International Immunology, Vol. 14, No. 2, 189-200,
February 2002
© 2002 Japanese Society for Immunology
Cis elements for transporter associated with antigen-processing-2 transcription: two new promoters and an essential role of the IFN response factor binding element in IFN-
-mediated activation of the transcription initiator
Department of Pathology and Comprehensive Cancer Center, Ohio State University Medical Center, 129 Hamilton Hall, 1645 Neil Avenue, Columbus, OH 43210, USA
1 Department of Pediatrics, Columbus Children's Hospital, Ohio State University, Columbus, OH 43205, USA
2 Present address: Hoechst Marion Rousse, Inc., CNS-Molecular Biology, Bridgewater, NJ 08807, USA
Correspondence to: P. Zheng; E-mail: zheng-1{at}medctr.osu.edu
| Abstract |
|---|
|
|
|---|
Expression of cell surface MHC class I:peptide complex requires coordinated expression of multiple genes such as MHC class I heavy chain, ß2-microglobulin (ß2m), transporters associated with antigen-processing (TAP)-1 and TAP-2, and proteosomal components low-molecular weight polypeptide (LMP)-2 and LMP-7. All of these genes are expressed at defined and distinct levels in normal tissues, and are inducible by IFN-
. While the cis elements involved in transcription of the MHC class I heavy chain, ß2m, TAP-1 and LMP-2 have been analyzed extensively, those for TAP-2 and LMP-7 have not been well studied. Here we systematically analyzed the cis elements for TAP-2 transcription. We found at least two independent elements that are sufficient to activate transcription of a reporter gene. One (hereby called TAP-2 P1) is located 5' to the TAP-2 exon 1, while the other (hereby called TAP-2 P2) is a transcription initiator residing in intron 1. Analysis of the 5' sequence of TAP-2 mRNA indicates that both promoters are active. Moreover, while the TAP-2 promoter region contains cis elements that can mediate TAP-2 induction by IFN-
, such as
-activation site and IFN response factor binding element (IRFE), only the IRFE is required for IFN-
induction of TAP-2 promoter in vitro. The IRFE appears to work as an enhancer for the initiator (P2). Together with another promoter recently identified by others, TAP-2 therefore has three independent promoters that can be differentially regulated.
Keywords: antigen presentation genes, IFN-
activation, transporters associated with antigen-processing-2, transcriptional regulation
| Introduction |
|---|
|
|
|---|
MHC class I antigens are expressed constitutively in the majority of tissues, but the levels of expression differ significantly. While most leukocytes express high levels of MHC class I, other organs express these genes at much reduced levels, with almost no detectable expression in the central nervous system (1). In addition, MHC class I antigens are highly inducible by a number of cytokines, such as IFNs (2) and tumor necrosis factors (3). Since MHC class I is the target for the majority of cytotoxic T cells (4), the expression level of these proteins determines the efficiency of immune surveillance by CD8 T cells. Indeed, both viruses (5,6) and tumors (711) can evade the immune system by down-regulating cell surface MHC class I expression.
Expression of MHC class I antigen on the cell surface requires expression of multiple genes (1214), such as MHC class I heavy chain, ß2-microglobulin (ß2m), peptide transporters associated with antigen-processing (TAP)-1 and TAP-2, and immune proteosomal components low-molecular-weight polypeptide (LMP)-2 and LMP-7, all of which are inducible by IFN-
(15). Cell surface MHC class I expression is controlled by both transcriptional and post-translational mechanisms. Most studies on transcriptional regulation of MHC class I antigen presentation genes have focused on MHC class I heavy chain and ß2m genes. More recently, the bi-directional promoter that controls both LMP-2 and TAP-1 has been studied in detail (12,16,17), but very little information is available on the promoters for LMP-7 and TAP-2. Here we have carried out a detailed deletion analysis in order to characterize the TAP-2 promoters. Our analysis has revealed two independent promoters for TAP-2 expression. Moreover, we report here that IFN response factor binding element (IRFE), but not the
-activation site (GAS) element, is required for IFN-
-mediated induction of the TAP-2 promoter and that the IRFE acts as an enhancer for the transcription initiator.
| Methods |
|---|
|
|
|---|
Cells and experimental animals
A number of murine cell lines were used for the study. The NIH3T3 cell line and the embryonic fibroblast cell lines, prepared from either wild-type (B6WT) or STAT-1(/) (B6STKO) C57BL/6j mice were kindly provided by Dr David E. Levy (New York University Medical Center, New York, NY) (18). HeLa and COS cells were obtained from ATCC (Rockville, MD). In some experiments, wild-type or STAT-1(/) C57BL/6j mice were used as sources of splenocytes.
Cloning of DNA fragment between known exons of LMP-7 and TAP-2 genes
The DNA fragment between LMP-7 and TAP-2 genes was amplified by PCR using genomic DNA from 129/sv spleen cells as the template. The LMP7.F1 was used as the forward primer and TAP2.R1 as the reverse primer. All primer sequences are listed in Table 1
. PCR was carried out for 35 cycles: 94°C 1 min, 55°C 1 min and 72°C, 4 min. The 3.8-kb PCR product was cloned into pBluescript-KS vector (Stratagene, La Jolla, CA). Its identity was verified by partial sequencing from both directions. The restriction enzyme mapping of the cloned fragment was identical to the published sequence.
|
Construction for luciferase reporters and dual-luciferase assay
A large panel of luciferase reporter constructs was made. Each construct consisted of a portion of the TAP-2 gene 5' sequence inserted 5' to the open-reading frame of the luciferase gene. TAP-2 5' gene fragments were generated by PCR using primers listed in Table 1
For the IRFE enhancer activity study, P1F5/s was cut out using XhoI and HindIII, and blunt-ended using T4 DNA polymerase (Life Technologies, Grand Island, NY) before being cloned into the SmaI site 5' to the P2 promoter in P2F9 construct. Copy number and direction of the inserts were confirmed by sequencing.
The luciferase reporter constructs were co-transfected with pRL-SV40 (Promega) as a control for transfection efficiency. The promoter activity was determined using a dual-luciferase assay kit from Promega and is expressed as fold induction, calculated according to the following formula: fold induction = (sample luciferase/sample renila luciferase)/(basic luciferase/basic renila luciferase).
Data presented as means of triplicates with variations among replicates always <20%.
Characterization of 5' sequence of the TAP-2 cDNA by PCR
cDNA libraries prepared from either RAW8.1 leukemia cell line or primary splenocytes were used as a source of TAP-2 cDNAs (19). The T7 primer was used as a forward primer and the reverse sequence corresponding to the 4570 bp down-stream of the translation initiation codon of the TAP-2 gene was used as the reverse primer (TAP2.Rev). The PCR products obtained were either sequenced directly or were cloned into the pBluescript vector prior to sequencing.
Characterization of the 5' TAP-2 mRNA sequence by 5' rapid amplification of cDNA ends (5' RACE)
Total cellular RNA was isolated from splenocytes of either wild-type or STAT-1(/) C57BL/6j mice with Trizol reagent (Life Technologies, Grand Island, NY). (5' RACE) was carried out with the 5' RACE system (Life Technologies). Briefly, 2 µg of total RNA was used for first-strand cDNA synthesis using random hexamer primers. The oligo(dC) tailed cDNA was amplified by PCR using Pfu DNA polymerase according to the protocol from the manufacturer (Promega; 35 cycles of 95°C for 1 min, 55°C for 0.5 min, 72°C for 3 min and final extension at 72°C for 5 min) with an abridged anchor primer (AAP, 5' RACE system; Life Technologies) and a TAP-2-specific primer (TAP2P1) complementary to nucleotides 454478 of the TAP-2 coding sequence (5'-CCACAAGGAAGAAGAAGGCAGCTAT) (GenBank M90459). A dilution of the original PCR product served as template for nested PCR using the abridged universal amplification primer (AUAP, 5' RACE system) and a second TAP-2-specific primer (TAP2P2) complementary to nucleotides 422436 of the TAP-2 coding sequence (5'-GGCAGGTCCGGCCTGGACAGCTTCA). PCR products were separated by agarose gel electrophoresis, transferred to nylon membranes and hybridized to a TAP-2 cDNA probe. At the same time, larger DNA fragments (>500 bp) were isolated and directly cloned into the pCNTR shuttle vector system (Eppendorf Scientific, Westbury, NY) for the analysis. Ten TAP-2 cDNA clones were sequenced using a TAP-2-specific primer (TAP2P4) complementary to nucleotides 301323 of the TAP-2 coding sequence (5' GCCCCATAGCCAGCCAGCAGCCA).
| Results |
|---|
|
|
|---|
Deletional analysis reveals two independent TAP-2 promoters
The murine TAP-2 cDNA available at the time of this study did not contain a 5' untranslated region (UTR) sequence upstream of the translation initiation codon (ATG). In contrast, data from GenBank shows both human (13) and rat (20) TAP-2 cDNA sequences contain a 5' UTR encoded by a distinct exon 1. As attempts to characterize the 5' UTR by primer extension and RNase protection were unsuccessful, we used RT-PCR to determine the 5' sequence of the TAP-2 gene. Two cDNA libraries cloned into the pCDM8 vector were used as templates: one was prepared from mouse splenocytes, the other from the RAW8.1 leukemia cell line. The T7 primer was used as the forward primer and the reverse primer consisted of the nucleotides 4570 down-stream of the ATG initiation site (Fig. 1a and b
|
|
The DNA sequence 5' of the TAP-2 open reading frame was not published when our analysis was initiated. Since the LMP-7 and TAP-2 genes are closely linked within the MHC class II region (Fig. 2a
As a first step towards characterizing the promoter region that controls TAP-2 expression, we compared the promoter activity of a 1.7-kb 3' fragment (P1F1) with that of the full-length 3.8-kb fragment (P1P2). The two fragments were cloned into the pGL2 luciferase reporter vector and transiently transfected into NIH3T3 or embryonic fibroblast cell lines prepared from either wild-type or STAT-1(/) C57BL/6j mice. After 48 h, the cell lysates were analyzed by dual-luciferase assay. As shown in Fig. 2
(bd), both P1F1 and P1P2 fragments had strong and comparable promoter activity. We therefore restricted further analysis on the 1.7-kb P1F1 fragment.
As illustrated in Fig. 2
(a), the P1F1 fragment contained ~1 kb of sequence 5' to exon 1, all of exon 1 and intron 1, as well as part of the exon 2 sequence. Analysis of P1F1 revealed multiple potential transcription factor binding sites, as depicted in Fig. 3
(a). These cis elements were scattered in the region 5' of exon 1 and in intron 1. To determine the potential contribution of these cis elements, we generated a series of promoter deletion mutants and inserted these fragments into the pGL-2 luciferase vector (Fig. 3b
). Upon transfection of these constructs into both murine (NIH3T3) and human (HeLa) cell lines, we consistently observed undiminished promoter activity when all but 70 bp of the sequence 5' of the exon 1 was deleted (Fig. 3c
). Further deletion in the 5' region, as in the case of P1F5, resulted in a 3-fold reduction of the promoter activity. Moreover, removal of an additional 32 bp 5' of exon 1 (P2Sac) reduced promoter activity by another 5- to 10-fold. Note here that the P2Sac fragment that contains exon 1 and intron 1 still maintains significant promoter activity. Nonetheless, the 70-bp fragment 5' of exon 1 plays an important role in transcriptional activation of the TAP-2 promoter.
|
To test whether the 70- and 32-bp fragments are sufficient to activate transcription, we inserted the 70 (P1F4/s)- or the 32 (P1F5/s)-bp element into the luciferase vector (Fig. 4a
|
Nevertheless, the 70 (P1F4/s)-bp fragment had a substantially lower promoter activity than the entire P1F4 fragment and the significant promoter activity observed in the P2Sac fragment (Fig. 3b
|
5' RACE revealed that the transcription initiator is functional in vivo
The deletional analysis described above revealed that TAP-2 gene has two promoters: one resides just 5' of exon 1 and the other is potentially a transcription initiator (Inr) residing within intron 1. A unique feature of the Inr is that transcription starts at the +1 site of the CTA(+1)TTTC, which serves as a useful fingerprint of the Inr utilization (22,23). Since utilization of the two promoters should result in distinct products, we set out to characterize the 5' UTR of the TAP-2 transcripts. As discussed, we were unable to identify the 5' transcription start sites by primer extension and therefore took the 5' RACE approach. We made a reverse primer using TAP-2 exon 2 sequence and amplified the 5' sequence using RNA isolated from either wild-type or STAT-1(/) splenocytes. The PCR products were cloned into the pBlusescript vector and the TAP-2 clones obtained were individually sequenced. These sequences were aligned with the genomic DNA sequence (Fig. 6a
|
Half of the clones sequenced belong to group 2 (TAP-2-3), which started precisely at the +1 site of the Inr (Fig. 6a
In order to measure the relative abundance of the three groups of the TAP-2 cDNA, the 5' RACE products were separated by agarose gel electrophoresis and then analyzed by Southern blot using TAP-2 cDNA as the probe. Inserts from all three groups of cDNA clones were isolated and used as markers. As shown in Fig. 6
(c), four major species of the 5' RACE products were detected by Southern blot. The molecular weights of these bands were consistent with the four transcription start sites we have predicted. It is therefore likely that the 5' termini of the major TAP-2 mRNA species have now been identified. Moreover, since all species were present in the RACE products from both wild-type and STAT-1(/) spleens, both promoters must have been functionally independent of STAT-1.
IRFE as an essential IFN-
responsive element that acts as an enhancer for Inr
An important feature of genes involved in antigen presentation is their induction by IFN, especially IFN-
. The TAP-2 promoter region contains a GAS and an IRFE. To determine whether any of these cis elements are required for IFN-
-mediated induction of TAP-2, we carried out a systematic deletion analysis. The deletion mutants were cloned into the luciferase reporter constructs, as illustrated in Fig. 7
(a), and then used to transfect either wild-type or STAT-1(/) embryonic fibroblasts. Transfected cells were left untreated or treated with 1000 U/ml of IFN-
and lysates were tested for luciferase activity at 48 h. The ratios of luciferase activity in IFN-treated over untreated cultures are presented in Fig. 7
(b). The data showed that deletion of all but 32 bp 5' of exon 1 had no effect on IFN-
-induced TAP-2 promoter activity. Since the deletion of GAS had no effect on IFN-
responsiveness, the GAS was not necessary for induction by IFN-
. In contrast, IFN-
induction was eliminated after a 32-bp sequence was removed. Regardless of the constructs used, IFN-
function depends on the STAT-1 gene, as the STAT-1(/) fibroblasts showed no induction of TAP-2 activity by IFN-
.
|
Since the essential 32-bp fragment contains an IRFE, it is most likely that this element is required for IFN-
responsiveness. To confirm this, we generated a mutant that contained all of the TAP-2 5' sequence except the IRFE (Fig. 8a
was completely eliminated by deletion of the IRFE. Thus IRFE is required for IFN-
-response of the TAP-2 promoter. Again, despite the fact that promoter activity was unaffected by deletion of GAS, IFN-
function was strictly dependent on the STAT-1 gene as TAP-2 was not induced by IFN-
in fibroblasts derived from the STAT-1(/) mice.
|
To test if the P1, which contains the IRFE, is responsive to IFN-
, we compared P1F1, P1F4/s and P1F5/s activity in cells with and without IFN-
stimulation. As shown in Fig. 9
stimulation, the response of P1F4/s and P1F5/s to IFN-
was not significant. This result suggests that the IFN-
cannot stimulate IRFE to enhance P1 activity. An alternative hypothesis is that IRFE works in concert with the Inr. To evaluate this possibility, we linked, in different copy numbers and orientations, the P1F5/s fragment, which contains the IRFE, to the P2F9 fragment, which contains the Inr. Since the P2F9 by itself was not responsive to IFN-
(data not shown), we defined the activity of P2F9 as 1 to better illustrate the function of IRFE. As shown in Fig. 9
|
| Discussion |
|---|
|
|
|---|
The TAP-2 gene encodes an essential subunit for the transporter associated with antigen processing. While it is clear that transcriptional regulation of TAP-2 is an important aspect of antigen presentation, very little information is available on the gene structure and regulation of TAP-2 transcription. Our results presented here, and a recent publication by Arons et al. (21), provide the much-needed initial characterization. Taken together, the two studies reveal three distinct promoters responsible for expression of TAP-2 mRNA, two of which are responsive to the IRFE-mediated induction by IFN-
. The first promoter, P1, resides immediately upstream of exon 1. Deletion analysis revealed that essentially all of the promoter activity is contained in a 70-bp fragment 5' of exon 1. A lower, but significant promoter activity can be detected in an even smaller 32-bp fragment containing the IRFE sequence. Interestingly, while these short fragments have promoter activity, they contain neither a TATA box nor an Sp1 consensus sequence. The high G/C content of this region may allow binding of RNA polymerase to initiate transcription. The existence of this promoter is supported by Arons et al. (21), who reported a significant promoter activity of a 95-bp fragment encompassing both the 32- and 70-bp fragments. The second promoter, P2, resides 38 bp 5' of the translation start codon. Sequence analysis of this region indicates that a transcription initiator (Inr) is located within the region. A signature of Inr function is that transcription starts at the +1 position of the Inr (22,23). Analysis of the 5' sequence of TAP-2 transcripts identified using 5' RACE indicates that the Inr is indeed employed as a second promoter. However, Arons et al. (21) were not able to observe any TAP-2 transcripts initiated in the intron 1 by RNase protection assay. This is most likely due to technical difficulties associated with the high G/C content of this region, as the majority of the 5' initiation sites were not identified by this method (21). The third promoter, identified by Arons et al. (21) (hereby called TAP-2 P3), encompasses 111 bp of exon 1. This region contains two multiple starting site down-stream element (MED1) sequences which may explain the multiple initiating sites identified by Arons et al. (21). It is unclear whether the difference in our results is due to technical difficulties or reflects the use of different cell lines in our respective studies.
It is worth noting that while all three promoters can function independently, in a physiological context they are most likely to function in concert. This is underscored by the requirement of the first intron for optimal functioning of the first promoter, P1. The precise sequence in the intron 1 that enhances the P1 activity remains to be characterized. Sequence analysis revealed that the DNA that encodes intron 1 contains two CRE elements. As a group, these cis elements do not enhance the function of the Inr. It remains to be tested if they are responsible for increasing the efficacy of the promoters 1 and 3.
Although the initiator alone has strong promoter activity, this activity appears to be negatively regulated by the additional sequence in the 5'. Since the initiator was preceded by two CRE elements that have been implicated in suppression of MHC class I heavy chain transcription (24), we tested the effect of deleting CRE on the activity of the initiator. Our results demonstrated that deletion of the two CRE elements reduces the initiator activity, thus the CRE elements are not negative regulators for the TAP-2 initiator.
Our data and that of Arons et al. (21) have shown that IRFE is required for IFN-
-mediated induction of TAP-2 promoters 2 and 3 respectively. In addition, the IRFE is required for optimal constitutive activity of promoter 3 (21), as is generally true for MED1 promoters (25). However, linking the IRFE to the Inr did not appreciably increase the Inr's constitutive activity. Since the IRFE is part of P1, it obviously plays a role in its constitutive activity.
Most, if not all, transcriptional activation by IFN-
is mediated by the JakStat pathway (18,26,27). The IFN-
signaling process is initiated by binding of dimeric IFN-
to the ligand-binding IFN-
receptor
subunit chain. This leads to receptor dimerization, which is followed by activation of the Janus protein tyrosine kinases, Jak-1 and Jak-2, associated with the IFN-
receptor subunits. Subsequently, this leads to the phosphorylation of latent cytoplasmic transcription factor Stat-1 and the translocation of activated dimeric Stat-1 to the nucleus. The GAS response element TTCC(C or G)GGAA present within responsive promoters is bound directly by the Stat-1 dimer, thereby leading to transcriptional activation. Several GAS-like elements that possess the palindromic core sequence TTN5AA are also bound by Stat-1 (2629). Our study revealed that in the STAT-1(/) fibroblast the TAP-2 promoter is completely resistant to IFN-
-mediated induction. However, the critical involvement of the IRFE, but not the GAS element, in IFN-
-mediated activation of the TAP-2 promoter argues for a different mechanism. Several lines of evidence support this. First, Arons et al. (21) showed that the IRF-1, but not IRF-2 and IFN consensus sequence binding protein, is sufficient to induce the TAP-2 promoter. Second, Stat-1 is required for optimal expression of IRF-1 (18,30). In this regard, it is most likely that activation of TAP-2 promoter requires both Stat-1 and IRF-1, much as what has been suggested for LMP-2 (31). Recent studies revealed an alternative pathway in which IFN-activated Stat-1 complexed with IRF-9 (p48) can activate transcription through interaction with the IFN-stimulated response element (3234). The function of IRF-9 in the binding of TAP-2 promoter is not clear, as our preliminary studies indicated that anti-p48 did not super-shift the IRFEprotein complex from IFN-
-stimulated cells (data not shown).
In summary, our analysis and that of Arons et al. (21) indicate that, despite the presence of numerous cis elements, relatively few are involved in both constitutive and IFN-
inducible expression of the TAP-2 gene. The constitutive expression is controlled by three promoters, a 70-bp fragment 5' to the exon 1, the MED1 sequence within exon 1 and an initiator located 32 bp 5' of the translation start codon. Identification of these cis elements will facilitate characterization of the transactivating element that controls TAP-2 gene expression. Moreover, since the promoter activity dissected in our study is based on analysis of five different cell lines from three different species, murine, monkey and human, it is most likely that the elements identified may function in a number of contexts. The existence of distinct promoter and transcription initiation sites allows independent mechanisms for expression of TAP-2. This apparent redundancy will likely make it more difficult to inactivate transcription by virus and tumors, while providing ample opportunities for interplay of multiple pathophysiological factors.
| Acknowledgments |
|---|
We thank Jennifer Kiel for secretarial assistance. This study is supported by NIH grants (CA82355, CA69091 and CA58033), Department of Defense grant (DAMD17-00-1-0041), a seed grant from The Ohio Cancer Research Associates and by Ohio State University Comprehensive Cancer Center.
| Abbreviations |
|---|
| 5' RACE rapid amplification of 5' cDNA end |
| CRE cAMP response element |
GAS -activation site |
| IRF interferon regulatory factor |
| IRFE interferon response factor binding element |
| LMP low-molecular-weight polypeptide |
| MED1 multiple start site element down-stream |
| TAP transporter associated with antigen processing |
| UTR untranslated region |
| Notes |
|---|
Transmitting editor: R. A. Flavell
Received 15 June 2001, accepted 24 October 2001.
| References |
|---|
|
|
|---|
- Williams, K. A., Hart, D. N., Fabre, J. W. and Morris, P. J. 1980. Distribution and quantitation of HLA-ABC and DR (Ia) antigens on human kidney and other tissues. Transplantation 29:274.[Web of Science][Medline]
- Wong, G. H., Bartlett, P. F., Clark-Lewis, I., Battye, F. and Schrader, J. W. 1984. Inducible expression of H-2 and Ia antigens on brain cells. Nature 310:688.[Medline]
-
Collins, T., Lapierre, L. A., Fiers, W., Strominger, J. L. and Pober, J. S. 1986. Recombinant human tumor necrosis factor increases mRNA levels and surface expression of HLA-A,B antigens in vascular endothelial cells and dermal fibroblasts in vitro. Proc. Natl Acad. Sci. USA 83:446.
[Abstract/Free Full Text] - Zinkernagel, R. M. and Doherty, P. C. 1974. Restriction of in vitro T cell-mediated cytotoxicity in lymphocytic choriomeningitis within a syngeneic or semiallogeneic system. Nature 248:701.[Medline]
-
Rotem-Yehudar, R., Groettrup, M., Soza, A., Kloetzel, P. M. and Ehrlich, R. 1996. LMP-associated proteolytic activities and TAP-dependent peptide transport for class 1 MHC molecules are suppressed in cell lines transformed by the highly oncogenic adenovirus 12. J. Exp. Med. 183:499.
[Abstract/Free Full Text] -
Rotem-Yehudar, R., Winograd, S., Sela, S., Coligan, J. E. and Ehrlich, R. 1994. Downregulation of peptide transporter genes in cell lines transformed with the highly oncogenic adenovirus 12. J. Exp. Med. 180:477.
[Abstract/Free Full Text] - Korkolopoulou, P., Kaklamanis, L., Pezzella, F., Harris, A. L. and Gatter, K. C. 1996. Loss of antigen-presenting molecules (MHC class I and TAP-1) in lung cancer. Br. J. Cancer 73:148.[Web of Science][Medline]
-
Restifo, N. P., Esquivel, F., Kawakami, Y., Yewdell, J. W., Mule, J. J., Rosenberg, S. A. and Bennink, J. R. 1993. Identification of human cancers deficient in antigen processing. J. Exp. Med. 177:265.
[Abstract/Free Full Text] -
Restifo, N. P., Marincola, F. M., Kawakami, Y., Taubenberger, J., Yannelli, J. R. and Rosenberg, S. A. 1996. Loss of functional beta 2-microglobulin in metastatic melanomas from five patients receiving immunotherapy. J. Natl Cancer Inst. 88:100.
[Abstract/Free Full Text] -
Vegh, Z., Wang, P., Vanky, F. and Klein, E. 1993. Selectively down-regulated expression of major histocompatibility complex class I alleles in human solid tumors. Cancer Res. 53:2416.
[Abstract/Free Full Text] - Zheng, P., Guo, Y., Niu, Q., Levy, D. E., Dyck, J. A., Lu, S., Sheiman, L. A. and Liu, Y. 1998. Proto-oncogene PML controls genes devoted to MHC class I antigen presentation. Nature 396:373.[Medline]
- White, L. C., Wright, K. L., Felix, N. J., Ruffner, H., Reis, L. F. L., Pine, R. and Ting, J. P.-Y. 1996. Regulation of LMP2 and TAP1 genes by IRF-1 explains the paucity of CD8 T cells in IRF-1(/) mice. Immunity 5:365.[Web of Science][Medline]
- Trowsdale, J., Hanson, I., Mockridge, I., Beck, S., Townsend, A. and Kelly, A. 1990. Sequences encoded in the class II region of the MHC related to the `ABC' superfamily of transporters. Nature 348:741.[Medline]
- Martinez, C. K. and Monaco, J. J. 1991. Homology of proteasome subunits to a major histocompatibility complex-linked LMP gene. Nature 353:664.[Medline]
- Boehm, U., Klamp, T., Groot, M. and Howard, J. C. 1997. Cellular responses to interferon-gamma. Annu. Rev. Immunol. 15:749.[Web of Science][Medline]
-
Wright, K. L., White, L. C., Kelly, A., Beck, S., Trowsdale, J. and Ting, J. P. 1995. Coordinate regulation of the human TAP1 and LMP2 genes from a shared bidirectional promoter. J. Exp. Med. 181:1459.
[Abstract/Free Full Text] -
Wright, K. L., Chin, K. C., Linhoff, M., Skinner, C., Brown, J. A., Boss, J. M., Stark, G. R. and Ting, J. P. 1998. CIITA stimulation of transcription factor binding to major histocompatibility complex class II and associated promoters in vivo. Proc. Natl Acad. Sci. USA 95:6267.
[Abstract/Free Full Text] - Durbin, J. E., Hackenmiller, R., Simon, M. C. and Levy, D. E. 1996. Targeted disruption of the mouse Stat1 gene results in compromised innate immunity to viral disease. Cell 84:443.[Web of Science][Medline]
-
Guo, Y., Wu, Y., Shinde, S., Sy, M. S., Aruffo, A. and Liu, Y. 1996. Identification of a costimulatory molecule rapidly induced by CD40L as CD44H. J. Exp. Med. 184:955.
[Abstract/Free Full Text] - Deverson, E. V., Gow, I. R., Coadwell, W. J., Monaco, J. J., Butcher, G. W. and Howard, J. C. 1990. MHC class II region encoding proteins related to the multidrug resistance family of transmembrane transporters [see Comments]. Nature 348:738.[Medline]
-
Arons, E., Kunin, V., Schechter, C. and Ehrlich, R. 2001. Organization and functional analysis of the mouse transporter associated with antigen processing 2 promoter. J. Immunol. 166:3942.
[Abstract/Free Full Text] - Smale, S. T. and Baltimore, D. 1989. The `initiator' as a transcription control element. Cell 57:103.[Web of Science][Medline]
- Lo, K. and Smale, S. T. 1996. Generality of a functional initiator consensus sequence. Gene 182:13.[Web of Science][Medline]
-
Saji, M., Shong, M., Napolitano, G., Palmer, L. A., Taniguchi, S. I., Ohmori, M., Ohta, M., Suzuki, K., Kirshner, S. L., Giuliani, C., Singer, D. S. and Kohn, L. D. 1997. Regulation of major histocompatibility complex class I gene expression in thyroid cells. Role of the cAMP response element-like sequence. J. Biol. Chem. 272:20096.
[Abstract/Free Full Text] -
Ince, T. A. and Scotto, K. W. 1995. A conserved downstream element defines a new class of RNA polymerase II promoters. J. Biol. Chem. 270:30249.
[Abstract/Free Full Text] - Fu, X. Y. 1992. A transcription factor with SH2 and SH3 domains is directly activated by an interferon alpha-induced cytoplasmic protein tyrosine kinase(s). Cell 70:323.[Web of Science][Medline]
-
Darnell, J. E., Jr, Kerr, I. M. and Stark, G. R. 1994. JakSTAT pathways and transcriptional activation in response to IFN-s and other extracellular signaling proteins. Science 264:1415.
[Abstract/Free Full Text] - Shtrichman, R. and Samuel, C. E. 2001. The role of gamma interferon in antimicrobial immunity. Curr. Opin. Microbiol. 4:251.[Web of Science][Medline]
-
Darnell, J. E., Jr. 1997. STATs and gene regulation. Science 277:1630.
[Abstract/Free Full Text] - Meraz, M. A., White, J. M., Sheehan, K. C., Bach, E. A., Rodig, S. J., Dighe, A. S., Kaplan, D. H., Riley, J. K., Greenlund, A. C., Campbell, D., Carver-Moore, K., DuBois, R. N., Clark, R., Aguet, M. and Schreiber, R. D. 1996. Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAKSTAT signaling pathway. Cell 84:431.[Web of Science][Medline]
-
Chatterjee-Kishore, M., Kishore, R., Hicklin, D. J., Marincola, F. M. and Ferrone, S. 1998. Different requirements for signal transducer and activator of transcription 1alpha and interferon regulatory factor 1 in the regulation of low molecular mass polypeptide 2 and transporter associated with antigen processing 1 gene expression. J. Biol. Chem. 273:16177.
[Abstract/Free Full Text] -
Majumder, S., Zhou, L. Z., Chaturvedi, P., Babcock, G., Aras, S. and Ransohoff, R. M. 1998. p48/STAT-1alpha-containing complexes play a predominant role in induction of IFN-gamma-inducible protein, 10 kDa (IP-10) by IFN-gamma alone or in synergy with TNF-alpha. J. Immunol. 161:4736.
[Abstract/Free Full Text] -
John, J., McKendry, R., Pellegrini, S., Flavell, D., Kerr, I. M. and Stark, G. R. 1991. Isolation and characterization of a new mutant human cell line unresponsive to alpha and beta interferons. Mol. Cell. Biol. 11:4189.
[Abstract/Free Full Text] -
Bluyssen, H. A., Muzaffar, R., Vlieststra, R. J., van der Made, A. C., Leung, S., Stark, G. R., Kerr, I. M., Trapman, J. and Levy, D. E. 1995. Combinatorial association and abundance of components of interferon-stimulated gene factor 3 dictate the selectivity of interferon responses. Proc. Natl Acad. Sci. USA 92:5645.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
N. Sizemore, A. Agarwal, K. Das, N. Lerner, M. Sulak, S. Rani, R. Ransohoff, D. Shultz, and G. R. Stark Inhibitor of {kappa}B kinase is required to activate a subset of interferon {gamma}-stimulated genes PNAS, May 25, 2004; 101(21): 7994 - 7998. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||









