immunology

A novel lipid raft-associated glycoprotein, TEC-21, activates rat basophilic leukemia cells independently of the type 1 Fc{varepsilon} receptor

Ivana Hálová, Lubica Dráberová and Petr Dráber

Department of Mammalian Genes Expression, Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, Vídenská 1083, 142 20 Prague 4, Czech Republic

Correspondence to: P. Dráber; E-mail: draberpe{at}biomed.cas.cz


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Recent data suggest that initiation of signal transduction via type 1 Fc{varepsilon} receptor (Fc{varepsilon}RI) and other immunoreceptors is spatially constrained to lipid rafts. In order to better understand the complexity and function of these structures, we prepared mAb against lipid rafts from the rat basophilic leukemia cell line, RBL-2H3, which is extensively used for analysis of Fc{varepsilon}RI-mediated activation. One of the antibodies was found to recognize a novel glycosylphosphatidylinositol-anchored plasma membrane glycoprotein of 250 amino acids, designated TEC-21, containing a cysteine-rich domain homologous to those found in the urokinase plasminogen activator receptor/Ly-6/snake neurotoxin family. TEC-21 is abundant on the surface of RBL-2H3 cells (>10 6 molecules/cell), but is absent in numerous rat tissues except for testes. Aggregation of TEC-21 on RBL-2H3 cells induced a rapid increase in tyrosine phosphorylation of several substrates including Syk kinase and LAT adaptor, calcium flux, and release of secretory components. Similar but more profound activation events were observed in cells activated via Fc{varepsilon}RI. However, aggregation of TEC-21 did not induce changes in density of IgE–Fc{varepsilon}RI complexes, tyrosine phoshorylation of Fc{varepsilon}RI ß and {gamma} subunits, and co-aggregation of Lyn kinase. TEC-21-induced activation events were also observed in Fc{varepsilon}RI- mutants of RBL-2H3 cells. Thus, TEC-21 is a novel lipid raft component of RBL-2H3 cells whose aggregation induces activation independently of Fc{varepsilon}RI.

Keywords: basophil, IgE receptor, Lyn kinase, mast cell, Syk kinase


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Aggregation of the type 1 Fc{varepsilon} receptor (Fc{varepsilon}RI) on mast cells and basophils triggers activation pathways resulting in a release of secretory mediators and cytokines. The first biochemical step in this pathway is tyrosine phosphorylation of Fc{varepsilon}RI ß and {gamma} subunits. It has been established in the 2H3 subline of rat basophilic leukemia (RBL) cells, which have been extensively used as a model system for analysis of Fc{varepsilon}RI-mediated activation, that the Src family protein tyrosine kinase Lyn is the key enzyme in this process (1–4). However, the detailed molecular mechanism of how Lyn interacts with the receptor is only partially understood and two models are at present considered. According to the `protein–protein' model, a fraction of Lyn is somehow associated with Fc{varepsilon}RI in quiescent cells. The binding of a multivalent antigen to IgE–Fc{varepsilon}RI complexes results in aggregation of the receptors and associated kinases, which allows more efficient tyrosine phosphorylation by transphosphorylation (2).

An alternative model has recently been suggested, which postulates that Lyn is not pre-associated with Fc{varepsilon}RI, but instead is sequestered into specialized detergent-resistant membrane microdomains, called lipid rafts, which are enriched in glycosphingolipids, cholesterol, glycosylphosphatidylinositol (GPI)-anchored proteins, Src family kinases and some other signal-transducing molecules (5,6). Aggregation brings Fc{varepsilon}RI into these lipid rafts where it is phosphorylated by lipid raft-associated Lyn kinase (7,8). Although the role of lipid rafts in signal transduction was confirmed for other immunoreceptors on T cells (9–11) and B cells (12), molecular mechanisms underlying the integration of lipid raft components with immunoreceptors, as well as their composition, are only incompletely explained (for review, see 13).

A role for lipid rafts in the initiation of mast cell activation was suggested by earlier studies indicating that the aggregation of a lipid raft component, the Thy-1 glycoprotein (gp), induced cell activation events which resembled Fc{varepsilon}RI-mediated activation events, although they were lower in extent and were observed even in mutant cells defective in the expression of surface Fc{varepsilon}RI (14–17). Furthermore, it has been observed that glycosphingolipid-specific mAb 2B5 induces the release of secretory components and redistribution of fluorescently labeled IgE similar to that produced by antigen-mediated aggregation of Fc{varepsilon}RI (18). Because this effect was observed only in IgE-sensitized cells, it seems that the activation induced by 2B5 mAb is mediated via aggregated Fc{varepsilon}RI–IgE complexes (18). Different results were obtained with the AA4 mAb, which binds an {alpha}-galactosyl derivative of ganglioside GD1b (19,20). Although this mAb induced tyrosine phosphorylation of Fc{varepsilon}RI ß and {gamma} subunits, Syk kinase, and other substrates, its activity was blocked when Fc{varepsilon}RI was saturated with IgE or when F(ab')2 fragments of AA4 mAb were used, suggesting that direct aggregation of Fc{varepsilon}RI and GD1b is involved (21).

In an attempt to elucidate the complexity of lipid rafts and their role in mast cell activation we prepared mAb against lipid rafts from RBL-2H3 cells and characterized the target antigens. In this study we describe a novel lipid raft-associated gp, TEC-21, which belongs to the urokinase plasminogen activator receptor (uPAR)/Ly-6/snake neurotoxin family. Its expression in normal tissues seems to be restricted to testes and no evidence of expression in primary mast cells was found. Nevertheless, because of its constitutive inclusion in RBL-2H3 lipid rafts, it provided us the opportunity to study interplay between Fc{varepsilon}RI- and lipid raft-mediated signaling. We found that antibody-mediated aggregation of TEC-21 gp induced cell activation events and we analyzed whether Fc{varepsilon}RI was involved in this process. We also studied the association of TEC-21 gp with Lyn kinase by confocal microscopy and the changes in this association after aggregation of the TEC-21 gp. Our data indicate that aggregated TEC-21, contrary to some other lipid raft components, induced activation independently of Fc{varepsilon}RI.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cells and antibodies
RBL-2H3 cells and Fc{varepsilon}RI-{gamma}- mutants derived therefrom were maintained as monolayer cultures in culture medium as described (15,17). The following mAb were used: anti-Syk (Syk-01/Pr) (22), anti-Fc{varepsilon}RI ß subunit (JRK) (23), TNP-specific IgE (IGEL b4 1) (24), anti-phosphotyrosine, PY-20, conjugated to horseradish peroxidase (HRP; Transduction Laboratories, Lexington, KY). Polyclonal antibodies specific for Syk, LAT and IgE were prepared by immunization of rabbits with recombinant fragments of Syk (22), LAT (P. Tolar and P. Dráber, unpublished) or IGEL b4 1 mAb respectively. Anti-IgE antibody was affinity purified on Sepharose 4B with immobilized IGEL b4 1. Some antibodies were biotinylated with ImmunoPure NHS-LC-biotin (Pierce, Rockford, IL) according to the manufacturer's instructions. Goat anti-mouse IgG conjugated to HRP was obtained from Transduction Laboratories. Cy3-conjugated streptavidin was purchased from Sigma (St Louis, MO).

To prepare TEC-21 mAb, BALB/c mice were immunized with pooled lipid rafts isolated from RBL-2H3 cells lysed in 1% Brij 96 and fractionated by sucrose density-gradient ultracentrifugation as described (25). Hybridoma cells were obtained after fusion of SP02 mouse myeloma cells with spleen cells of immunized mice using standard procedures (26). A mouse mAb isotyping kit (Sigma) was used to determine the Ig isotype. TEC-21 mAb was isolated from culture supernatant or ascitic fluid on a column of UltraLink-immobilized Protein A beads (Pierce). Antibodies isolated by both these procedures had similar properties. F(ab')2 fragments were obtained by standard procedures (27).

Flow cytofluorometry analysis
Cells (106) were stained with saturating concentrations of mAb followed by FITC-labeled anti-mouse IgG. The cells were evaluated by flow cytofluorometry using a FACScan (Becton Dickinson, Mountain View, CA). In some experiments the cells were stained after pretreatment with phosphatidylinositol-specific phospholipase C (PI-PLC) as described (25).

Ca2+ measurements
Cytoplasmic Ca2+ responses were measured with Fura-2 fluorescence probe as described (28). Briefly, cells were harvested and sensitized or not with biotin-labeled TEC-21 mAb (5 µg/ml) or IgE (IGEL b4 1 ascites diluted 1:1000). After 30 min the cells were washed in BSS (20 mM HEPES, pH 7.4, 135 mM NaCl, 5 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2 and 5.6 mM glucose) supplemented with 0.1% BSA and 2.5 mM probenecid, and resuspended at a concentration of 5x106/ml in BSS/0.1% BSA/probenecid containing 2 µM Fura-2-AM (Molecular Probes, Eugene, OR). After incubation for 40 min at 37°C, the cells were washed in BSS/BSA and the concentrations of free intracellular Ca2+ ([Ca2+]i) measured in a luminescence spectrometer LS-50B (Perkin-Elmer, Beaconsfield, UK) with excitation wavelengths 340 and 380 nm, and with constant emission at 510 nm. The values of [Ca2+]i were calculated using the ICBC Calibration Perkin-Elmer Fluorescence Winlab program (Perkin-Elmer).

Immunoaffinity purification and partial amino acid sequencing
RBL-2H3 cells in monolayer cultures were harvested and suspended in BSS/0.1% BSA. Cells were centrifuged and resuspended in ice-cold PBS containing 0.2% saponin. After 10 min on ice the cells were centrifuged at 4000 g for 5 min and resuspended at a concentration 108 cells/ml in ice-cold lysis buffer (25 mM Tris, pH 8.0, 140 mM NaCl, 2 mM EDTA, 1 mM Na3VO4, 1 mM PMSF, 5 µg/ml aprotinin and 2 µg/ml leupeptin) supplemented with 1% NP-40. After 30 min on ice the lysate was centrifuged at 12,000 g for 10 min. Postnuclear supernatants from 109 cells were precleared with Sepharose CL-4B (Amersham Pharmacia Biotech, Uppsala, Sweden) for 1 h at 4°C, followed by immunoprecipitation with TEC-21 mAb, covalently bound to UltraLink-immobilized Protein A by means of 20 mM dimethyl pimelimidate (Sigma) in 0.2 M sodium borate (pH 9.0). After overnight incubation at 4°C, the beads were washed 4 times with ice-cold lysis buffer with 0.5% NP-40 and the proteins were eluted by boiling in 0.5% SDS. To remove N-linked sugar chains, peptide N-glycosidase F (PNGF; New England BioLabs, Beverly, MA) was used. UltraLink-immobilized Protein A beads with bound mAb–TEC-21 gp complexes were boiled in 0.5% SDS. After 5 min the beads were centrifuged and supernatant was supplied with 0.05 M (final concentration) sodium phosphate, 1% NP-40 and 500 U of PNGF per reaction, and incubated at 37°C overnight. After PNGF treatment the samples were reimmunoprecipitated with immobilized TEC-21 mAb for 1 h at 4°C. Proteins were eluted from the beads by boiling in SDS sample buffer without mercaptoethanol, subjected to SDS–PAGE and transferred onto a PVDF membrane (Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. The N-terminal amino acid sequence was determined by automated Edman degradation using a Procise protein sequencing system (Perkin Elmer Applied Biosystems, Foster City, CA).

cDNA cloning and sequencing
Based on the N-terminal amino acid sequence and its similarity to the mouse TES101 cDNA sequence (29), a 5' primer (primer I: ACCCTGAGTCTGGAAGAC) was designed. An oligo(dT)primer, TTCTAGAATTCAGCGGCCGCT(TTT)8x, with an XbaI cloning site (underlined) was used for the reverse transcription step using mouse Moloney virus reverse transcriptase (Gibco/BRL, Gaithersburg, MD) and total RNA isolated from RBL-2H3 cells employing acidic phenol extraction reagent (Tri Reagent; Sigma). The cDNA obtained was used in PCR. The PCR-generated DNA fragment of 0.86 kbp was digested with RsaI and XbaI enzymes, and cloned into SmaI/XbaI-digested pBluescript KSII- (Stratagene, La Jolla, CA). The plasmid was amplified in bacteria and four independent clones were sequenced bidirectionally on an automated sequencer ABI Prism 377 (Perkin Elmer Applied Biosystems). After partial cDNA sequencing two other primers were designed [primer II: TGGCCATCAGTCTGCAGCCGAT (PstI site underlined) and primer III: CTCTAGAACCTTAGAGAAGCCATG (XbaI site underlined)] and used for RT-PCR amplification of the remaining part of the mRNA coding region. The PCR product was digested with PstI and XbaI, cloned into PstI/XbaI-digested pBluescript KSII-, and sequenced. Sequences were analyzed by Vector NTI Suite software (InforMax, North Bethesda, MD) and database searches were performed by the BLAST algorithm.

Cell transfection
The coding region of TEC-21 cDNA was amplified by PCR using appropriate primers (AAAGGATCCGCCACCATGGGAGCCTGCCGC and AAGAATTCCGGTGTCCTCTCAAGGGA) with BamHI and EcoRI restriction sites (underlined) and the optimized ribosome binding site (marked in bold letters). For PCR the proofreading Pfu DNA polymerase (Stratagene, La Jolla, CA) was used. The PCR-generated DNA fragments were digested with the appropriate enzymes and introduced into an expression vector pZeo SV2 (Invitrogen, Groningen, Netherlands). COS cells were transiently transfected with the vector containing TEC-21 cDNA or empty vector using the DEAE–dextran method as described (30). After 48 h the cells were harvested and the surface expression of the TEC-21 gp was evaluated by flow cytofluorometry (see above).

Antibody radioiodination and direct radioantibody binding assay
Labeling of mAb with 125I (ICN Biomedicals, Costa Mesa, CA) by the chloramine T method and direct radioantibody binding assays were performed as described (31). The number of bound molecules per cell at saturation was extrapolated from Scatchard plots (32). All binding assays were performed at least 3 times in triplicates.

Cell activation, immunoprecipitation and immunoblotting
Cells were harvested, resuspended in culture medium at a concentration of 5x106 cells/ml and sensitized in suspension with TEC-21 mAb or biotin-labeled TEC-21 mAb or TNP-specific IgE. After incubation for 30 min at 37°C in a CO2 incubator, the cells were washed twice in BSS/0.1% BSA and activated at 37°C by exposure to streptavidin (10 µg/ml) or TNP-BSA (500 ng/ml) for different time intervals as specified in Results. Towards the end of the activation period, the cells were briefly centrifuged and the supernatants used for determination of ß-glucuronidase release (28). The cell pellets were resuspended in ice-cold lysis buffer containing 1% Triton X-100 (for Syk or LAT immunoprecipitation or phosphotyrosine immunoblotting) or 0.2% Triton X-100 (for Fc{varepsilon}RI immunoprecipitation). After 30 min on ice the lysate was centrifuged at 12,000 g for 10 min. Syk, LAT or IgE–Fc{varepsilon}RI complexes were immunoprecipitated from samples equivalent to 107 cells with the corresponding antibody prebound to UltraLink-immobilized Protein A and immunoblotting was performed as described (22).

Sucrose density-gradient ultracentrifugation and Sepharose 4B gel chromatography
In radioantibody binding experiments, RBL-2H3 cells (2x107) were treated in suspension with various 125I-labeled and unlabeled ligands and aggregating agents as described in Results. The cells were lysed in 0.8 ml of lysis buffer containing 10 mM Tris–HCl (pH 8.0), 50 mM NaCl, 10 mM EDTA, 1 mM Na3VO4, 10 mM glycerophosphate, 1 mM PMSF, 5 µg/ml aprotinin, 2 µg/ml leupeptin and 0.06 or 1% (v/v) Triton X-100. After 15 min the lysate was homogenized by passing 5 times through a 27-gauge needle and adjusted to 40% (w/v) sucrose by adding an equal amount of 80% sucrose. Gradient was formed by successive addition of 0.2 ml of 80% sucrose stock to the bottom of a polyallomer tube (13x51 mm; Beckman Instruments, Palo Alto, CA) followed by 0.5 ml of 60% sucrose, 1.5 ml of 40% sucrose (containing the cell lysate), 0.8 ml of 35% sucrose, and 0.5 ml aliquots of 30, 25, 20 and 15% sucrose. Sucrose solutions were prepared by mixing the appropriate amount of the gradient buffer (25 mM Tris–HCl, pH 7.5, 125 mM NaCl and 2 mM EDTA) and 80% sucrose. Tubes were centrifuged at 210,000 g for 4 h at 4°C using a SW 55 Ti rotor (Beckman Instruments). Gradients were fractionated into 0.2 ml aliquots withdrawn from the top of the tube and radioactivity in each fraction was determined using a Cobra II {gamma}-counter (Global Medical Instrumentation, St Paul, MN). The exact sucrose concentration (% w/v) in each fraction was determined by an Abbe refractometer. Gel chromatography on Sepharose 4B minicolumns was carried out as described (16).

Recombinant Semliki Forest virus (SFV) infection and confocal microscopy
SFV gene expression system, pSFV1 and helper pSFV2, was purchased from Gibco/BRL. pSFV1 was further modified to contain a multiple cloning site and a green fluorescent protein (GFP) expression cassette (pSFV-GFP) as previously described (33). Rat LynA cDNA (34) was amplified by PCR using appropriate primers (AAACCTAGGGCCACCATGGGATGTATTAAATCAAAAAGGAAAGAC and AAACCTAGGTGGCTGCTGCTGATACTGCCCTTCCGTGGCAGTGTA) with AvrII restriction sites (underlined) and the optimized ribosome binding site (marked by bold letters). The PCR-generated DNA fragments were digested with AvrII restriction enzyme and then inserted into the AvrII-digested pSFV-GFP. For all PCRs the proofreading Pfu DNA polymerase was used. Fidelity of all PCR products was confirmed by direct sequencing. Generation of SFV and infection of RBL-2H3 cells were performed as previously described (33). SFV infectivity ranged from 60 to 90%.

Immediately after infection the cells were sensitized with biotin–IgE (1 µg/ml) or biotin–TEC-21 mAb (5 µg/ml), incubated for 3 h at 37°C, washed in BSS/BSA and suspended at 106/ml in BSS/BSA supplemented with Cy3-conjugated streptavidin (2 µg/ml; Pierce). After 2 min at 37°C the cells were washed in PBS, transferred on poly-L-lysine (Sigma; 100 µg/ml)-pretreated cover-slips and centrifuged for 1 min at 200 g. The attached cells were fixed with 4% paraformaldehyde for 15 min at room temperature, washed twice in PBS, dried in air, mounted in 6 µl of ProLong antifade reagent (Molecular Probes) per cover-slip, dried and stored in the dark until use. Control cells were fixed with paraformaldehyde before the exposure to biotin-labeled antibodies and streptavidin. The confocal fluorescence images were taken using the Leica TCS NT/SP confocal system in conjunction with a Leica DM R microscope (Leica Microsystems, Wetzlar, Germany). A chromatically corrected objective x100 (NA 1.4) was used to simultaneously collect green and red images of the cells. Fluorescence bleedthrough was evaluated by separate excitation with blue (488 nm) or yellow (568 nm) laser lines (argon/krypton mix gas laser). Cross-correlation analysis of the co-redistribution of Lyn–GFP constructs with aggregated Fc{varepsilon}RI or TEC-21 gp complexes was carried out on equatorial images of individual cells using the quantification mode of the Leica TCS NT software (Leica Microsystems). The correlation coefficients were calculated from this analysis as described (35). These values were averaged from each sample for numerical comparison of the degree of co-redistribution.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Identification of a novel lipid raft-associated gp, TEC-21
In an attempt to identify new components of lipid rafts, we immunized BALB/c mice with rafts isolated from RBL-2H3 cells. After the fifth immunization mAb were prepared and one of them, TEC-21, of the IgG2a isotype, was studied in detail. Immunoblotting analyses indicated that TEC-21 recognized gp of an apparent molecular mass of 36–42 kDa (Fig. 1Go). Treatment with PNGF yielded 20- and 29-kDa forms of the protein (Fig. 1Go), indicating that TEC-21 is heavily N-glycosylated. TEC-21 from cells lysed in 1% Brij 96 and fractionated by sucrose density-gradient ultracentrifugation was found, like other lipid raft-associated proteins (25), mostly in light-density fractions (15–20% sucrose; not shown). Furthermore, TEC-21 in postnuclear supernatants from cells solubilized in 1% Brij 96 was found mostly in large complexes (>2 MDa), which were eluted from Sepharose 4B columns in the void volume fractions (data not shown). TEC-21 gp was bound to the plasma membrane via a GPI anchor as indicated by experiments in which the binding of TEC-21 mAb to RBL-2H3 cells was reduced after treatment with PI-PLC (Fig. 2Go). Scatchard analysis of the binding of 125I-labeled TEC-21 mAb to RBL-2H3 cells indicated that there were ~106 TEC-21 molecules per cell, assuming a bivalent binding of the antibody (not shown). Thus, TEC-21 is one of the most abundant gp on the surface of RBL-2H3 cells.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1. Immunoblotting analysis of TEC-21. TEC-21 gp was immunoprecipitated from postnuclear supernatant of RBL-2H3 cells solubilized successively in buffers containing 0.2% saponin and 1% NP-40, and treated (+) or not (–) with PNGF before SDS–PAGE size fractionation and immunoblotting with TEC-21 mAb. Numbers on the left indicate positions of molecular mass size standards in kDa.

 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 2. Flow cytofluorometry analysis of the expression of TEC-21 in PI-PLC-treated or untreated cells. Cells were incubated without (–) or with (+) PI-PLC (1.2 U/ml) for 40 min at 37°C and the binding of TEC-21 mAb or negative control mAb (C) was determined by flow cytofluorometry.

 
Direct evidence that TEC-21 mAb recognizes the TEC-21 gp was obtained by flow cytofluorometry analysis of COS cells transfected with a vector containing TEC-21 cDNA (see below). After a 48-h expression period 10–18% of the transfected cells reacted with TEC-21 mAb. When the cells were transfected with an empty vector, <1% of the cells were positive.

The expression pattern of TEC-21 gp in rat tissues was examined by immunoblotting. As shown in Fig. 3Go(A), high expression of TEC-21 gp was found in testicular tissue but no TEC-21 was detectable in brain, bone marrow, thymus, lymph nodes, spleen, liver and heart. Ponceau S staining of membrane-bound proteins indicated that similar amounts of proteins were loaded in all cases (not shown). The apparent molecular mass of TEC-21 gp was lower (30–36 kDa) in testes than in RBL-2H3 cells. Immunofluorescence assays indicated that TEC-21 gp was detectable on germinal cells but not on sperm cells (not shown). Interestingly, no TEC-21 was detectable by immunofluorescence on isolated rat peritoneal and pleural mast cells isolated by standard procedure (14) (not shown). The observed expression pattern of TEC-21 was confirmed by RT-PCR analysis, using oligonucleotide primers specific for TEC-21 cDNA (Fig. 3BGo). Control RT-PCR with actin-specific oligonucleotide primers confirmed that the difference in TEC-21 mRNA expression in various tissues was not attributable to different amounts of total mRNA used in the assay.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 3. Tissue distribution of TEC-21. (A) TEC-21 gp distribution. Equal amounts of tissue/cell extracts (25 µg of protein/lane) from RBL-2H3 cells or various rat tissues were size fractionated by SDS–PAGE and processed for immunoblotting with TEC-21 mAb. (B) TEC-21 mRNA distribution. An aliquot of 1 µg of total RNA isolated from RBL-2H3 cells or different rat tissues was used. mRNA was converted to cDNA in a reverse transcription step using oligo(dT) primer. In subsequent PCR, primers specific for TEC-21 or actin were used. RT-PCR products were separated by agarose gel electrophoresis. Regions corresponding to TEC-21 or actin cDNA fragments are shown.

 
Protein sequencing and cDNA cloning of TEC-21
TEC-21 gp was isolated by immunoaffinity chromatography from 0.2% saponin/1% NP-40 lysed RBL-2H3 cells, deglycosylated by PNGF treatment and reprecipitated on Protein A beads with prebound TEC-21 mAb. The immunoprecipitate was fractionated by SDS–PAGE under non-reducing conditions, transferred on PVDF membrane and the Coomasie blue stained region corresponding to the 29-kDa band of TEC-21 gp (~10 µg) was sequenced. The oligopeptide sequence obtained, IYCEVSRTLSLEDNPSGTF, was not found in several protein databases. However, a significant similarity to the mouse TES101 (BLAST accession no. AB022914) was noticed and utilized for designing a 5' oligonucleotide primer (primer I). This primer and oligo(dT) primer, containing a XbaI restriction site, were employed for RT-PCR to amplify a cDNA fragment of 0.86 kbp. The fragment was cloned into pBluescript KSII- and its nucleotide sequence was determined. Database searches revealed 87% identity with TES101 cDNA. Based on TEC-21 and TES101 cDNA sequence data, other primers were designed and a complete coding region of TEC-21 was obtained by sequencing RT-PCR products. The deduced amino acid sequence contained the peptide sequence determined from direct N-terminal TEC-21 sequencing. Further analysis suggested that the N-terminal 25-amino-acid sequence was cleaved as a signal sequence (marked by the dotted line in Fig. 4Go) (36). At the C-terminus a hydrophobic region (last 21 amino acids) is present. In analogy with other GPI-anchored proteins (37), this region is cleaved before addition of the GPI anchor. As predicted from the effect of PNGF treatment (see above), four putative N-glycosylation sites were recognized (marked by asterisks in Fig. 4Go). Interestingly, TEC-21 contains a 70-amino-acid domain with eight cysteines spaced at conserved distances allowing formation of disulfide bonds. Such domains are found in several members of the uPAR/Ly-6/snake neurotoxin family (38) with which TEC-21 shares a low level of homology (~30% identity). The combined data identify TEC-21 as a novel cell surface gp, which is expressed in large amount on RBL-2H3 and testicular cells.



View larger version (58K):
[in this window]
[in a new window]
 
Fig. 4. Nucleotide sequence of TEC-21 cDNA and alignment of deduced amino acids sequence. The N-terminal signal sequence is marked by dotted line. Cysteines representing a motif of uPAR/Ly-6/snake neurotoxin family are underlined. A putative GPI attachment site is indicated ({diamondsuit} G at position 224). Four potential N-glycosylation sites are also marked (*) as well as a stop codon ({diamondsuit}). The nucleotide sequence data reported in this paper have been deposited in the GenBank nucleotide sequence databases with the accession no. AF347056.

 
TEC-21-mediated signal transduction
Our finding that TEC-21 is associated with lipid rafts prompted us to examine whether antibody-mediated aggregation of TEC-21 would induce cell activation events. An exposure of RBL-2H3 cells to TEC-21 mAb alone induced only a weak increase in concentration of [Ca2+]i and secretion of ß-glucuronidase (Fig. 5A and BGo). However, aggregation of cell-bound biotin-labeled TEC-21 mAb by streptavidin resulted in a rapid increase in [Ca2+]i and release of ß-glucuronidase. The extent of these activation events was lower compared to antigen-mediated aggregation of IgE–Fc{varepsilon}RI complexes.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 5. TEC-21-mediated Ca2+ mobilization and secretory response. (A and C) Fura-2-loaded RBL-2H3 cells (A) or RBL-{gamma}- variant cells (C) were activated via TEC-21 dimers using TEC-21 mAb alone (10 µg/ml; T-21, thin lines), via extensively aggregated TEC-21 gp employing biotin-labeled TEC-21 mAb (5 µg/ml) followed by streptavidin (10 µg/ml; T-21b + S) or via Fc{varepsilon}RI by adding TNP-BSA (500 ng/ml) to IgE-primed cells (1:1000 diluted ascites, Ag). Response of variant cells to Ca2+ ionophore A23187 is also shown in (C). Arrows indicate the addition of activating compounds. [Ca2+]i was determined as described in Methods. One typical experiment out of five performed is shown. (B and D) RBL-2H3 cells (B) or RBL-{gamma}- variant cells (D) were sensitized and activated as in (A) and (C), and at various time intervals ß-glucuronidase released into culture supernatant was determined. Means ± SD were calculated from three to seven experiments performed in duplicates or triplicates.

 
To prove that the activation events are mediated by specific aggregation of TEC-21 gp, we also tested the effect of F(ab')2 fragments of TEC-21 mAb on secretory response. When F(ab')2 fragments were used, only weak release of ß-glucuronidase was observed (2.5 ± 0.5%; n = 6). However, aggregation of cell-bound biotinylated TEC-21 F(ab')2 fragments with streptavidin induced significant secretory response (20.9 ± 1.9%). It should be noted that streptavidin alone did not induce any secretion.

The binding of TEC-21 mAb alone induced an increase in tyrosine phosphorylation of several endogenous substrates, mainly with apparent molecular masses of ~55 and 100 kDa (Fig. 6AGo). More extensive TEC-21 cross-linking by biotin-labeled TEC-21 mAb/streptavidin caused more intense tyrosine phosphorylation of several other cellular proteins, i.e. those of ~72 kDa. Interestingly, the SDS–PAGE profile of tyrosine phosphorylated proteins was similar, but not identical, in cells activated via extensive aggregation of TEC-21 gp and Fc{varepsilon}RI (Fig. 6AGo). To determine whether Syk kinase and LAT were among the proteins with increased tyrosine phosphorylation in TEC-21-activated cells, lysates from RBL-2H3 cells activated as above were immunoprecipitated using Syk kinase- and LAT-specific antibody, and the immunoprecipitates were analyzed by immunoblotting with anti-phosphotyrosine mAb (PY-20–HRP). Data presented in Fig. 6Go(B and C) indicate that TEC-21 mAb alone induced only a weak tyrosine phosphorylation of Syk kinase and LAT. A significant increase in tyrosine phosphorylation of these proteins was observed in cells with extensively aggregated TEC-21. However, the extent of Syk and LAT tyrosine phosphorylation was lower than that seen in cells activated via Fc{varepsilon}RI. Reprobing the membranes with anti-Syk or anti-LAT antibody confirmed that the observed differences were not due to differences in the amount of proteins precipitated. Increased tyrosine phosphorylation of total cellular proteins as well as Syk kinase in TEC-21-activated cells was inhibited by 15-min exposure of the cells to Src kinase inhibitor PP1 (not shown), like in the previously described experiments with Thy-1-activated cells (39).



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 6. TEC-21-mediated tyrosine phosphorylation of whole-cell lysate proteins, Syk and LAT. (A) RBL-2H3 cells were activated as in Fig. 5Go(A). Cells exposed to non-reactive mAb were used as a negative control (Con). Five minutes after addition of activation agents the cells were lysed in a lysis buffer with 1% Triton X-100. Postnuclear supernatants were size fractionated by SDS–PAGE and analyzed for tyrosine phosphorylation by immunoblotting with PY-20–HRP conjugate. (B and C) RBL-2H3 cells, non-activated or activated as in (A), were lysed in 1% Triton X-100. Syk and LAT were immunoprecipitated (IP) from postnuclear supernatants using UltraLink-immobilized Protein A beads armed with anti-Syk (B) or anti-LAT (C) polyclonals and analyzed for tyrosine phosphorylation by immunoblotting (IB) with PY-20–HRP conjugate (PY-20). The amounts of immunoprecipitated Syk and LAT were determined by immunoblotting with the corresponding mAb.

 
Is Fc{varepsilon}RI involved in TEC-21-mediated activation?
Previous studies, using RBL-2H3 cells as a model, have shown that there are surface molecules that modulate the Fc{varepsilon}RI-mediated signaling (40–42). In further studies we analyzed the effect of TEC-21 on signaling via Fc{varepsilon}RI. First, we tested whether TEC-21 mAb binding would interfere with binding of IgE to its receptor. When the cells were exposed to saturating concentrations of biotin-labeled TEC-21 mAb, the binding of [125I]IgE determined by direct radioantibody binding assay decreased by ~37 ± 4% (mean ± SD; n = 8). Interestingly, aggregation of the bound biotin–TEC-21 mAb with streptavidin significantly reduced the inhibitory effect (inhibition only 22 ± 5%; n = 8), suggesting that TEC-21 and Fc{varepsilon}RI are not physically associated.

Next we studied changes in association of Fc{varepsilon}RI with lipid rafts after TEC-21 aggregation. It has been previously shown that a small fraction of monomeric IgE–Fc{varepsilon}RI complexes is associated with lipid rafts as determined by an analysis of sucrose gradient fractionated RBL-2H3 cells, solubilized in lysis buffer with 0.05% Triton X-100. The amount of Fc{varepsilon}RI in lipid raft fractions dramatically increased after Fc{varepsilon}RI aggregation (7,8). As presented in Fig. 7Go(A), we confirmed these data using RBL-2H3 cells solubilized in 0.06% Triton X-100-supplemented lysis buffer. Thus, unaggregated [125I]IgE–Fc{varepsilon}RI complexes were found mostly (80 ± 6%; n = 7) in higher density fractions (38–44% sucrose) containing soluble proteins, whereas only 10 ± 4% were found associated with lipid rafts (15–33% sucrose). After an aggregation of [125I]IgE–Fc{varepsilon}RI complexes with anti-IgE, 62 ± 3% (n = 7) of radioactivity was found in lipid raft fractions and only 13 ± 4% in high-density fractions. A significant amount of radioactivity (20 ± 4%) was associated with nuclear remnants localized at fractions 22–25.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 7. TEC-21 gp is not physically associated with Fc{varepsilon}RI. (A) RBL-2H3 cells were incubated at 37°C with [125I]IgE (1 µg/ml). After 10 min, biotin-labeled TEC-21 mAb (5 µg/ml; {square}, {blacksquare}) or medium alone ({circ}, •) were added and the cells were incubated for an additional 20 min. The cells were washed, exposed to streptavidin (10 µg/ml; {square}) or rabbit anti-IgE (10 µg/ml; {circ}) for 5 min at 37°C and lysed on ice in a buffer containing 0.06% Triton X-100. Total cell lysates were loaded within 40% sucrose fractions of sucrose step gradients, and fractionated by ultracenrifugation. Points show the percent of total c.p.m. present in individual fractions (left axis). Sucrose concentrations are also indicated ({blacktriangledown}; right axis). (B) RBL-2H3 cells were incubated for 30 min at 37°C with [125I]TEC-21 mAb (0.1 µg/ml). Unbound mAb was washed out and the cells were solubilized on ice in a lysis buffer containing 0.06% ({circ}) or 1% ({triangleup}) Triton X-100. Total cell lysates were fractionated and analyzed as described in (A). (C) The cells were incubated at 37°C with [125I]IgE (1 µg/ml). After 10 min, biotin-labeled cholera toxin B (5 µg/ml) was added and the cells were incubated for an additional 20 min. The cells were washed, exposed to streptavidin (10 µg/ml; {square}) or medium alone (•) for 5 min at 37°C and lysed on ice in a buffer containing 0.06% Triton X-100. Total cell lysates were fractionated and analyzed as described in (A). Data from typical experiments from three to seven performed in each group (see Results) are shown.

 
Using the same fractionation procedure, 44 ± 6% (n = 5) of [125I]TEC-21 was found in lipid raft fractions (Fig. 7BGo). This association was not significantly affected by an increase in concentration of Triton X-100 (up to 1%) used for solubilization. Interestingly, in cells solubilized with 1% Triton X-100, a large amount of [125I]TEC-21 mAb was found associated with cytoskeleton/nuclear remnants at the bottom of the centrifugation tube (Fig. 7BGo) and could be detected only by counting the radioactivity remaining in the centrifugation tube after gradient removal. In contrast, in cells solubilized with 0.06% Triton X-100 most of the [125I]TEC-21 was localized at fractions 23–24, indicating that under these lysis conditions the TEC-21/cytoskeleton/nuclear remnant complexes were of lower density. Binding of biotin–TEC-21 mAb or aggregation of biotin–TEC-21 with streptavidin had no effect on the density of [125I]IgE–Fc{varepsilon}RI complexes (Fig. 7AGo), confirming no detectable association of TEC-21 with Fc{varepsilon}RI.

Stauffer and Meyer (43) described that fluorescently labeled cholera toxin B co-localized with aggregated Fc{varepsilon}RI. Cholera toxin B is a marker for glycosphingolipids with strong affinity for GM1. To determine whether aggregation of GM1 would have any effect on the density of monomeric IgE–Fc{varepsilon}RI complexes we performed another set of experiments in which Fc{varepsilon}RI was labeled with [125I]IgE and GM1 was aggregated with biotin-labeled cholera toxin B and streptavidin. Data presented in Fig. 7Go(C) show that the formation of GM1 aggregates is accompanied by transfer of a fraction of [125I]IgE–Fc{varepsilon}RI complexes (23 ± 1%; n = 3) into lipid raft fractions. Thus, aggregation of two different lipid raft components, TEC-21 and GM1, could have different consequences for the association of Fc{varepsilon}RI with lipid rafts.

The absence of physical and functional association of TEC-21 and Fc{varepsilon}RI is also supported by experiments assaying tyrosine phosphorylation of Fc{varepsilon}RI ß and {gamma} subunits. TEC-21 gp was either dimerized by an exposure of the cells to TEC-21 mAb alone or extensively aggregated by a sequential exposure of the cells to biotin-labeled TEC-21 mAb and streptavidin. Non-activated cells and cells activated by antigen were employed as negative and positive controls respectively. After 5-min exposure to aggregating agents the cells were solubilized in 0.2% Triton X-100 and Fc{varepsilon}RI was immunoprecipitated from postnuclear supernatants by polyclonal anti-IgE–IgE complexes immobilized on Protein A beads, except for Fc{varepsilon}RI-activated cells, where immobilized anti-IgE alone was used. Immunoblotting analysis showed that Fc{varepsilon}RI ß and {gamma} subunits were tyrosine-phosphorylated in cells activated via Fc{varepsilon}RI but not in cells activated via TEC-21 dimers or extensively aggregated TEC-21 (Fig. 8Go). The absence of tyrosine phosphorylation did not reflect lower Fc{varepsilon}RI recovery, since the amount of the Fc{varepsilon}RI ß subunit was comparable in all immunoprecipitates.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 8. Activation via TEC-21 does not involve tyrosine phosphorylation of Fc{varepsilon}RI. RBL-2H3 cells non-activated or activated as in Fig. 5Go were lysed in a buffer containing 0.2% Triton X-100 and Fc{varepsilon}RI complexes in postnuclear supernatants were immunoprecipitated with UltraLink-immobilized Protein A beads armed with rabbit anti-IgE–IgE complexes (control and TEC-21 activated cells) or rabbit anti-IgE alone (antigen-activated cells). The complexes were fractionated by SDS–PAGE and analyzed by immunoblotting with PY-20–HRP conjugate. Positions of Fc{varepsilon}RI ß and {gamma} subunits are indicated. The amount of Fc{varepsilon}RI ß subunit in immunoprecipitates was determined by immunoblotting with JRK mAb ({alpha}-ß).

 
TEC-21-mediated secretory response in Fc{varepsilon}RI-{gamma}- cells
In our previous studies we have characterized the RBL-2H3-derived mutant cell line defective in surface expression of Fc{varepsilon}RI due to the absence of Fc{varepsilon}RI {gamma} subunit (1,744,45). Here we employed this mutant to determine whether the surface expression of Fc{varepsilon}RI or cytoplasmic {gamma} subunit is important for TEC-21-mediated secretory response. Mutant cells were sensitized with biotin-labeled TEC-21 mAb and activated by an exposure to streptavidin. Data presented in Fig. 5Go(C and D) indicate that aggregation of TEC-21 induced a rapid increase in [Ca2+]i and release of ß-glucuronidase. The lower response of mutant cells seems to be due to their general defect in secretory responsiveness as evidenced by a decreased response to Ca2+ ionophore A23187 (Fig. 5CGo), an agent which acts independently of expression of Fc{varepsilon}RI (17). As expected there was weak response to TEC-21 dimerization and no response to antigen (Fig. 5C and DGo).

Aggregation of TEC-21 is not accompanied by co-aggregation of Lyn kinase
Confocal microscopy studies showed that aggregated Fc{varepsilon}RI co-localized with several raft components, including GM1, Thy-1, Lyn and Syk kinase (43,46,47). To find out whether or not TEC-21 is physically associated with Lyn kinase, we studied the co-localization of GFP-labeled Lyn with aggregated TEC-21 by confocal microscopy (Fig. 9Go). In cells fixed before TEC-21 staining (top row), both the TEC-21 and Lyn–GFP were homogeneously distributed on respectively the exogenous and endogenous leaflet of the plasma membrane. As expected from the SFV system used (33,46), the Lyn–GFP construct was also localized in the cytoplasm, but was absent in the nucleus. When the cells were fixed after TEC-21 aggregation, Lyn kinase showed no signs of co-localization with aggregated TEC-21. Detailed analysis indicated that the cross-correlation coefficient from 18 cells evaluated attained the value 0.1 ± 0.11 (mean ± SD). Contrary to TEC-21, Lyn kinase exhibited significant co-localization with aggregated Fc{varepsilon}RI. This co-localization was clearly seen on overlays of GFP and Cy3 channels (Fig. 9Go bottom line), and the cross-correlation coefficient amounted to 0.49 ± 0.07 (n = 16). Thus, although both TEC-21 and Lyn are localized in lipid rafts, they do not co-localize after TEC-21 cross-linking at physiological temperatures.



View larger version (45K):
[in this window]
[in a new window]
 
Fig. 9. Co-redistribution of Lyn kinase with aggregated Fc{varepsilon}RI but not TEC-21 gp. RBL-2H3 cells were transfected with Lyn–GFP construct using the SFV expression system. Immediately after infection the cells were sensitized with biotin–TEC-21 or biotin–IgE mAb. After 3 h incubation the cells were washed and the antibody–receptor complexes were aggregated (Aggr.) with Cy3-conjugated streptavidin for 2 min at 37°C. The cells were immobilized on cover-slips, fixed with 4% paraformaldehyde and analyzed by confocal microscopy. Control cells were fixed with 4% paraformaldehyde before exposure to biotin-labeled antibodies and staining with Cy3-conjugated streptavidin. Lyn–GFP staining (left column), streptavidin–Cy3 staining (biotin-labeled TEC-21 or IgE, middle column) and merged images (right column) are shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
In order to advance the understanding of functional and structural complexity of lipid rafts in RBL cells we immunized mice with detergent-resistant membranes isolated by sucrose gradient ultracentrifugation from Brij-96 lysed RBL-2H3 cells and prepared mAb. One of them, the TEC-21, was highly specific for RBL-2H3 cells and did not bind to several other in vitro cultured cell lines nor to numerous rat tissue cells. The only exception where TEC-21 was easily detectable at the protein and mRNA level was testicular tissue. By SDS–PAGE the apparent molecular mass of TEC-21 gp from RBL-2H3 cells is 36–42 kDa, and can be reduced by PNGF treatment to 20 and 29 kDa, indicating that TEC-21 is N-glycosylated. TEC-21 gp from cells lysed in 1% Triton X-100 at 4°C has typical properties of a lipid raft component, including large size (>2 MDa) and low density. Apparent molecular masses of TEC-21 from testicular tissue were lower (30–36 kDa) compared to that derived from RBL-2H3 cells. This difference seems to reflect different N-glycosylation pattern of these two proteins, as indicated by the similarity of their apparent molecular masses after PNGF treatment of TEC-21 gp isolated from RBL-2H3 cells or from testes (I. Hálová, unpublished); the observed molecular mass was close to that based on cDNA sequence (21 kDa), without the N- and C-terminal signal sequences (see below).

Sequence analysis revealed that TEC-21 is a gp belonging to the uPAR/Ly-6/snake neurotoxin family. Although the amino acid identity between members of this family is low (~30%), the family is defined by the presence of cysteine-rich domains of 70–90 amino acids, which contain between eight and 10 cysteine residues, spaced at conserved distances. TEC-21, like some other members of the family, contains one such domain with eight cysteine residues. The highest homology (38% identity) was found with the two cysteine-rich domains of a recently described PRV-1 (48). Searches in mouse DNA and protein databases revealed that TEC-21 exhibited 87% identity to TES101 at the cDNA level (coding region) and 79% identity at the protein level, suggesting that TEC-21 is a rat homologue of mouse TES101. This conclusion is supported by similar expression patterns of mouse TES101 (29) and rat TEC-21 (this study and I. Hálová, unpublished). It should be noted that TES101/TEC-21 homologue is also found in human testes (50% identity; BLAST accession no. AAK27310) and that the human homologue was recently cloned from lung small cell carcinoma (BLAST accession no. AAH01861).

Although the TEC-21 expression seems to be confined in adult rats to testicular tissue, its expression in RBL-2H3 cells could be related to their tumor origin, and, importantly, provides a novel and dominant lipid raft marker in a cell line which has been extensively used for analysis of immunoreceptor signaling and the role of lipid rafts in this process (see Introduction). Antibody mediated aggregation of TEC-21-triggered cell activation events which included enhanced tyrosine phosphorylation of Syk kinase, LAT adaptor and other cellular substrates, elevated [Ca2+]i, and release of a secretory component, ß-glucuronidase. Because TEC-21 is anchored to the plasma membrane via GPI anchor, it is possible that its signaling capacity is mediated via interaction with other signaling molecules with transmembrane and cytoplasmic domains. A likely candidate molecule is Fc{varepsilon}RI whose aggregation resulted in qualitatively similar activation events as those evoked by aggregation of TEC-21, although of higher magnitude. However, several lines of evidence presented in this study indicate that the TEC-21-mediated activation does not require Fc{varepsilon}RI.

First, aggregation of TEC-21 was not accompanied by tyrosine phosphorylation of Fc{varepsilon}RI ß and {gamma} subunits. Phosphorylation of these subunits by Lyn kinase is the first biochemical event observed in cells activated via Fc{varepsilon}RI. The absence of this step suggests that TEC-21 aggregation does not induce functional interaction of Fc{varepsilon}RI and Lyn. This is true not only for TEC-21 but also for another GPI-anchored protein, Thy-1 (our unpublished data). In this respect activation via GPI-anchored proteins differs from activation mediated via glycosphingolipids (18,42), which are also associated with lipid rafts. Whether this difference reflects heterogeneity among lipid rafts, as suggested by our previous study (25), remains to be determined.

Second, the absence of direct interaction between Fc{varepsilon}RI and TEC-21 was supported by an assay based on density-gradient fractionation of aggregated and unaggregated Fc{varepsilon}RI and TEC-21 complexes from Triton X-100 lysed cells. In accordance with previous results (7,8), we found that unaggregated IgE–Fc{varepsilon}RI complexes were localized predominantly in higher density fractions (38–44% sucrose). After aggregation, most of the complexes moved into fractions of lower density, corresponding to 15–33% sucrose. This movement was observed only when Triton X-100 was used at low concentration (0.06%). Surface TEC-21 gp labeled with [125I]TEC-21 mAb was found mostly in low-density fractions and was resistant to solubilization with 1% Triton X-100. When the cells were solubilized with 1% Triton X-100, 20% of [125I]TEC-21 mAb was found associated with nuclear remnants moving through the 80% sucrose layer. Interestingly, solubilization of the cells in 0.06% Triton X-100 resulted in an association of ~44% of TEC-21 with nuclear remnants which had lower density and remained at the 60/80% sucrose interface. Dimerization or extensive aggregation of TEC-21 did not induce any movement of [125I]IgE–Fc{varepsilon}RI complexes into lower density fractions. This suggests that changes in surface distribution of TEC-21 do not induce any changes in association of Fc{varepsilon}RI with lipid rafts, and that TEC-21 and Fc{varepsilon}RI move independently in the plasma membrane. At present we cannot completely exclude the possibility that these two proteins are somehow physically associated, but the forces that keep them together are weaker than those involved in formation of patches and caps. It should be noted, however, that aggregation of GM1, another lipid raft component, resulted in movement of [125I]Fc{varepsilon}RI complexes into lipid rafts (Fig. 7CGo). This finding supports the concept of heterogeneity of lipid rafts as defined by insolubility in detergents (see above).

Third, aggregation of TEC-21 did not induce co-aggregation of the Lyn–GFP construct as evidenced by confocal micrososcopy (Fig. 9Go). These data coupled with increased tyrosine phosphorylation of numerous cellular substrates in TEC-21-activated cells and their sensitivity to Src kinase inhibitor PP1 suggest that Lyn kinase need not translocate into TEC-21 patches to initiate cell activation events. This corroborates our previous observations indicating that aggregation of GPI-anchored gp is not followed by an immediate visible co-localization of cytoplasmic Lyn kinase (49). In contrast, aggregated Fc{varepsilon}RI exhibited significant co-localization with Lyn kinase. This co-localization was completely dependent on the anchoring of Lyn kinase into the plasma membrane and only partially dependent on its anchor into the lipid rafts (50).

Finally, aggregated TEC-21 induced a secretory response in cells defective in the expression of Fc{varepsilon}RI {gamma} subunit. These mutants have been previously shown to be defective in the surface expression of Fc{varepsilon}RI {alpha} subunit and therefore incapable of binding the IgE (17).

In conclusion, our data indicate that TEC-21 is a novel lipid raft component of RBL-2H3 cells whose aggregation induces early activation events independently of Fc{varepsilon}RI. The similarity between TEC-21- and Fc{varepsilon}RI-mediated activation events is probably related to the role of lipid rafts as preformed `signalosomes', and their use for initiation of signaling via both aggregated TEC-21 and Fc{varepsilon}RI. Although the function of TEC-21 remains to be elucidated, its unusual tissue specificity, surface expression and association with lipid rafts imply that it exerts a unique function in the communication of cells with extracellular signals. We are currently examining the possibility that expression of TEC-21 in RBL cells is related to their tumor origin.


    Acknowledgments
 
We thank J. Rivera (NIAMS, NIH, Bethesda, MD) for providing some reagents and critical review of our manuscript, and H. Mrázová and R. Budovicová for technical support. This work was supported by grants 312/96/K205, 204/00/0204 and 310/00/205 from the Grant Agency of the Czech Republic, by grants A5052005/00 and A7052006/00 from the Grant Agency of the Academy of Sciences of the Czech Republic, and by grant LN00A026 from the Ministry of Education, Youth and Sports of the Czech Republic. The research of P. D. was supported in part by an International Research Scholar's award from Howard Hughes Medical Institute.


    Abbreviations
 
[Ca2+]i concentration of free intracellular Ca2+
Fc{varepsilon}RI type 1 Fc{varepsilon} receptor
GFP green fluorescent protein
gp glycoprotein
GPI glycosylphosphatidylinositol
HRP horseradish peroxidase
PI-PLC phosphatidylinositol-specific phospholipase C
PNGF peptide N-glycosidase F
PP1 4-amino-5-(4-methylphenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine
RBL rat basophilic leukemia
SFV Semliki Forest virus
uPAR urokinase plasminogen activator receptor

    Notes
 
Transmitting editor: I. Pecht

accepted 30 October 2001.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Eiseman, E. and Bolen, J. B. 1992. Engagement of the high-affinity IgE receptor activates src protein-related tyrosine kinases. Nature 355:78.[Medline]
  2. Pribluda, V. S., Pribluda, C. and Metzger, H. 1994. Transphosphorylation as the mechanism by which the high-affinity receptor for IgE is phosphorylated upon aggregation. Proc. Natl Acad. Sci. USA 91:11246.[Abstract/Free Full Text]
  3. Jouvin, M.-H. E., Adamczewski, M., Numerof, R., Letourneur, O., Vallé, A. and Kinet, J.-P. 1994. Differential control of the tyrosine kinases Lyn and Syk by the two signaling chains of the high affinity immunoglobulin E receptor. J. Biol. Chem. 269:5918.[Abstract/Free Full Text]
  4. Kihara, H. and Siraganian, R. P. 1994. Src homology 2 domains of Syk and Lyn bind to tyrosine-phosphorylated subunit of the high affinity IgE receptor. J. Biol. Chem. 269:22427.[Abstract/Free Full Text]
  5. Brown, D. A. and London, E. 1998. Functions of lipid rafts in biological membranes. Annu. Rev. Cell Dev. Biol. 14:111.[ISI][Medline]
  6. Simons, K. and Ikonen, E. 1997. Functional rafts in cell membranes. Nature 387:569.[Medline]
  7. Field, K. A., Holowka, D. and Baird, B. 1995. Fc{varepsilon}RI-mediated recruitment of p53/56lyn to detergent-resistant membrane domains accompanies cellular signaling. Proc. Natl Acad. Sci. USA 92:9201.[Abstract/Free Full Text]
  8. Field, K. A., Holowka, D. and Baird, B. 1997. Compartmentalized activation of the high affinity immunoglobulin E receptor within membrane domains. J. Biol. Chem. 272:4276.[Abstract/Free Full Text]
  9. Xavier, R., Brennan, T., Li, Q., McCormack, C. and Seed, B. 1998. Membrane compartmentation is required for efficient T cell activation. Immunity 8:723.[ISI][Medline]
  10. Montixi, C., Langlet, C., Bernard, A.-M., Thimonier, J., Dubois, C., Wurbel, M.-A., Chauvin, J.-P., Pierres, M. and He, H.-T. 1998. Engagement of T cell receptor triggers its recruitment to low-density detergent-insoluble membrane domains. EMBO J. 17:5334.[ISI][Medline]
  11. Viola, A., Schroeder, S., Sakakibara, Y. and Lanzavecchia, A. 1999. T lymphocyte costimulation mediated by reorganization of membrane microdomains. Science 283:680.[Abstract/Free Full Text]
  12. Petrie, R. J., Schnetkamp, P. P., Patel, K. D., Awasthi-Kalia, M. and Deans, J. P. 2000. Transient translocation of the B cell receptor and Src homology 2 domain-containing inositol phosphatase to lipid rafts: evidence toward a role in calcium regulation. J. Immunol. 165:1220.[Abstract/Free Full Text]
  13. Dráber, P., Dráberová, L., Kovárová, M., Hálová, I., Tolar, P., Cerná, H. and Boubelík, M. 2001. Lipid rafts and their role in signal transduction—mast cells as a model. Trends Glycosci. Glyc. 13:261.
  14. Dráberová, L. 1989. The involvement of Thy-1 antigen in the activation of rat mast cells. Eur. J. Immunol. 19:1715.[ISI][Medline]
  15. Dráberová, L. and Dráber, P. 1991. Functional expression of the endogenous Thy-1 gene and the transfected murine Thy-1.2 gene in rat basophilic leukemia cells. Eur. J. Immunol. 21:1583.[ISI][Medline]
  16. Dráberová, L. and Dráber, P. 1993. Thy-1 glycoprotein and src-like protein-tyrosine kinase p53/p56lyn are associated in large detergent-resistant complexes in rat basophilic leukemia cells. Proc. Natl Acad. Sci. USA 90:3611.[Abstract/Free Full Text]
  17. Dráberová, L. and Dráber, P. 1995. Thy-1-mediated activation of rat basophilic leukemia cells does not require co-expression of the high-affinity IgE receptor. Eur. J. Immunol. 25:2428.[ISI][Medline]
  18. Schwarz, A., Jürgens, L., Licht, A., Schneider, H., Futerman A, H. and Pecht, I. 2000. An IgE-dependent secretory response of mast cells can be induced by a glycosphingolipid-specific monoclonal antibody. Eur. J. Immunol. 30:217.[ISI][Medline]
  19. Minoguchi, K., Swaim, W. D., Berenstein, E. H. and Siraganian, R. P. 1994. Src family tyrosine kinase p53/56lyn, a serine kinase and Fc{varepsilon}RI associate with {alpha}-galactosyl derivatives of ganglioside GD1b in rat basophilic leukemia RBL-2H3 cells. J. Biol. Chem. 269:5249.[Abstract/Free Full Text]
  20. Basciano, L. K., Berenstein, E. H., Kmak, L. and Siraganian, R. P. 1986. Monoclonal antibodies that inhibit IgE binding. J. Biol. Chem. 261:11823.[Abstract/Free Full Text]
  21. Swaim, W. D., Minoguchi, K., Oliver, C., Hamawy, M. M., Kihara, H., Stephan, V., Berenstein, E. H. and Siraganian, R. P. 1994. The anti-ganglioside monoclonal antibody AA4 induces protein tyrosine phosphorylations, but not degranulation, in rat basophilic leukemia cells. J. Biol. Chem. 269:19466.[Abstract/Free Full Text]
  22. Tolar, P., Dráberová, L. and Dráber, P. 1997. Protein tyrosine kinase Syk is involved in Thy-1 signaling in rat basophilic leukemia cells. Eur. J. Immunol. 27:3389.[ISI][Medline]
  23. Rivera, J., Kinet, J.-P., Kim, J., Pucillo, C. and Metzger, H. 1988. Studies with a monoclonal antibody to the ß subunit of the receptor with high affinity for immunoglobulin E. Mol. Immunol. 25:647.[ISI][Medline]
  24. Rudolph, A. K., Burrows, P. D. and Wabl, M. R. 1981. Thirteen hybridomas secreting hapten-specific immunoglobulin E from mice with Iga or Igb heavy chain haplotype. Eur. J. Immunol. 11:527.[ISI][Medline]
  25. Surviladze, Z., Dráberová, L., Kubínová, L. and Dráber, P. 1998. Functional heterogeneity of Thy-1 membrane microdomains in rat basophilic leukemia cells. Eur. J. Immunol. 28:1847.[ISI][Medline]
  26. Dráber, P., Zikán, J. and Vojtísöková, M. 1980. Establishment and characterization of permanent murine hybridomas secreting monoclonal anti-Thy-1 antibodies. J. Immunogenet. 7:455.[ISI][Medline]
  27. Andrew, S. M. and Titus, J. A. 1997. Fragmentation of immunoglobulin G. In Coligan, J. E., Kruisbeek, A. M., Margulies, D. H., Shevach, E. M. and Strober, W., eds, Current Protocols in Immunology, p. 2.8.1. Wiley, New York.
  28. Surviladze, Z., Dráberová, L., Kovárová, M., Boubelík, M. and Dráber, P. 2001. Differential sensitivity to acute cholesterol lowering of activation mediated via the high-affinity IgE receptor and Thy-1 glycoprotein. Eur. J. Immunol. 31:1.[ISI][Medline]
  29. Kurita, A., Takizawa, T., Takayama, T., Totsukawa, K., Matsubara, S., Shibahara, H., Orgebin-Crist, M.-C., Sendo, F., Shinkai, Y. and Araki, Y. 2001. Identification, cloning, and initial characterization of a novel mouse testicular germ cell-specific antigen. Biol. Reprod. 64:935.[Abstract/Free Full Text]
  30. Selden, R. F. 1995. Transfection using DEAE–dextran. In Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K., eds, Current Protocols in Molecular Biology, p. 9.2.1. Wiley, New York.
  31. Dráber, P. and Stanley, P. 1984. Cytotoxicity of plant lectins for mouse embryonal carcinoma cells. Somat. Cell Mol. Genet. 10:435.[ISI][Medline]
  32. Scatchard, G. 1949. The attractions of proteins for small molecules and ions. Ann. NY Acad. Sci. 51:660.[ISI]
  33. Arudchandran, R., Brown, M. J., Song, J. S., Wank, S. A., Haleem-Smith, H. and Rivera, J. 1999. Polyethylene glycol-mediated infection of non-permissive mammalian cells with semliki forest virus: application to signal transduction studies. J. Immunol. Methods 222:197.[ISI][Medline]
  34. Vonakis, B. M., Chen, H., Haleem-Smith, H. and Metzger, H. 1997. The unique domain as the site on Lyn kinase for its constitutive association with the high affinity receptor for IgE. J. Biol. Chem. 272:24072.[Abstract/Free Full Text]
  35. Sheets, E. D., Holowka, D. and Baird, B. 1999. Critical role for cholesterol in Lyn-mediated tyrosine phosphorylation of Fc{varepsilon}RI and their association with detergent-resistant membranes. J. Cell Biol. 145:877.[Abstract/Free Full Text]
  36. Schultz, J., Copley, R. R., Doerks, T., Ponting, C. P. and Bork, P. 2000. SMART: a web-based tool for the study of genetically mobile domains. Nucleic Acids Res. 28:231.[Abstract/Free Full Text]
  37. Coyne, K. E., Crisci, A. and Lublin, D. M. 1993. Construction of synthetic signals for glycosyl-phosphatidylinositol anchor attachment. Analysis of amino acid sequence requirements for anchoring. J. Biol. Chem. 268:6689.[Abstract/Free Full Text]
  38. Ploug, M. and Ellis, V. 1994. Structure–function relationships in the receptor for urokinase-type plasminogen activator. Comparison to other members of the Ly-6 family and snake venom {alpha}-neurotoxins. FEBS Lett. 349:163.[ISI][Medline]
  39. Amoui, M., Dráber, P. and Dráberová, L. 1997. Src family-selective tyrosine kinase inhibitor, PP1, inhibits both Fc{varepsilon}RI- and Thy-1-mediated activation of rat basophilic leukemia cells. Eur. J. Immunol. 27:1881.[ISI][Medline]
  40. Ortega,