Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lécart, S.
Right arrow Articles by Yssel, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lécart, S.
Right arrow Articles by Yssel, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 14, No. 11, pp. 1351-1356, November 2002
© 2002 Japanese Society for Immunology

IL-22, in contrast to IL-10, does not induce Ig production, due to absence of a functional IL-22 receptor on activated human B cells

Sandrine Lécart1, Frank Morel2, Nelly Noraz3, Jérôme Pène1, Martine Garcia2, Katia Boniface2, Jean-Claude Lecron2 and Hans Yssel1

1 INSRM U454, CHU Arnaud de Villeneuve, 371, Avenue Doyen Gaston Giraud, 34295 Montpellier Cedex 5, France 2 IBMIG, CNRS FRE 2224, 40 Avenue du Recteur Pineau, 86022 Poitiers Cedex, France 3 Institut Génétique Moléculaire, UMR 5535, 1919 Route de Mende, 34033 Montpellier Cedex 1, Montpellier, France

The first two authors contributed equally to this work
Correspondence to: H. Yssel; E-mail: yssel{at}montp.inserm.fr
Transmitting editor: J. Borst


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
IL-22 is an IL-10 homologue that binds to and signals via the class II cytokine receptor (R) heterodimer IL-22RA1/CFR2-4 (IL-10R2), the latter chain being part of the IL-10R complex. Here, we report that, despite its structural similarity with IL-10, as well as its use of the common IL-10R2 chain, IL-22, in contrast to IL-10, is unable to induce Ig production by activated human B cells. Whereas culture of anti-CD40 mAb-stimulated splenic or tonsillar B cells in the presence of rIL-10 resulted in the production of IgG, IgG1, IgG3 and IgA, rIL-22, at concentrations ranging from 4 to 100 ng/ml, did not induce the production of any of these isotypes. Moreover, unlike rIL-10 which enhanced rIL-4-induced IgG4 and IgE production, rIL-22 was ineffective. Although activated B cells expressed transcripts for a soluble IL-22-binding protein (IL-22RA2), no mRNA for a transmembrane IL-22R (IL-22RA1) could be detected. The latter result was confirmed by the demonstration that rIL-22 failed to induce activation of STAT-3 and -5 in resting or activated B cells. Together, these data show that IL-22, in contrast to its homologue IL-10, is not involved in the immunological activity of B cells, which is due to the absence of a functional IL-22R at the surface of these cells.

Keywords: B cell, ELISA, IL-10, IL-12, signal transduction, Western blotting


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
IL-22 is a cytokine with significant homology to IL-10 that has recently been identified in humans (1) as well as in mice (2). Mouse IL-22 is also known as IL-10-related T cell-derived inducible factor (IL-TIF-{alpha}). The human IL-22 cDNA encodes a protein of 179 amino acids that has 25% identity to human IL-10. The relationship between IL-10 and IL-22 is furthermore underscored by the observation that IL-22 binds and signals through a receptor (R) complex that is composed of the IL-22RA1 chain (CRF-9), a novel member of the class II cytokine receptor family (1), and the IL-10R2 chain (1,3,4). Originally described as an IL-9-inducible cytokine, IL-TIF is produced by activated T cells and mast cells (2). Injection of lipopolysaccharide into mice induces IL-22 transcription and production by hepatocytes, resulting in a rapid increase in the production of acute-phase reactants in the liver, suggesting that IL-22 might contribute to inflammatory responses in vivo (2). However, apart from the observation that human IL-22 has slight inhibitory effects on the production of IL-4 by Th2 cells (1), at present little is known about its functional activity on other cell types of the immune system.

During antigen-induced immune responses, human B cells switch from the production of IgM/IgD to that of IgG1–4, IgA1–2 or IgE, a process that is dependent on CD40 engagement, as well as on the presence of cytokines which are able to induce B cells to the production of specific isotypes. Human IL-10 induces the synthesis of IgM, IgG1 and IgG3, but not IgG2 or IgG4, by anti-CD40 mAb-activated naive, surface IgD+ (sIgD+) tonsillar B cells (5,6). Furthermore, such B cells, activated with an anti-CD40 mAb, can be induced to produce IgA, following their culture in the presence of both transforming growth factor-ß and IL-10 (7). Although IL-10 is not a switch factor for the production of IgG4, it increases IgG4 production by potentiating IL-4-induced IgG4 switching, as well as by enhancing the growth and/or differentiation of B cells that are already committed to the production of IgG4 (8).

Because of its structural homology with IL-10, we have studied the capacity of human rIL-22 to induce Ig production by human B cells. In the present study we show that rIL-22, unlike rIL-10, is ineffective in this process and that it is unable to induce the production of Ig by anti-CD40 mAb-activated purified splenic or tonsillar B cells, which is due to the lack of expression of a functional receptor for IL-22 on these cells.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cytokines
The following human recombinant cytokines were used in this study: rIL-4, rIFN-{gamma} and rIL-10, which were generous gifts from Drs N. Nagabushan (DNAX, Palo Alto, CA) and Francine Brière (Schering-Plough, Dardilly, France) respectively, and rIL-22, a generous gift of Austin Gurney, Genentech, South San Francisco, CA (1).

Cells and culture conditions
Highly purified B cells were obtained from human tonsil or spleen mononuclear cells as follows. Pieces of spleen or tonsil were gently pressed through a 100 µm cell strainer followed by centrifugation of the cell suspension over Ficoll-Hypaque. CD19+ B cells were isolated by positive selection using specific mAb-coated magnetic beads and a preparative magnetic cell sorter (Miltenyi, Bergisch Gladbach, Germany), according to the experimental procedure recommended by the manufacturer. Purity of the selected B cell populations was analyzed by immunostaining and flow cytometry (FACScan; Becton Dickinson, San Jose, CA). Only B cell populations >98% CD19+ were used in the experiments.

For induction of Ig, 2 x 105 CD19+ spleen- or tonsil-derived B lymphocytes were cultured with various combinations of cytokines, as indicated in the text or figures, in the presence or absence of 1 µg/ml of the anti-CD40 mAb 89 (9) (a kind gift of Dr Francine Brière) in flat-bottom 96-well culture plates in IMDM (Gibco/Life Technologies, Cergy Pontoise, France), supplemented with 10% FCS in sextuplate in a final volume of 200 µl. After 12 days of incubation at 37°C and 5% CO2, culture supernatants were collected, spun for 3 min at 270 g to remove residual B cells, aliquotted and stored at –80°C prior to Ig measurements. The hepatocyte cell line HepG2 was used as a control cell line for the detection of mRNA specific for cell surface IL-22RA1 or the IL-22-binding protein, IL-22RA2, as well as for Western blot analysis of STAT phosphorylation.

Measurement of Ig production
Total IgG, IgG1, IgG3, IgG4, total IgA and IgE secretion was determined by isotype-specific ELISA, as described previously (10,11). Briefly, 96-well ELISA plates (Nunc, Roskilde, Denmark) were coated at 4°C for 18 h with antibody or anti-serum directed against IgG (Dade Behring, Paris, France), IgG1, IgG3 (Oxoid/Skybio, Bedfordshire, UK), IgG4 (Southern Biotechnology, Birmingham AL), IgA (BD Biosciences/PharMingen, Le Pont de Claix, France) and IgE (Dako, Trappes, France) raised against each isotype in 125 mM carbonate buffer, pH 9.6. The plates were washed 3 times with PBS containing 0.05% Tween 20 and saturated at room temperature for 1 h with 0.1% BSA (Sigma-Aldrich, St Louis, MO) in PBS. Then 50 µl of culture supernatant was added to the wells and incubated for 18 h at 4°C. After washing with Tween 20 buffer anti-IgG, IgA (Dako), IgG1 and IgG3 (Sigma-Aldrich) antibodies, conjugated to peroxidase and diluted in Tween 20 buffer, were added and the plates were incubated at room temperature for 1 h. IgG4 and IgE measurements were carried out in a two-step assay, by incubating the wells with a purified anti-IgG4 mAb (Bionostics, Devens, MA) or the anti-IgE mAb I-27 (11) for 2 h at room temperature, followed by an incubation with a goat anti-mouse IgG antibody (Dako) for 1 h. After washing, bound enzyme activity was measured using 1 mg/ml of 2'2-azinobis (3-ethylbenzthiazoline sulfonic acid) (Sigma-Aldrich) diluted in 0.1 M citrate phosphate buffer, pH 4.5, containing 0.003% H2O2 as substrate. The optical density was read in an ELISA reader (Molecular Devices, Menlo Park, CA).

cDNA synthesis and RT-PCR analysis
For analysis of IL-22RA1 and IL-22RA2 mRNA expression, 106 human splenic or tonsillar B cells were cultured in medium alone or stimulated with anti-CD40 mAb (1 µg/ml) in the presence or absence of rIL-4 (10 ng/ml) for 24 h. After washing, the cells were lysed in RNA-plus (Tel-Test, Friendswood, TX), according to the manufacturer’s instructions, and total mRNA was extracted using chloroform, precipitated with EtOH and quantitated by optical density reading at a wavelength of 260 nm. Reverse transcription and amplification of cDNA by PCR was performed as described previously (12). PCR cycles were 30 s at 94°C, 30 s at 60°C and 30 s at 72°C for IL-22RA1 (sense: CCCCACTGGGA CACTTTCT A; anti-sense TGGCCCTTTAGGTACTGTGG), IL-22RA2 (sense: AGCTT GCCTTCTTCACTTG; anti-sense: TTGCTCTGCCTCTTATTC) and IL-10R2 (sense: AGGGT ACAATTTCAGTCCCGA; anti-sense: CGGCGTCAG CTCCA TTCTGA) (all 35 cycles) with annealing temperatures of 52 and 55°C respectively. PCR cycles were 30 s at 94°C, 30 s at 55°C and 30 s at 72°C (35 cycles) for porphobilinogen deaminase (PBGD: sense: TGAGAGTGATTCGCG TGGGTA C; antisense: CCCTGTGGTGGACATAGCAATG) (13).

Western Blot analysis
For Western blot analysis of STAT tyrosine phosphorylation, purified human splenic B cells (106 cells/ml) were stimulated with anti-CD40 mAb (1 µg/ml) and rIL-4 (20 ng/ml) or cultured in medium alone. After 48 h of incubation, cells were washed in RPMI 1640 medium and 106 cells were activated with either rIL-10 or rIL-22 (both at 10 ng/ml) for 10 min at 37°C. For control experiments, HepG2 cells were cultured in medium in the presence or absence of rIL-10 or rIL-22 (both 10 ng/ml) for 30 min. Cells were then lysed in a 1% NP-40 lysis buffer, and lysates were boiled, resolved on SDS–PAGE gels and transferred electrophoretically to nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany). Membranes were blocked for 1 h in TBS (150 mM NaCl and 20 mM Tris, pH 7.5), containing 5% non-fat dry milk and 0.1% Tween 20, and incubated with either polyclonal anti-phospho STAT-3 (New England Biolabs, Beverly, MA) or anti-phospho STAT-5 (Cell Signaling, Beverly, MA) antibody or an anti-Erk-2 mAb (Transduction Laboratories, Lexington, KY) for 1 h at room temperature. For some experiments, the blots were stripped and reprobed with an antibody recognizing both activated and non-activated STAT-3 proteins (Santa Cruz Biotechnology, Santa Cruz, CA). Blots were then incubated with horseradish peroxidase-conjugated goat anti-rabbit or anti-mouse antibodies (Amersham, Arlington Heights, IL) and immunoreactive proteins were visualized using the enhanced chemiluminescence assay.


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Capacity of rIL-10 and rIL-22 to modulate Ig production by B cells
IL-10 has been described to induce the production of various Ig by activated B cells. To evaluate the Ig production-inducing capacity of the IL-10 homologue IL-22, purified human splenic or tonsillar B cells were stimulated with anti-CD40 mAb in the presence of various concentrations of rIL-22 and Ig production was measured in culture supernatants by isotype-specific ELISA after 12 days of culture. As expected, stimulation of splenic B cells with anti-CD40 mAb in the presence of rIL-10 resulted in the production of IgG, IgG1, IgG3 (Fig. 1), IgA (Fig. 2) and IgD (Data not shown). Similar results were obtained when tonsillar B cells were used (Fig. 1C and data not shown), although levels of Ig production were generally lower compared to those produced by splenic B cells. However, in contrast, rIL-22, used at concentrations up to 100 ng/ml, was not able to induce the production of any of these Ig, neither in B cells isolated from spleen nor in those from tonsils (Figs 1 and 2). Binding of IL-22 to its receptor activates STAT-1, -3 and -5 (1,2). Recombinant IL-22 used in this study was functional as demonstrated by its capacity to induce activation of STAT-3 in the hepatocyte cell line HepG2 (Fig. 3) (2).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Capacity of rIL-10 and rIL-22 to induce the production of IgG, IgG1 and IgG3 by human splenic and tonsillar B cells. Purified human splenic or tonsillar B cells were stimulated with anti-CD40 mAb (1 µg/ml) in the presence of various concentrations of rIL-10 or rIL-22 in 96 well-culture plates for 12 days in IMDM supplemented with 10% FCS and culture supernatants were analyzed by isotype-specific ELISA.

 


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Capacity of rIL-10 and rIL-22 to induce the production of IgA by human splenic and tonsillar B cells. Purified human splenic or tonsillar B cells were stimulated as indicated in the legend to Fig. 1 and culture supernatants were analyzed by IgA-specific ELISA.

 


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 3. rIL-22 activates STAT-3 in HepG2 cells. The hepatocyte cell line HepG2 (106 cells/ml) was cultured in medium alone (Control) or with 10 ng/ml of rIL-10 or rIL-22 for 15 min and tyrosine phosphorylation of STAT-3 was detected by Western blot analysis of whole-cell lysate. The positions of the induced STAT-3 activity (P-STAT) and constitutive STAT-3 (t-STAT) are indicated.

 
To investigate the possibility that IL-22, rather than inducing Ig production by itself, might modulate Ig production induced by other cytokines, its effect on IL-4-mediated production of IgG4 and IgE was investigated. As shown in Fig. 4, rIL-22, used at 4, 20 or 100 ng/ml, did not affect the production of either isotype by splenic B cells, induced by rIL-4. In contrast, rIL-10, which by itself did not induce the production of IgE by splenic B cells, strongly synergized in a dose-dependent manner with the IL-4-induced production of IgE. Moreover, rIL-10 induced the production of IgG4, at all concentrations used, which was slightly enhanced by the addition of rIL-4.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 4. Effect of rIL-10 and rIL-22 on rIL-4-induced production of IgG4 and IgE by human splenic B cells. Purified human splenic or tonsillar B cells were stimulated for 12 days with anti-CD40 mAb (1 µg/ml) in the absence or presence of rIL-4 (20 ng/ml) and/or various concentrations of rIL-10 and rIL-22 in 96 well-culture plates in IMDM supplemented with 10% FCS, and culture supernatants were analyzed by isotype-specific ELISA.

 
Resting and activated human B cells do not express a functional IL-22RA1
At present, it is not known whether human B cells express the IL-22RA1 at their surface and therefore it cannot be excluded that the observed lack of Ig production-inducing activity of IL-22 is due to the absence of a functional IL-22R. It has been reported that activated B cells express transcripts for a soluble IL-22-binding protein, IL-22RA2, displaying 33% homology with the extracellular domain of the IL-22RA1 chain (14,15), making it plausible that these cells might express the IL-22RA1 at their cell surface as well. Using two different primer sequences that discriminate between IL-22RA1 and IL-22RA2, the expression of transcripts for each receptor chain was analyzed by RT-PCR in tonsillar and splenic B cells, stimulated with anti-CD40 mAb in the presence of rIL-4. Resting B cells did not express detectable transcripts for IL-22RA2. As expected, tonsillar (Fig. 5) or splenic (results not shown) B cells activated for 24 h expressed IL-22RA2 mRNA, confirming the results of Xu et al. (14). In contrast, however, no transcripts for the IL-22RA1 chain could be detected either in resting tonsillar B cells or in B cells activated with anti-CD40 mAb and rIL-4. In addition, the use of quantitative PCR confirmed the absence of IL-22RA1 mRNA in resting or activated splenic B cells (data not shown). Resting and activated B cells expressed transcripts for IL-10R2, whereas the HepG2 cell line, used as a positive control, expressed mRNA for both IL-10R2 and IL-22RA1.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 5. Human tonsillar B cells, activated with anti-CD40 mAb and rIL-4, express transcripts for IL-22RA2, but not for IL-22RA1. One million purified human tonsillar B cells, either freshly isolated (NA) or stimulated for 24 h with anti-CD40 mAb (1 µg/ml) and rIL-4 (20 ng/ml) (A), were analyzed for the expression of mRNA specific for IL-22RA1, IL-22RA2 or IL-10R2. The hepatocyte cell line HepG2 served as a positive control for expression of IL-22RA1 and IL-10R2. PBGD served as a control housekeeping gene (13).

 
To confirm the absence of a functional IL-22R at the cell surface of activated B cells, human splenic (Fig. 6) and tonsillar (results not shown) B cells were cultured with anti-CD40 mAb in the presence of rIL-4 for 48 h, stimulated with rIL-22 for 15 min, and phosphorylation of STAT-3 and -5 was measured by Western Blot analysis. B cells, activated under the same conditions, but stimulated with rIL-10, were used as positive control. As shown in Fig. 6, rIL-22 was not able to activate either STAT protein, in contrast to rIL-10 that activated both STAT-3 and, to a lesser extent, STAT-5. Although stimulation of resting B cells with rIL-10 also resulted in low levels of phosphorylation of STAT-3, activation of these cells with anti-CD40 mAb strongly enhanced IL-10-induced STAT-3 activation (Fig. 6), corresponding with the observed increase in IL-10R2 mRNA expression under these conditions (Fig. 5) and showing that the lack of rIL-22-mediated signal transduction was not due to suboptimal activation conditions.



View larger version (60K):
[in this window]
[in a new window]
 
Fig. 6. rIL-22, in contrast to rIL-10, does not activate STAT-3 or -5 in human splenic B cells stimulated with anti-CD40 mAb. Purified human splenic B cells at a concentration of 106 cells/ml were stimulated with anti-CD40 mAb (1 µg/ml) and rIL-4 (20 ng/ml) (A) or cultured in medium alone (NA). After 48 h of incubation, cells were washed and 105 cells were stimulated with either rIL-10 or rIL-22 (both at 100 ng/ml) for 15 min, and tyrosine phosphorylation of STAT-3 and -5 was detected by Western blot analysis of whole-cell lysate.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
IL-22 is one of five recently identified IL-10 homologues of human origin (1,2) which uses a receptor consisting of a unique IL-22R (IL-22RA1) chain and the IL-10R2 chain, the latter also serving as a second chain of the IL-10R complex (1,3,4). Apart from its reported effects on the induction of acute-phase proteins by liver cells, as well as a slight inhibition of IL-4 production by Th2 cells, little is known about the functional activity of IL-22. In the present study, we show that rIL-22, in contrast to rIL-10, was not able to induce the production of IgG1 and IgG3 by purified tonsillar and splenic B cells. Moreover, rIL-22 was unable to enhance the production of IgE by B cells activated with anti-CD40 mAb and cultured in the presence of rIL-4. Although the molecular mechanisms involved in isotype switching have not been analyzed, the results presented here nevertheless exclude a role for IL-22 in the process of Ig isotype switching by human B cells.

IL-10 reportedly has differential effects on IgE and IgG4 production respectively, in that it enhances IL-4-induced expression of IgG4 transcripts and IgG4 production by peripheral blood B cells, whereas it interferes with the expression of {epsilon} transcripts, thereby inhibiting the production of IgE by naive sIgD+ B cells (8). Surprisingly, although IL-4, but not IL-10, is a switch factor for IgG4 production (16), the latter cytokine was far more effective in inducing the production of this isotype by activated splenic or tonsillar B cells. Furthermore, rIL-10, which by itself was not able to induce the production of IgE, strongly synergized with rIL-4 to induce IgE production by these cells. The latter results underscore the previously described capacity of IL-10, as a result of its growth-promoting activities, to enhance the production of IgG4, as well that of IgE, by enhancing the growth and/or differentiation of B cells that are already committed to the production of either isotype (8).

As demonstrated in the present study, the reason for the absence of Ig-inducing activity is the absence of a functional IL-22R at the surface of these cells. Neither resting B cells nor B cells activated for various periods of time with anti-CD40 mAb expressed transcripts for the IL-22RA1 gene. Moreover, whereas resting, as well as activated, splenic or tonsillar B cells could be induced to activate STAT-3 and -5, following stimulation with rIL-10, no STAT-activating effects were observed with rIL-22, either in resting (results not shown) or in activated (Fig. 6) B cells, despite its capacity to activate STAT-3 in HepG2 cells. Finally, the addition of rIL-4, a cytokine with strong B cell growth- and differentiation-inducing activities, during the experimental procedures also failed to render activated B cells responsive to rIL-22. The possibility that the failure of rIL-22 to induce detectable activation of STAT proteins was due to improper or suboptimal activation conditions is to be excluded, since activation of B cells with anti-CD40 mAb strongly enhanced IL-10-induced STAT-3 and -5 activation.

The latter results were underscored by the absence of detectable IL-22RA1 mRNA in resting or activated B cells. Nevertheless, activated human B cells were found to express transcripts for a soluble binding protein of the IL-22R, IL-22RA2, confirming previously reported data in the literature (14). It was shown in the latter study that IL-22RA2 was able to inhibit IL-22-induced proliferation of a murine cell line, transfected with both the human IL-22RA1 and the CFR2-4 chain, indicating that this protein is likely to function as an IL-22 antagonist. Furthermore, based on the predominant expression of IL-22RA2 transcripts in activated B cells and monocytes, it was suggested that this soluble IL-22R is likely to play a role in inflammatory and autoimmune diseases (14). However, the physiological significance of IL-22RA2 as a natural inhibitor of IL-22-induced B cell function is not clear in view of our finding that neither resting nor activated B cells express a functional IL-22R at their cell surface. Moreover, it has to be noted that, in spite of the expression of transcripts for the IL-22RA2 gene in activated B cells, the presence of IL-22RA2 protein in the culture supernatants of these cells has yet to be demonstrated. It is possible that B cell-secreted IL-22RA2 interferes with the activity that IL-22 exerts on other cell types responsive to this cytokine, such as hepatocytes, but this hypothesis remains to be proven.

IL-22 has been shown to bind directly to the IL-10R2 chain (1), which raises the possibility that it might compete with IL-10 for binding to the common chain of the IL-10R complex, even in the absence of a functional IL-22RA1. However, under the experimental conditions used in the present study, the addition of a 50-fold molar excess of rIL-22 did not affect rIL-10-induced production of IgG1 and IgG3 by anti-CD40-activated B cells (data not shown), indicating that IL-22 does not affect, either directly or indirectly, IL-10-mediated signaling. Taken together, these results demonstrate that rIL-22, notwithstanding its structural homology to IL-10 and its use of the signaling chain of the IL-10R complex, does not have B cell-activating or differentiation-inducing effects, which is due to the absence of a functional IL-22R at the surface of these cells.


    Acknowledgements
 
The authors would like to thank Dr Nathalie Lecointe, Vera Boulay and Adriana Delwayl for advice and technical assistance; Drs Austin Gurney and Francine Brière for generous gifts of cytokines and mAb; and in particular, Professor Jean-Michel Fabre, CHU St Eloi, Montpellier, for human spleen samples. S. L. is supported by MedBioMed.


    Abbreviations
 
PBGD—porphobilinogen deaminase

IL-TIF-{alpha}—IL-10-related T cell-derived inducible factor

R—receptor


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Xie, M. H., Aggarwal, S., Ho, W. H., Foster, J., Zhang, Z., Stinson, J., Wood, W. I., Goddard, A. D. and Gurney, A. L. 2000. Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. J. Biol. Chem. 275:31335.[Abstract/Free Full Text]
  2. Dumoutier, L., Van Roost, E., Colau, D. and Renauld, J. C. 2000. Human interleukin-10-related T cell-derived inducible factor: molecular cloning and functional characterization as an hepatocyte-stimulating factor. Proc. Natl Acad. Sci. USA 97:10144.[Abstract/Free Full Text]
  3. Kotenko, S. V., Krause, C. D., Izotova, L. S., Pollack, B. P., Wu, W. and Pestka, S. 1997. Identification and functional characterization of a second chain of the interleukin-10 receptor complex. EMBO J. 16:5894.[Web of Science][Medline]
  4. Kotenko, S. V., Izotova, L. S., Mirochnitchenko, O. V., Esterova, E., Dickensheets, H., Donnelly, R. P. and Pestka, S. 2001. Identification of the functional interleukin-22 (IL-22) receptor complex: the IL-10R2 chain (IL-10Rß) is a common chain of both the IL-10 and IL-22 (IL-10-related T cell-derived inducible factor, IL-TIF) receptor complexes. J. Biol. Chem. 276:2725.[Abstract/Free Full Text]
  5. Briere, F., Servet-Delprat, C., Bridon, J. M., Saint-Remy, J. M. and Banchereau, J. 1994. Human interleukin 10 induces naive surface immunoglobulin D+ (sIgD+) B cells to secrete IgG1 and IgG3. J. Exp. Med. 179:757.[Abstract/Free Full Text]
  6. Malisan, F., Briere, F., Bridon, J. M., Harindranath, N., Mills, F. C., Max, E. E., Banchereau, J. and Martinez-Valdez, H. 1996. Interleukin-10 induces immunoglobulin G isotype switch recombination in human CD40-activated naive B lymphocytes. J. Exp. Med. 183:937.[Abstract/Free Full Text]
  7. Defrance, T., Vanbervliet, B., Briere, F., Durand, I., Rousset, F. and Banchereau, J. 1992. Interleukin 10 and transforming growth factor beta cooperate to induce anti-CD40-activated naive human B cells to secrete immunoglobulin A. J. Exp. Med. 175:671.[Abstract/Free Full Text]
  8. Jeannin, P., Lecoanet, S., Delneste, Y., Gauchat, J. F. and Bonnefoy, J. Y. 1998. IgE versus IgG4 production can be differentially regulated by IL-10. J. Immunol. 160:3555.[Abstract/Free Full Text]
  9. Valle, A., Zuber, C. E., Defrance, T., Djossou, O., De Rie, M. and Banchereau, J. 1989. Activation of human B lymphocytes through CD40 and interleukin 4. Eur. J. Immunol. 19:1463.[Web of Science][Medline]
  10. Pene, J., Rousset, F., Briere, F., Chretien, I., Bonnefoy, J. Y., Spits, H., Yokota, T., Arai, N., Arai, K., Banchereau, J. and de Vries, J. E. 1988. IgE production by normal human lymphocytes is induced by interleukin 4 and suppressed by interferons gamma and alpha and prostaglandin E2. Proc. Natl Acad. Sci. USA 85:6880. [Abstract/Free Full Text]
  11. Chretien, I., Pene, J., Briere, F., De Waal Malefijt, R., Rousset, F. and De Vries, J. E. 1990. Regulation of human IgE synthesis. I. Human IgE synthesis in vitro is determined by the reciprocal antagonistic effects of interleukin 4 and interferon-{gamma}. Eur. J. Immunol. 20:243.[Web of Science][Medline]
  12. Yssel, H. and Cottrez, F. 1998. Measuring human cytokine responses. In Kaufman, S. and Kabelitz, D., eds, Methods in Microbiology, p. 621. Academic Press, London.
  13. Lion, T. and Kidd V. 1998. Appropriate controls for RT-PCR. Leukemia 12:1983.
  14. Xu, W., Presnell, S. R., Parrish-Novak, J., Kindsvogel, W., Jaspers, S., Chen, Z., Dillon, S. R., Gao, Z., Gilbert, T., Madden, K., Schlutsmeyer, S., Yao, L., Whitmore, T. E., Chandrasekher, Y., Grant, F. J., Maurer, M., Jelinek, L., Storey, H., Brender, T., Hammond, A., Topouzis, S., Clegg, C. H. and Foster, D. C. 2001. A soluble class II cytokine receptor, IL-22RA2, is a naturally occurring IL-22 antagonist. Proc. Natl Acad. Sci. USA 98:9511.[Abstract/Free Full Text]
  15. Dumoutier, L., Lejeune, D., Colau, D. and Renauld, J. C. 2001. Cloning and characterization of IL-22 binding protein, a natural antagonist of IL-10-related T cell-derived inducible factor/IL-22. J. Immunol. 166:7090.[Abstract/Free Full Text]
  16. de Vries, J. E., Punnonen, J., Cocks, B. G. and Aversa, G. 1993. The role of T/B cell interactions and cytokines in the regulation of human IgE synthesis. Semin. Immunol. 5:431.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
BloodHome page
D. T. Avery, C. S. Ma, V. L. Bryant, B. Santner-Nanan, R. Nanan, M. Wong, D. A. Fulcher, M. C. Cook, and S. G. Tangye
STAT3 is required for IL-21-induced secretion of IgE from human naive B cells
Blood, September 1, 2008; 112(5): 1784 - 1793.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. Strle, R. H. McCusker, R. W. Johnson, S. M. Zunich, R. Dantzer, and K. W. Kelley
Prototypical anti-inflammatory cytokine IL-10 prevents loss of IGF-I-induced myogenin protein expression caused by IL-1{beta}
Am J Physiol Endocrinol Metab, April 1, 2008; 294(4): E709 - E718.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Pene, L. Guglielmi, J.-F. Gauchat, N. Harrer, M. Woisetschlager, V. Boulay, J.-M. Fabre, P. Demoly, and H. Yssel
IFN-{gamma}-Mediated Inhibition of Human IgE Synthesis by IL-21 Is Associated with a Polymorphism in the IL-21R Gene
J. Immunol., October 15, 2006; 177(8): 5006 - 5013.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Boniface, F.-X. Bernard, M. Garcia, A. L. Gurney, J.-C. Lecron, and F. Morel
IL-22 Inhibits Epidermal Differentiation and Induces Proinflammatory Gene Expression and Migration of Human Keratinocytes
J. Immunol., March 15, 2005; 174(6): 3695 - 3702.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. N. Lozier, N. Tayebi, and P. Zhang
Mapping of genes that control the antibody response to human factor IX in mice
Blood, February 1, 2005; 105(3): 1029 - 1035.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Pene, J.-F. Gauchat, S. Lecart, E. Drouet, P. Guglielmi, V. Boulay, A. Delwail, D. Foster, J.-C. Lecron, and H. Yssel
Cutting Edge: IL-21 Is a Switch Factor for the Production of IgG1 and IgG3 by Human B Cells
J. Immunol., May 1, 2004; 172(9): 5154 - 5157.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (17)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Lécart, S.
Right arrow Articles by Yssel, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lécart, S.
Right arrow Articles by Yssel, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?