International Immunology, Vol. 13, No. 9, 1185-1192,
September 2001
© 2001 Japanese Society for Immunology
Distinct requirements for IL-6 in polyclonal and specific Ig production induced by microorganisms
Unit of Experimental Medicine,
1 Ludwig Institute for Cancer Research, Christian de Duve Institute of Cellular Pathology and
2 Microbiology Unit, Cliniques Universitaires Saint-Luc, Université Catholique de Louvain, Avenue Hippocrate 74, 1200 Bruxelles, Belgium
Correspondence to: D. Markine-Goriaynoff
| Abstract |
|---|
|
|
|---|
The role of IL-6 in Ig production induced in the mouse by lactate dehydrogenase-elevating virus (LDV), Toxoplasma gondii or lipopolysaccharide (LPS) was assessed. Following infection with LDV, a strong activator of B cells, an early and transient IL-6 production was observed, that originated predominantly from macrophages. Whereas LDV-induced B lymphocyte proliferation appeared independent of IL-6, mice deficient for this cytokine showed a marked reduction in their total T-dependent IgG2a production when compared to their normal counterparts. By contrast, specific responses directed against either LDV or non-viral antigens administered at the time of infection were not decreased in the absence of IL-6. Similarly, polyclonal, but not anti-parasite IgG2a production triggered by T. gondii infection was strongly dependent on the presence of IL-6. Finally, T-independent total IgG3 secretion triggered by LPS was also markedly reduced in IL-6-deficient mice. These results suggest that IL-6 plays a major role in T-dependent and T-independent polyclonal Ig production following B lymphocyte activation by viruses, and parasites, but not in specific antibody responses induced by the same microorganisms.
Keywords: cytokine, IL-6, antibody isotype, lactate dehydrogenase-elevating virus, lipopolysaccharide, Toxoplasma gondii
| Introduction |
|---|
|
|
|---|
Infection of mice by some microorganisms including viruses, parasites and bacteria, or inoculation of products such as lipopolysaccharide (LPS), induce, in addition to secretion of specific antibodies, a strong B lymphocyte polyclonal activation resulting in hypergammaglobulinemia (14). The isotypic distribution of these Ig depends on the stimulus involved: LPS induces a response that is dominated by IgM and IgG3 (46); responses induced by parasites such as Plasmodium chabaudi, Trypanosoma cruzi and Toxoplasma gondii are restricted to the IgG2a subclass (710); a similar IgG2a preponderance has been reported after infection with viruses like lactate dehydrogenase-elevating virus (LDV), mouse hepatitis virus, murine adenovirus, lymphocytic choriomeningitis virus and murine cytomegalovirus (1,6,1114). The enhanced production of natural antibodies resulting from such B cell polyclonal activation may play an important role in the defense against infections, especially at the early times after invasion of the host by viruses or bacteria, when specific responses have not yet matured (15). However, the mechanisms leading to this type of immune response are not fully understood. In many cases, a T lymphocyte-independent proliferation of B cells (1,14,16) results probably from a direct interaction of a microorganism product with some receptor expressed on these cells (1720). In contrast, Ig switch and secretion by these activated B lymphocytes are more likely regulated by Th cell-dependent mechanisms involving interaction with cytokines (1,13,2124).
Among the cytokines capable to stimulate B lymphocytes, it has been reported that IL-6, in synergy with IL-1, induces B cell proliferation and secretion of large amounts of IgM by those cells (25). Moreover, the production of other Ig isotypes, such as IgA and IgG, by B lymphocytes already committed to their secretion is enhanced by IL-6 (26,27). In addition, IL-6 is a potent in vitro and in vivo growth factor for murine plasmacytomas (2830). Therefore, it is plausible to hypothesize that IL-6 could play a role in microorganism-triggered Ig production, including that following B lymphocyte polyclonal activation, especially since the secretion of this molecule has been shown to be induced by both LPS and parasitic and viral infection (3138). Our results indicate that, at least in some mouse strains, IL-6 is indeed required for hypergammaglobulinemia induced by microorganisms and derived products, but not for the secretion of specific antibodies, suggesting that specific or polyclonal B lymphocyte activations are differentially regulated by this cytokine.
| Methods |
|---|
|
|
|---|
Mice
Isolator-reared 129/Sv female mice and SPF BALB/c mice were produced at the Ludwig Institute for Cancer Research by Dr G. Warnier and used when 812 weeks old. B6,129-IL6tm1Kopf mice and their controls, B6129F2/J animals (39), were obtained from the Jackson Laboratory (Bar Harbor, ME).
Virus, parasite, LPS and antigen
In vivo infection was performed by i.p. injection of ~2x107 50% infectious doses (ID50) of LDV (Riley strain; ATCC, Rockville, MD) (6). Mice were infected with the weakly virulent Beverley strain of T. gondii by i.p. inoculation with 5 cyst parasites, as described previously (10). LPS from Escherichia coli (055:B5; Difco, Detroit, MI) was injected i.p. (25 µg in 500 µl saline per mouse). Immunization with keyhole limpet hemocyanin (KLH) (Calbiochem, San Diego, CA) was performed by i.p. injection of 100 µg antigen in 500 µl saline.
Antibody
Anti-CD4 mAb GK1.5 (40) was made available by Dr F. W. Fitch (Chicago) and obtained through the courtesy of Dr H. R. MacDonald (Epalinges sur Lausanne, Switzerland).
Spleen cell cultures
As described previously (6), 25x106 spleen cells were cultured in 5 ml Iscove's medium containing 10% FCS and supplemented with 0.24 mM L-asparagine, 0.55 mM L-arginine, 1.5 mM L-glutamine and 0.05 mM 2-mercaptoethanol. Supernatants were collected 24 h after initiation of cultures.
Cell purification
Cell subpopulations were purified by magnetic cell sorting (MACS; Miltenyi Biotec, Bergisch Gladbach, Germany) as described previously (20,41). Briefly, cells were incubated with biotinylated mAb specific for subpopulation surface markers (Thy-1, B220 and MAC-1), followed with fluoresceinstreptavidin and MACSbiotin microbeads. Cells were loaded in a magnetic cell sorter on a cooled B2 column through a 22-gauge needle, washed with PBS containing 1% BSA through a 21-gauge needle, followed by a 19-gauge needle and eluted with 40 ml PBS with BSA. The purity of the cell preparations was checked by means of biotinylated antibodies, followed by alkaline phosphatase streptavidin and naphtol-AS-MX-phosphate or by flow cytometry analysis.
IL-6 assay
IL-6 was assayed as described in (42) by incubation of serial sample dilutions with the mouse IL-6-dependent B cell hybridoma 7TD1 (2000 cells/microwell) in 0.2 ml Iscove's medium containing 10% FSC, and supplemented with 0.24 mM L-asparagine, 0.55 mM L-arginine, 1.5 mM L-glutamine, 0.05 mM 2-mercaptoethanol, 0.1 mM hypoxanthine and 0.016 mM thymidine. Cells were counted 4 days later by hexosaminidase determination (43). Results, expressed in U/ml, were defined as the concentration producing half-maximal growth of the cells.
Antibody determination
Total IgG subclasses were determined by direct ELISA, as described previously (1). The binding of IgG subclasses to insolubilized mouse IgG isotype-specific rabbit antibody or to insolubilized mouse IgG isotype-specific rat mAb was measured with peroxidase-labeled anti-mouse Ig rat (obtained from H. Bazin, Brussels) or donkey antibody. Standards were mAb of the appropriate isotype. All IgG2a allotypes were recognized by the IgG2a-specific assay.
Specific antibody IgG2a was assayed by ELISA as described previously (10,24), by using plates coated with appropriate antigens and standard curves of selected anti-DNP mAb.
RNA extraction and PCR amplification
Gene expression was analyzed by RT-PCR as described previously (44). Cells were lysed in Trizol reagent (BRL, Gaithersburg, MD). Total RNA was first extracted with chloroform, then precipitated with isopropanol, washed in ethanol and finally resuspended in 50100 µl water. Oligo(dT)-primed cDNA was prepared from ~5 µg RNA using 200 U MMLV reverse transcriptase (BRL) according to the manufacturer's instructions. cDNA was amplified by PCR with DyNAzyme DNA polymerase (Finnzymes, Espoo, Finland) for actin and with a Gene Amp kit (Perkin-Elmer Cetus, Norwalk, CT) for IL-6 in a Thermal Reactor (Hybaid, Middlesex, UK). The primers were as follows: actin: AGGCATTGTGATGGACTCC and GCTGGAAGGTGGACAG-TGAG; IL-6: ATGAAGTTCC- TCTCTGCA and GTTTGCCGAGTAGATCTC.
The post-PCR products were analyzed in 1% agarose gels containing ethidium bromide. Semi-quantitative results were obtained after blotting of the PCR products on Zeta-Probe membranes (BioRad, Hercules, CA) and hybridization overnight at 42°C in Denhardt's solution with internal probes labeled with 32P. The radioactivity was quantitated with a PhosphorImager (Molecular Dynamics, Sunnyvale, CA), and the ratios between IL-6 and actin messages were calculated after subtraction of non-specific background and shown as arbitrary units. The sequence of the probes was: actin: TATGAGCTGCCTGACGGCCA; IL-6: GACCTGTCTATACCACTTCAC.
| Results |
|---|
|
|
|---|
IL-6 secretion in mice infected with LDV
Although it has been shown that many viruses trigger IL-6 secretion, little is known so far on the production of this cytokine after LDV infection. To analyze the role of IL-6 in LDV-induced Ig production, we first determined whether this virus triggered secretion of the cytokine. Thus, IL-6 was bioassayed in the serum of 129/Sv animals at different times post-infection (p.i.). As shown in Fig. 1(A)
|
IL-6 can be produced by different cell populations, including macrophages and Th lymphocytes. To determine the role of the latter cells in LDV-induced IL-6 secretion, we treated mice with anti-CD4 GK1.5 mAb, since this treatment had been previously found to deplete Th cells in vivo (40,45). No modification in IL-6 secretion was observed after this treatment (Table 1
|
|
Role of IL-6 in B lymphocyte responses triggered by LDV infection
LDV infection induces a polyclonal B lymphocyte activation characterized by both a T-independent cell proliferation and a T-dependent Ig secretion restricted to the IgG2a subclass (1,24). The role of IL-6 in these effects was analyzed in B6,129-IL6tm1Kopf mice that are deficient for this cytokine. LDV-induced B lymphocyte proliferation, measured by thymidine incorporation, was similar in IL-6-deficient and normal animals (data not shown). In contrast, a strong reduction of total serum IgG2a levels following LDV infection was observed in IL-6-deficient mice when compared to normal counterparts (Fig. 3A
0.01 by MannWhitney test) difference was already found in basal IgG2a levels of uninfected mice (Fig. 3A
0.05). No IL-6-related difference was observed for IgG3. Finally, basal IgG1 levels were slightly higher in IL-6-deficient mice than in normal animals (P = 0.03 and
0.01 for control and infected mice, respectively). Despite this difference, no increase in IgG1 levels followed LDV infection of IL-6-deficient mice. This control of LDV-induced total IgG2a secretion by IL-6 was confirmed by spleen cell cultures. As shown in Fig. 4
|
|
Like total Ig, specific antibody responses elicited against viral or non-viral antigens in mice infected with LDV and concomitantly immunized with a protein antigen such as KLH are restricted to the IgG2a subclass (11,12). However, contrasting with total IgG2a, the production of specific IgG2a anti-LDV antibodies was not significantly decreased in animals deficient for IL-6 (Fig. 3B
|
Requirement of IL-6 for T. gondii -induced Ig responses.
Like LDV, the weakly virulent Beverley strain of T. gondii induces an IgG2a-restricted polyclonal activation of B lymphocytes (10) and IL-6 production (37). To assess the role of the cytokine in this polyclonal IgG2a secretion, we infected IL-6-deficient mice with the parasite. As shown in Fig. 5(A)
|
LPS-induced B lymphocyte polyclonal activation in IL-6-deficient mice.
LPS injection into normal mice is followed by rapid IL-6 secretion (46) and a strong T-independent polyclonal IgG3 production (46). To determine whether this IgG3 production required IL-6, we administered LPS to IL-6-deficient mice and measured IgG3 levels in the serum 7 days later. Our results indicated that this T-independent polyclonal IgG3 secretion was markedly reduced in the absence of IL-6 (Fig. 6
|
| Discussion |
|---|
|
|
|---|
In vitro, the ability of IL-6 to enhance Ig secretion by mouse B lymphocytes is well established (26,27). Similarly, an in vivo effect of IL-6 on Ig secretion has been demonstrated with mice overexpressing this cytokine (47). In the present study, analyzing the actual involvement of IL-6 in pathological situations characterized by an enhanced Ig production, we showed that both T-dependent and T-independent hypergammaglobulinemia following B lymphocyte polyclonal activation triggered by microorganisms required the presence of this cytokine. In contrast, specific antibody responses appeared to be IL-6-independent.
Our results indicate that, after LDV infection, a transient production of IL-6 occurred that originated mostly from macrophages rather than from T lymphocytes. It has been suggested previously that LDV does not trigger IL-6 production and therefore that LDV-induced immune alterations could not be related to this cytokine (48). However, this analysis of IL-6 production was performed in chronically infected mice, which can easily account for the difference with our results that showed a rapid decrease of the cytokine expression 2 days after infection. On the other hand, our data fit well with other reports of IL-6 secretion by mouse or human macrophages after infection with different viruses, including Newcastle disease virus, respiratory syncytial virus and coxsackievirus (4951). Together with a previous report of early IL-12 expression following infection (41), our observation indicates that LDV triggers a transient macrophage activation that may initiate a cascade of events responsible for some of the effects of the virus on the immune responses, such as B lymphocyte polyclonal activation. It remains to be determined whether this cytokine production originates only from infected macrophages or involves also non-infected recruited cells.
Different studies have so far analyzed the role of IL-6 in Ig production by using either anti-IL-6 antibodies or mice deficient for this cytokine, often with apparently conflicting results. Only moderate influence on total IgG2a serum levels were observed after treatment with anti-IL-6 or anti-IL-6 receptor antibodies in BALB/c or NZB/W F1 mice, although an inhibition of IgG1 responses was found (52,53). Inhibition of total or specific Ig was reported in B6x129 mice deficient for IL-6 after administration of various stimuli such as ovalbumin, myelin oligodendrocyte glycoprotein peptide, vaccinia virus or murine cytomegalovirus (14,54,55). Interestingly, a strong decrease of IgG2a, IgG2b and IgG3, but not IgG1 antigen-specific antibodies was reported in these animals after immunization with DNPovalbumin (56). In contrast, whereas administration of Schistosoma mansoni eggs resulted in a decreased specific anti-egg antigen IgG1 and IgG2a antibody secretion in IL-6-deficient mice (57), IgG production by granuloma cells following s.c. infection with the same parasite was not modified in the absence of the cytokine (58). Similarly, a polyclonal IgG2a production induced by gammaherpesvirus 68 appeared to be IL-6-independent in the same B6x129 mice (59). In addition, independent studies performed with IL-6-deficient mice of the 129/Sv genetic background showed, in the absence of the cytokine, an increase of IgG2a antibodies after immunization with ovalbumin and infection with T. gondii (60,61). Interestingly, in contrast to the large decrease in total IgG2a production reported here after LDV infection of IL-6-deficient B6x129 mice, in C57BL/6 animals, LDV-induced total IgG2a production was IL-6-independent (data not shown), which fits well with a similar difference between mouse strains reported after ovalbumin immunization (56). These results indicate that the effect of IL-6 on B lymphocytes may vary from one mouse strain to another, and thus that the genetic background must be taken into consideration when analyzing the effect of cytokines on Ig secretion.
At this point, the mechanisms by which IL-6 enhances Ig production in vivo are not completely understood, although it has been shown that the cytokine may directly increase B cell growth and differentiation in vitro, especially in conjunction with IL-1 (25). Apparently conflicting results have been reported on the ability of IL-6 to affect Th lymphocyte differentiation (57,62). However, because T-independent LPS-induced IgG3 production was affected by the absence of IL-6 as well as T-dependent responses triggered by virus and parasite, it seems reasonable to postulate that this effect of the cytokine on B cells does not require the presence of T lymphocytes. Although in some models IL-6 was able to induce IgG1 responses (47), this isotype, whereas secreted at rather low levels in our models, was not decreased in the absence of IL-6, a finding reported by other authors as well (56), and was even higher in control IL-6-deficient B6x129 mice than in their normal counterparts. In addition to a mere stimulation of B cell Ig secretion, IL-6 might thus be able to modulate Ig isotypic distribution, in favour to IgG2a, IgG2b and/or IgG3.
Interestingly, in our models, IL-6 was required for the production of total IgG subclasses, but not of IgG2a antibodies specific for viral or parasite antigens, or for proteins that were administered at the time of infection. In addition, we have recently reported that anti-LDV specific antibody responses were controlled by IFN-
, but that total Ig production triggered by LDV or T. gondii did not require the presence of this cytokine (24) that is produced after infection with both infectious agents (10,63 and manuscripts in preparation). Together, these observations strongly suggest that parasite- or virus-induced total polyclonal IgG and specific antibody secretion originate from B lymphocytes that are differentially regulated by cytokines. It may thus be postulated that two distinct and successive humoral responses are triggered by primary infections: early after invasion of the host, a polyclonal production of IgG2a might enhance the levels of natural antibodies recognizing microorganisms, even with a low affinity, that will help to restrict their proliferation (15). The nature of this polyclonal Ig response remains unsolved. The IL-6-independence of the anti-KLH IgG2a antibody response that developed in mice immunized at the time of infection suggests that this cytokine does not enhance all ongoing immune responses. However, it remains possible that some concomitant responses directed against particular antigens, such as carbohydrates or lipids, and/or originating from specific B cell subpopulations, such as B1 cells, could be increased by the virus through IL-6 secretion. Alternatively, this enhanced antibody production may correspond to the stimulation of long-lived plasma cells already committed to IgG secretion (64,65). Why this response develops so fast may be explained by its control by IL-6, which is secreted by macrophages immediately after infection. Although other mechanisms are certainly also involved, it is possible that increased susceptibility of IL-6-deficient mice to various viruses, bacteria and parasites (39,61,66) is, at least partly, related to an impairment of this early polyclonal B cell response. Following this early secretion of total Ig, a more specific antibody response, involving longer recruitment of specific antiviral or anti-parasite B lymphocytes, and controlled by IFN-
, whose secretion requires subsequent activation of different cell populations like NK cells or lymphocytes, but not by IL-6, will then complete and tighten the control of the invading microorganism.
| Acknowledgments |
|---|
The authors are indebted to P. L. Masson and P. G. Coulie for critical reading of this manuscript, and to M.-D. Gonzales and T. Briet for expert technical assistance. This work was supported by the Fonds National de la Recherche Scientifique (FNRS), Fonds de la Recherche Scientifique Médicale (FRSM), Loterie Nationale, Fonds de Développement Scientifique (UCL), Opération Télévie, the State-Prime Minister's OfficeSSTC (interuniversity attraction poles, grant no. 44) and the `Actions de recherche concertées' from the Communauté franciaise de BelgiqueDirection de la Recherche scientifique (concerted actions, grant no. 99/04-239), Belgium. D. M. is a scientific research worker and J.-P. C. is a research director with the FNRS.
| Abbreviations |
|---|
| KLH keyhole limpet hemocyanin |
| LDV lactate dehydrogenase-elevating virus |
| LPS lipopolysaccharide |
| p.i. post-infection |
| Notes |
|---|
Transmitting editor: A. Radbruch
Received 2 November 2000, accepted 15 June 2001.
| References |
|---|
|
|
|---|
-
Coutelier, J.-P., Coulie, P. G., Wauters, P., Heremans, H. and van der Logt, J. T. M. 1990. In vivo polyclonal B-lymphocyte activation elicited by murine viruses. J. Virol.64:5383.
[Abstract/Free Full Text] -
Anders, E. M., Scalzo, A. A. and White, D. O. 1984. Influenza viruses are T cell-independent B cell mitogens. J. Virol.50:960.
[Abstract/Free Full Text] - Ortiz-Ortiz, L., Parks, D. E., Rodriguez, M. and Weigle, W. O. 1980. Polyclonal B lymphocyte activation during Trypanosoma cruzi infection. J. Immunol.124:121.[Abstract]
-
Izui, S., Eisenberg, R. A. and Dixon, F. J. 1981. Subclass-restricted IgG polyclonal antibody production in mice injected with lipid A-rich lipopolysaccharides. J. Exp. Med.153:324.
[Abstract/Free Full Text] - Björklund, M. and Coutinho, A. 1983. Isotype commitment in the in vivo immune responses. II. Polyclonal plaque-forming cell responses to lipopolysaccharide in the spleen and bone marrow. Eur. J. Immunol. 13:44.[Web of Science][Medline]
- Coutelier, J.-P. and Van Snick, J. 1985. Isotypically restricted activation of B lymphocytes by lactic dehydrogenase virus. Eur. J. Immunol. 15:250.[Web of Science][Medline]
- Falanga, P. B., D'Imperio Lima, M. R., Coutinho, A. and Pereira da Silva, L. 1987. Isotypic pattern of the polyclonal B cell response during primary infection by Plasmodium chabaudi and in immune-protected mice. Eur. J. Immunol. 17:599.[Web of Science][Medline]
- D'Imperio Lima, M. R., Joskowicz, M., Coutinho, A., Kipnis, T. and Eisen, H. 1985. Very large and isotypically atypical polyclonal plaque-forming cell responses in mice infected with Trypanosoma cruzi. Eur. J. Immunol. 15:201.[Web of Science][Medline]
- el Bouhdidi, A., Truyens, C., Rivera, M. T., Bazin, H. and Carlier, Y. 1994. Trypanosoma cruzi infection in mice induces a polyisotypic hypergamaglobulinaemia and parasite-specific response involving high IgG2a concentrations and highly avid IgG1 antibodies. Parasite Immunol. 16:69.[Web of Science][Medline]
-
Nguyen, T. D., Bigaignon, G., Van Broeck, J., Vercammen, M., Nguyen, T. N., Delmée, M., Turneer, M., Wolf, S. F. and Coutelier, J.-P. 1998. Acute and chronic phases of Toxoplasma gondii infection in mice modulate the host immune responses. Infect. Immun. 66:2991.
[Abstract/Free Full Text] -
Coutelier, J.-P., van der Logt, J. T. M., Heessen, F. W. A., Warnier, G. and Van Snick, J. 1987. IgG2a restriction of murine antibodies elicited by viral infections. J. Exp. Med. 165:64.
[Abstract/Free Full Text] -
Coutelier, J.-P., van der Logt, J. T. M., Heessen, F. W. A., Vink, A. and Van Snick, J. 1988. Virally induced modulation of murine IgG antibody subclasses. J. Exp. Med. 168:2373.
[Abstract/Free Full Text] -
Lardans, V., Godfraind, C., van der Logt, J. T. M., Heessen, F. W. A., Gonzalez, M. D. and Coutelier, J.-P. 1996. Polyclonal B lymphocyte activation induced by mouse hepatitis virus A59 infection. J. Gen. Virol. 77:1005.
[Abstract/Free Full Text] - Karupiah, G., Sacks, T. E., Klinman, D. M., Fredrickson, T. N., Hartley, J. W., Chen, J.-H. and Morse, H. C., III. 1998. Murine cytomegalovirus infection-induced polyclonal B cell activation is independent of CD4+ T cells and CD40. Virology 240:12.[Web of Science][Medline]
-
Ochsenbein, A. F., Fehr, T., Lutz, C., Suter, M., Brombacher, F., Hengartner, H. and Zinkernagel, R. M. 1999. Control of early viral and bacterial distribution and disease by natural antibodies. Science 286:2156.
[Abstract/Free Full Text] -
Mochizuki, D., Hedrick, S., Watson, J. and Kingsbury, D. T. 1977. The interaction of herpes simplex virus with murine lymphocytes. I. Mitogenic properties of herpes simplex virus. J. Exp. Med. 146:1500.
[Abstract/Free Full Text] -
Goodman-Snitkoff, G., Mannino, R. J. and McSharry, J. J. 1981. The glycoprotein isolated from vesicular stomatitis virus is mitogenic for mouse B lymphocytes. J. Exp. Med. 153:1489.
[Abstract/Free Full Text] - Gibson, M., Tiensiwakul, P. and Khoobyarian, N. 1982. Adenovirus fiber protein (FP) functions as a mitogen and an adjuvant. Cell. Immunol. 73:397.[Web of Science][Medline]
-
Anders, E. M., Scalzo, A. A., Rogers, G. N. and White, D. O. 1986. Relationship between mitogenic activity of influenza viruses and the receptor-binding specificity of their hemagglutinin molecules. J. Virol. 60:476.
[Abstract/Free Full Text] - Coutelier, J.-P., Godfraind, C., Dveksler, G. S., Wysocka, M., Cardellichio, C. B., Noël, H. and Holmes, K. V. 1994. B lymphocyte and macrophage expression of carcinoembryonic antigen-related adhesion molecules that serve as receptors for murine coronavirus. Eur. J. Immunol. 24:1383.[Web of Science][Medline]
- Björklund, M., Forni, L. and Coutinho, A. 1987. T-cell-dependent modulation of the polyclonal B-lymphocyte responses in normal spleen cell cultures stimulated by lipopolysaccharide. Ann. Inst. Pasteur/Immunol. 138:181.[Web of Science][Medline]
- Minoprio, P., Eisen, H., Joskowicz, M., Pereira, P. and Coutinho, A. 1987. Suppression of polyclonal antibody production in Trypanosoma cruzi-infected mice by treatment with anti-L3T4 antibodies. J. Immunol. 139:545.[Abstract]
- Spinella, S., Milon, G. and Hontebeyrie-Joskowicz, M. 1990. A CD4+ Th2 cell line isolated from mice chronically infected with Trypanosoma cruzi induces IgG2 polyclonal responses in vivo. Eur. J. Immunol. 20:1045.[Web of Science][Medline]
-
Markine-Goriaynoff, D., van der Logt, J. T. M., Truyens, C., Nguyen, T. D., Heessen, F. W. A., Bigaignon, G., Carlier, Y. and Coutelier, J.-P. 2000. IFN-
-independent IgG2a production in mice infected with viruses and parasites. Int. Immunol. 12:223.[Abstract/Free Full Text] - Vink, A., Coulie, P. G., Wauters, P., Nordan, R. P. and Van Snick, J. 1988. B cell growth and differentiation activity of interleukin-HP1 and related murine plasmacytoma growth factors. Synergy with interleukin 1. Eur. J. Immunol. 18:607.[Web of Science][Medline]
-
Beagley, K. W., Eldridge, J. H., Lee, F., Kiyono, H., Everson, M. P., Koopman, W. J., Hirano, T., Kishimoto, T. and McGhee, J. R. 1989. Interleukins and IgA synthesis. Human and murine interleukin 6 induce high rate IgA secretion in IgA-committed B cells. J. Exp. Med. 169:2133.
[Abstract/Free Full Text] -
Kawano, Y., Noma, T. and Yata, J. 1994. Regulation of human IgG subclass production by cytokines. IFN-
and IL-6 act antagonistically in the induction of human IgG1 but additively in the induction of IgG2. J. Immunol. 153:4948.[Abstract]
-
Nordan, R. P. and Potter, M. 1986. A macrophage-derived factor required by plasmacytomas for survival and proliferation in vitro. Science 233:566.
[Abstract/Free Full Text] -
Van Snick, J., Vink, A., Cayphas, S. and Uyttenhove, C. 1987. Interleukin-HP1, a T cell-derived hybridoma growth factor that supports the in vitro growth of murine plasmacytomas. J. Exp. Med. 165:641.
[Abstract/Free Full Text] -
Vink, A., Coulie, P., Warnier, G., Renauld, J.-C., Stevens, M., Donckers, D. and Van Snick, J. 1990. Mouse plasmacytoma growth in vivo: enhancement by interleukin 6 (IL-6) and inhibition by antibodies directed against IL-6 or its receptor. J. Exp. Med. 172:997.
[Abstract/Free Full Text] - Cayphas, S., Van Damme, J., Vink, A., Simpson, R. J., Billiau, A. and Van Snick, J. 1987. Identification of an interleukin HP1-like plasmacytoma growth factor produced by L cells in response to viral infection. J. Immunol. 139:2965.[Abstract]
-
Frei, K., Leist, T. P., Meager, A., Gallo, P., Leppert, D., Zinkernagel, R. M. and Fontana, A. 1988. Production of B cell stimulatory factor-2 and interferon
in the central nervous system during viral meningitis and encephalitis. Evaluation in a murine model infection and in patients. J. Exp. Med. 168:449.[Abstract/Free Full Text] -
Ginsberg, H. S., Moldawer, L. L., Sehgal, P. B., Redington, M., Kilian, P. L., Chanock, R. M. and Prince, G. A. 1991. A mouse model for investigating the molecular pathogenesis of adenovirus pneumonia. Proc. Natl Acad. Sci. USA 88:1651.
[Abstract/Free Full Text] -
Ray, A., Tatter, S. B., May, L. T. and Sehgal, P. B. 1988. Activation of the human `ß2-interferon/hepatocyte-stimulating factor/interleukin 6' promoter by cytokines, viruses, and second messenger agonists. Proc. Natl Acad. Sci. USA 85:6701.
[Abstract/Free Full Text] -
Sehgal, P. B., Helfgott, D. C., Santhanam, U., Tatter, S. B., Clarick, R. H., Ghrayeb, J. and May, L. T. 1988. Regulation of the acute phase and immune responses in viral disease. Enhanced expression of the ß2-interferon/hepatocyte-stimulating factor/interleukin 6 gene in virus-infected human fibroblasts. J. Exp. Med. 167:1951.
[Abstract/Free Full Text] - Van Damme, J., Schaafsma, M. R., Fibbe, W. E., Falkenburg, J. H. F., Opdenakker, G. and Billiau, A. 1989. Simultaneous production of interleukin 6, interferon-ß and colony-stimulating activity by fibroblasts after viral and bacterial infection. Eur. J. Immunol. 19:163.[Web of Science][Medline]
-
Hunter, C. A., Abrams, J. S., Beaman, M. H. and Remington, J. S. 1993. Cytokine mRNA in the central nervous system of SCID mice infected with Toxoplasma gondii: importance of T-cell-independent regulation of resistance to T. gondii. Infect. Immun. 61:4038.
[Abstract/Free Full Text] -
Truyens, C., Angelo-Barrios, A., Torrico, F., Van Damme, J., Heremans, H. and Carlier, Y. 1994. Interleukin-6 (IL-6) production in mice infected with Trypanosoma cruzi: effect of its paradoxical increase by anti-IL-6 monoclonal antibody treatment on infection and acute-phase and humoral immune responses. Infect. Immun. 62:692.
[Abstract/Free Full Text] - Kopf, M., Baumann, H., Freer, G., Freudenberg, M., Lamers, M., Kishimoto, T., Zinkernagel, R., Bluethmann, H. and Köhler, G. 1994. Impaired immune and acute-phase responses in interleukin-6-deficient mice. Nature 368:339.[Medline]
- Dialynas, D. P., Wilde, D. B., Marrack, P., Pierres, A., Wall, K. A., Havran, W., Otten, G., Loken, M. R., Pierres, M., Kappler, J. and Fitch, F. W. 1983. Characterization of the murine antigenic determinant, designated L3T4a, recognized by monoclonal antibody GK1.5: expression of L3T4a by functional T cell clones appears to correlate primarily with class II MHC antigen-reactivity. Immunol. Rev. 74:29.[Web of Science][Medline]
-
Coutelier, J.-P., Van Broeck, J. and Wolf, S. F. 1995. Interleukin-12 gene expression after viral infection in the mouse. J. Virol. 69: 1995.
[Abstract/Free Full Text] -
Van Snick, J., Cayphas, S., Vink, A., Uyttenhove, C., Coulie, P. G., Rubira, M. R. and Simpson, R. J. 1986. Purification and NH2-terminal amino acid sequence of a T-cell-derived lymphokine with growth factor activity for B-cell hybridomas. Proc. Natl Acad. Sci. USA 83:9679.
[Abstract/Free Full Text] - Landegren, U. 1984. Measurement of cell numbers by means of the endogenous enzyme hexosaminidase. Applications to detection of lymphokines and cell surface antigens. J. Immunol. Methods 67:379.[Web of Science][Medline]
- El Azami El Idrissi, M., Mazza, G., Monteyne, P., Elson, C. J., Day, M. J., Pfau, C. J. and Coutelier, J.-P. 1998. Lymphocytic choriomeningitis virus-induced alterations of T helpermediated responses in mice developing autoimmune hemolytic anemia during the course of infection. Proc. Soc. Exp. Biol. Med. 218:349.[Medline]
- Coulie, P. G., Coutelier, J.-P., Uyttenhove, C., Lambotte, P. and Van Snick, J. 1985. In vivo suppression of T-dependent antibody responses by treatment with a monoclonal anti-L3T4 antibody. Eur. J. Immunol. 15:638.[Web of Science][Medline]
- Coulie, P. G., Cayphas, S., Vink, A., Uyttenhove, C. and Van Snick, J. 1987. Interleukin-HP1-related hybridoma and plasmacytoma growth factors induced by lipopolysaccharide in vivo. Eur. J. Immunol. 17:1217.[Web of Science][Medline]
-
Suematsu, S., Matsuda, T., Aozasa, K., Akira, S., Nakano, N., Ohno, S., Miyazaki, J.-i., Yamamura, K.-i., Hirano, T. and Kishimoto, T. 1989. IgG1 plasmacytosis in interleukin 6 transgenic mice. Proc. Natl. Acad. Sci. USA 86:7547.
[Abstract/Free Full Text] - Iwata, H. and Hayashi, T. 1994. Interleukin-6 production by macrophages from BALB/c mice with a chronic infection of lactic dehydrogenase virus. Jikken Dobutsu 43:559.[Medline]
- Raj, N. B. K., Cheung, S. C., Rosztoczy, I. and Pitha, P. M. 1992. Mouse genotype affects inducible expression of cytokine genes. J. Immunol. 148:1934.[Abstract]
- Becker, S., Quay, J. and Soukup, J. 1991. Cytokine (tumor necrosis factor, IL-6, and IL-8) production by respiratory syncytial virus-infected human alveolar macrophages. J. Immunol. 147:4307.[Abstract]
-
Henke, A., Mohr, C., Sprenger, H., Graebner, C., Stelzner, A., Nain, M. and Gemsa, D. 1992. Coxsackievirus B3-induced production of tumor necrosis factor-
, IL-1ß, and IL-6 in human monocytes. J. Immunol. 148:2270.[Abstract]
- van Ommen, R., Vredendaal, A. E. C. M. and Savelkoul, H. F. J. 1994. Suppression of polyclonal and antigen-specific murine IgG1 but not IgE responses by neutralizing interleukin-6 in vivo. Eur. J. Immunol. 24:1396.[Web of Science][Medline]
- Mihara, M., Takagi, N., Takeda, Y. and Ohsugi, Y. 1998. IL-6 receptor blockage inhibits the onset of autoimmune kidney disease in NZB/W F1 mice. Clin. Exp. Immunol. 112:397.[Web of Science][Medline]
-
Ramsay, A. J., Husband, A. J., Ramshaw, I. A., Bao, S., Matthaei, K. I., Koehler, G. and Kopf, M. 1994. The role of interleukin-6 in mucosal IgA antibody responses in vivo. Science 264:561.
[Abstract/Free Full Text] - Mendel, I., Katz, A., Kozak, N., Ben-Nun, A. and Revel, M. 1998. Interleukin-6 functions in autoimmune encephalomyelitis: a study in gene-targeted mice. Eur. J. Immunol. 28:1727.[Web of Science][Medline]
-
Kopf, M., Herren, S., Wiles, M. V., Pepys, M. B. and Kosco-Vilbois, M. H. 1998. Interleukin 6 influences germinal center development and antibody production via a contribution of C3 complement component. J. Exp. Med. 188:1895.
[Abstract/Free Full Text] -
La Flamme, A. C. and Pearce, E. J. 1999. The absence of IL-6 does not affect Th2 cell development in vivo, but does lead to impaired proliferation, IL-2 receptor expression, and B cell responses. J. Immunol. 162:5829.
[Abstract/Free Full Text] - Blum, A. M., Metwali, A., Elliott, D., Li, J., Sandor, M. and Weinstock, J. V. 1998. IL-6-deficient mice form granulomas in murine schistosomiasis that exhibit an altered B cell response. Cell. Immunol. 188:64.[Web of Science][Medline]
-
Sangster, M. Y., Topham, D. J., D'Costa, S., Cardin, R. D., Marion, T. N., Myers, L. K. and Doherty, P. C. 2000. Analysis of the virus-specific and nonspecific B cell response to a persistent B-lymphotropic gammaherpesvirus. J. Immunol. 164:1820.
[Abstract/Free Full Text] - Brewer, J. M., Conacher, M., Gaffney, M., Douglas, M., Bluethmann, H. and Alexander, J. 1998. Neither interleukin-6 nor signalling via tumour necrosis factor receptor-1 contribute to the adjuvant activity of alum and Freund's adjuvant. Immunology 93:41.[Web of Science][Medline]
- Jebbari, H., Roberts, C. W., Ferguson, D. J. P., Bluethmann, H. and Alexander, J. 1998. A protective role for IL-6 during early infection with Toxoplasma gondii. Parasite Immunol. 20:231.[Web of Science][Medline]
-
Rincon, M., Anguita, J., Nakamura, T., Fikrig, E. and Flavell, R. A. 1997. Interleukin (IL)-6 directs the differentiation of IL-4-producing CD4+ T cells. J. Exp. Med. 185:461.
[Abstract/Free Full Text] - Plagemann, P. G. W., Rowland, R. R. R., Even, C. and Faaberg, K. S. 1995. Lactate dehydrogenase-elevating virus: an ideal persistent virus? Springer Semin. Immunopathol. 17:167.[Web of Science][Medline]
- Manz, R. A., Thiel, A. and Radbruch, A. 1997. Lifetime of plasma cells in the bone marrow. Nature 388:133.[Medline]
- McHeyzer-Williams, M. G. and Ahmed, R. 1999. B cell memory and the long-lived plasma cell. Curr. Opin. Immunol. 11:172.[Web of Science][Medline]
- Ramshaw, I. A., Ramsay, A. J., Karupiah, G., Rolph, M. S., Mahalingam, S. and Ruby, J. C. 1997. Cytokines and immunity to viral infections. Immunol. Rev. 159:119.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
E. Tsantikos, S. A. Oracki, C. Quilici, G. P. Anderson, D. M. Tarlinton, and M. L. Hibbs Autoimmune Disease in Lyn-Deficient Mice Is Dependent on an Inflammatory Environment Established by IL-6 J. Immunol., February 1, 2010; 184(3): 1348 - 1360. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Tsao, J. Jiao, M. Q. Ji, P. L. Cohen, and R. A. Eisenberg T Cell-Independent Spontaneous Loss of Tolerance by Anti-Double-Stranded DNA B Cells in C57BL/6 Mice J. Immunol., December 1, 2008; 181(11): 7770 - 7777. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Montes, E. V. Acosta-Rodriguez, M. C. Merino, D. A. Bermejo, and A. Gruppi Polyclonal B cell activation in infections: infectious agents' devilry or defense mechanism of the host? J. Leukoc. Biol., November 1, 2007; 82(5): 1027 - 1032. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Peters, W. Bloch, C. Wickenhauser, S. Tawadros, T. Oreshkova, D. Kess, T. Krieg, W. Muller, and K. Scharffetter-Kochanek Terminal B cell differentiation is skewed by deregulated interleukin-6 secretion in {beta}2 integrin-deficient mice J. Leukoc. Biol., September 1, 2006; 80(3): 599 - 607. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. D. Nguyen, G. Bigaignon, D. Markine-Goriaynoff, H. Heremans, T. N. Nguyen, G. Warnier, M. Delmee, M. Warny, S. F. Wolf, C. Uyttenhove, et al. Virulent Toxoplasma gondii strain RH promotes T-cell-independent overproduction of proinflammatory cytokines IL12 and {gamma}-interferon J. Med. Microbiol., October 1, 2003; 52(10): 869 - 876. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Markine-Goriaynoff, X. Hulhoven, C. L. Cambiaso, P. Monteyne, T. Briet, M.-D. Gonzalez, P. Coulie, and J.-P. Coutelier Natural killer cell activation after infection with lactate dehydrogenase-elevating virus J. Gen. Virol., November 1, 2002; 83(11): 2709 - 2716. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Deng, E. Goluszko, E. Tuzun, H. Yang, and P. Christadoss Resistance to Experimental Autoimmune Myasthenia Gravis in IL-6-Deficient Mice Is Associated with Reduced Germinal Center Formation and C3 Production J. Immunol., July 15, 2002; 169(2): 1077 - 1083. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












