Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Zhang, W.
Right arrow Articles by Martin, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, W.
Right arrow Articles by Martin, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 13, No. 9, 1175-1184, September 2001
© 2001 Japanese Society for Immunology

Clonal instability of V region hypermutation in the Ramos Burkitt's lymphoma cell line

Wei Zhang, Philip D. Bardwell, Caroline J. Woo, Vladimir Poltoratsky, Matthew D. Scharff and Alberto Martin

Department of Cell Biology, Albert Einstein College of Medicine, Bronx, NY 10461, USA

Correspondence to: A. Martin


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Affinity maturation of the humoral immune response is caused by single base changes that are introduced into the V regions of the Ig genes during a brief period of B cell differentiation. It has recently become possible to study V region mutation in some human Burkitt's lymphoma cell lines that mutate their V regions and express surface markers that suggest they arose from the malignant transformation of germinal center B cells. Ramos Burkitt's cells constitutively mutate their V regions at a rate of ~2 x 10-5 mutations/bp/generation. However, the sequencing of unselected V regions suggested that our Ramos cell line was progressively losing its ability to undergo V region hypermutation. To accurately quantify this process, subclones with different nonsense mutations in the µ heavy chain V region were identified. Reversion analysis and sequencing of unselected V regions were used to examine the clonal stability of V region hypermutation. Even after only 1 month in culture, stable and unstable subclones could be identified. The identification of mutating and non-mutating subclones of Ramos provided a unique opportunity to identify factors involved in the mutational process. Differential gene expression between mutating and non-mutating Ramos clones was examined by RT-PCR and cDNA microarray analyses. We found that the expression of activation-induced cytidine deaminase (AID), a putative cytidine deaminase, correlated with mutation rates in Ramos subclones. These results suggest that the hypermutation phenotype is inherently unstable in Ramos and that long culture periods favor outgrowth of non-mutating cells that express lower levels of AID.

Keywords: antibody, B lymphocytes, Burkitt's lymphoma, somatic mutation


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Mice, humans and other species generate an enormously diverse repertoire of high-affinity antibodies from a relatively small amount of genetic material. This is initially achieved by assembling different combinations of variable, diversity and joining minigenes to create B cells each expressing an antibody with a different antigen binding site. The B cells producing these germline-encoded, low-affinity antibodies, introduce further diversity by activating a mutational process that is targeted to the V regions of the heavy and light chain Ig genes. Some of these mutations result in higher-affinity antigen binding sites, and those B cells are selected for further growth and differentiation. This results in the affinity maturation of the antibody response and provides high- affinity antibodies that are required for survival. Although this process has been known for >30 years (1), the mechanisms responsible for the regulation, targeting and biochemistry of V region hypermutation have been remarkably elusive (2).

Transgenic and genetically deficient mice have been used to identify some of the trans-acting factors involved in V region mutation as it occurs in vivo and to eliminate many potential mechanisms of V region mutation (3). Genetically defective mice have recently revealed a role in the mutational process for mismatch repair (48) and for the activation-induced cytidine deaminase (AID) (9). Mice with genetically manipulated transgenes have also recently been used to show that double-stranded breaks in DNA occur early in the mutational process (1012). These and other studies have focused attention on error-prone DNA polymerases that might be recruited to the Ig genes during the mutational process (reviewed in 13,14).

The pursuit of the role of these polymerases and other potential trans-acting proteins illustrates the need for cultured antibody-forming cells that are undergoing V region mutation to allow the detailed analysis of the mechanisms involved in regulating and targeting V region mutation (15). Such cell lines have the obvious benefit of providing large relatively homogeneous populations of cells that can be easily transfected with many different engineered Ig genes and subjected to detailed biochemical analysis. Attempts to identify such cell lines have gone on for 30 years (16). Until recently, the few cell lines that mutated their V region mutations did it at rates that were much lower than those that occur in vivo and represented stages of B cell differentiation that do not normally undergo V region mutation in vivo (reviewed in 15,17). With identification of the Ramos (10), BL2 (18) and CL-01 (19) human Burkitt's lymphoma cell lines that have the markers of centroblasts and undergo high rates of mutation in culture, it has become possible to study V region mutation in cells that are more likely to reflect the normal process. As with all cell lines that carry out functions specific to a developmental stage, there are questions about the stability of this phenotype in vitro. Here we examine the clonal variation in rate and characteristics of somatic V region hypermutation in the Ramos cells and correlate this variation with the expression of some genes that could play a role in the mutational process.


    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Cell lines and cell culture conditions
Ramos, obtained from Hilda Ye (Bronx, NY), is an Epstein–Barr virus-negative human Burkitt's lymphoma cell line grown in IMDM (Biowhittaker, Walkersville, MD) medium supplemented with 10% FCS, penicillin and streptomycin (IMDM feeding medium). The V region sequence of the µ heavy chain in Ramos clone 1 is the same as that published previously (10), except for three point mutations: T to C at nucleotide 87, G to A at nucleotide 210 and a C to G at nucleotide 213. The human T cell line HUT-78 was grown in RPMI supplemented with 10% FCS, penicillin and streptomycin.

ELISA spot assay and fluctuation analysis
The assay was performed as previously reported (20). Briefly, 50 µl/well of goat anti-human IgM (Southern Biotechnology Associates, Birmingham, AL) diluted 1:500 in PBS was added to coat 96-well ELISA plates, then blocked with 2% BSA in PBS. Plates were washed in TBS with 0.1% Tween 20 (TBS-T), rinsed with IMDM, and 1–3x106 cells were added to 48 wells in IMDM feeding medium and incubated at 37°C for 16–18 h. The plates were washed with TBS-T and 50 µl/well of biotin-conjugated goat anti-human IgM diluted 1:500 in 1% BSA TBS was added for 2 h at 37°C, washed and then treated with the Vectastain avidin phosphatase amplification system as per the manufacturer's specifications (Vector, Burlingame, CA). Spots were developed with 1 mg/ml substrate 5-bromo-4-chloro-3-indolyl phosphate (Amresco, Solon, OH) in 0.2 mg/ml MgCl2, 0.01% Triton X-405, 9.6% 2-amino-2-methyl-1-propanol (Sigma, St Louis, MO), pH 9.8. Reactions were stopped with distilled H2O. Rates were calculated by fluctuation analyses, as previously described (21,22). Statistics using the Wilcoxon signed-ranks test were performed on indicated data using SPSS for Windows (release 9.0).

Isolation of Ramos µ- cells and enrichment for µ+ cells
A 3-month culture of Ramos clone 1 was used to isolate µ- cells. Cells (5x106) were washed and suspended in 1 ml FACS buffer (0.1% NaN3, 1% BSA in HBSS without phenol red). Then 200 µl of goat anti-µ–FITC (Southern Biotechnology Associates) diluted 1:80 in PBS with 0.5% BSA/5 mM EDTA (MACS buffer) was added for 20 min at 4°C. The cells were washed with FACS buffer and suspended in 160 µl MACS buffer. After adding 40 µl anti-FITC Microbeads (Miltenyi Biotec, Auburn, CA) for 15 min at 4°C, the cells were washed with MACS buffer, resuspended in 1ml MACS buffer and loaded onto the autoMACS column (Miltenyi Biotec). The µ- cells were first collected, then sorted by a FACStar Plus machine (Becton Dickinson, Mountain View, CA) into a 96-well plate with 100 µl IMDM feeding medium in it. The same procedure was used to enrich for µ+ revertant cells from µ- cells, except that the positive portion was collected. The supernatants from each well were assayed for secreted µ heavy chain and {lambda} light chain by ELISA. The V regions of µ- but {lambda}+ clones were sequenced.

Soft agar cloning
Cell subcloning was performed using soft-agar containing 0.3–0.4% Seaplaque agarose (FMC Bioproduct). First, 4 ml of IMDM cloning medium (IMDM with 20% FCS) containing 0.4% SeaPlaque agarose was introduced into a 60-mm culture plate (Falcon-Becton Dickinson). After solidification at 4°C for 10 min, 1 ml of the same medium containing 1000 cells was laid over the top of the soft agar and put at 4°C for 10 min. Cells were grown at 37°C for 5–7 days. Clones were randomly picked and placed into a 96-well plate.

PCR Amplification of the Ig gene from genomic DNA
Genomic DNA was prepared using QIAamp DNA blood mini kit according to the manufacture's instruction (Qiagen, La Jolla, CA). Pfu polymerase (Stratagene) was used to amplify the various parts of the Ig gene from genomic DNA using 30 cycles of 95°C/15 s, 58°C/15 s, 72°C/1 min. The primers used were the following: VDJ region, 5' primer: 5'-AAAA-GCTAGCACAAGAACATGAAAC-ACC-3', 3' primer: 5'-CCATCGATGGCGGTACCTGAGGAGACGGTGACC-3'; 5'VDJ region, 5' primer: 5'-GAGTCTAGAGAATAAAACGCAATG-3', 3' primer: 5'-TAAATAGTACCTGAGA-GCTGCCC-3'; Cµ2–4 region: 5' primer: 5'-CGGACCAGGTGCAGGCTGAGGCC-3', 3' primer: 5'-CTCCCGCAGGTTCAGCTGCT-CCC-3'.

Cloning PCR product and sequencing
PCR products were cloned using the Zero BluntTOPO PCR cloning kit (Invitrogen, Carlsbad, CA). Minipreps were prepared from overnight bacterial cultures using the QIAPREP 8 miniprep kit (Qiagen) and sequenced on an ABI model 3700 using standard T3 and T7 primers. The accession numbers of the mutated sequences listed in Table 1Go are AF385858–AF385893.


View this table:
[in this window]
[in a new window]
 
Table 1. Sequencing data derived from cultured Ramos clonesa
 
Extraction of RNA and RT-PCR:
Cells (5–10x106) were lysed with 1 ml Trizol reagent (Gibco/BRL, Gaithersburg, MD) and RNA extracted according to manufacturer's instructions. About 1 µg of total RNA was reverse transcribed in a 20 µl reaction using the Superscript II kit (Gibco/BRL). Taq polymerase (Roche, Indianapolis, IN) was used to amplify the following cDNAs using these primers: GAPDH, 5' primer: 5'-TCCACCACCCTGTTGCTGTAG-3', 3'primer: 5'-GACCACAGTCCATGCCATCACT-3'; AID, 5' primer: 5'-GAGGCAAGAAGACACTCTGG-3', 3' primer: 5'-GTGACATTCCTGGAAGTTGC-3'; Pol {iota}, 5' primer: 5'AAGG-GAAAGGAGAAGTGTGAGTTGTC-3', 3' primer: 5'-TCTGGCTCTCTATTTTCTGTAAGT-3'; Pol {eta}, 5' primer: CGAAATGATAATGACAGCAGGGTAGCC, 3' primer: GGAGCAGTAAGAGATGAAAGCGAAG; Pol µ, 5' primer: 5'-ATGCTCCCCAAACGGCGGCGAGCGC-3', 3' primer: 5'-ACGAATTCTGGAGACATTCAGTGGCCAG-3'; Pol {zeta}, 5' primer: 5'-GCTCCAGTATGTGTACCATCTTGT-3', 3' primer: 5'-CATTTTGTGTTCAAGATGATGGC3'; Pol {kappa}, 5' primer: 5'-TAGGAATGGGATAAGAAGGTGAT-3', 3' primer: 5'-TGACAAGAAATGAAATAC-TGCCA-3'; MSH2, 5' primer: 5'-CCCAAGGATGCCATTGTTAAAGAAA-3', 3' primer: 5'-TTAACAGTTGGTATCTGATTGGCC-3'. Then 5 µl of the reverse-transcribed product was diluted 5-fold with H2O sequentially 4 times, and 1 µl of each of these four dilutions was used in a PCR reaction and all amplifications of each cDNA from each different clone were done together. 30 cycles of 95°C/15 s, 58°C/15 s and 72°C/1 min was used for all amplifications, except that only 24 cycles were used for GAPDH. The same PCR reactions in which reverse transcriptase was omitted during the initial step yielded no detectable products (data not shown). PCR products were electrophoresed together on a 1% agarose gel and photographed using a Chemi imager by Alpha Innotech (San Leandro, CA). PCR products were cloned and sequenced to confirm identity of cDNAs (data not shown). Densitometry was performed using NIH Image 1.62 and GAPDH-normalized values for AID were plotted. Primary data of three different experiments presented in Fig. 3(A and CGo) was measured by ANOVA analysis and the post hoc Dunnett t-test (two-sided).



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 3. RT-PCR analyses show that AID expression is lower in the non-mutating clone 1-12. (A) Five-fold sequential dilutions of reverse-transcribed RNA extracted from clones 7-3 (3-month culture of clone 7), 6-1 (1 month culture of clone 6) and 1-12 (12-month culture of clone 1) were subjected to PCR reactions of the indicated genes. PCR reactions for samples from a set were done together, and electrophoresed on the same gel and photographed. Expression of AID relative to clone 1-12 (set at 1) after GAPDH normalization is represented on a bar graph + SD (*P = 0.025 and **P = 0.023 for comparisons of AID levels to 1-12). Mutation rates for each clone (mutations/bp/generation) obtained from Table 1Go are shown above the graph. (B) Same as in (A), except that reverse-transcribed RNA from clones 1-12, subclones A and B of clone 1-12, and the human T-cell line HUT-78 were used. (C) Same as A, except that reverse-transcribed RNA from clones 6-0, 6-1, 6-2, 71-0 and 71-3 were used. Expression of AID relative to clone 6-0 (for clones 6-1 and 6-2) and to clone 71-0 (for clone 71-3) after GAPDH normalization is represented on a bar graph + SD (*P = 0.005 and **P = 0.002 for comparisons of AID levels to 6-2 and 71-3 respectively). Mutation rates for each clone (mutations/bp/generation) obtained by fluctuation analysis from Fig. 2Go are shown above the graph. Data for panels (A)–(C) are representative of three independent experiments.

 
cDNA microarray analysis
Description of the protocol and of the microarray used at the Albert Einstein College of Medicine is described in detail by Mariadason et al. (23). Three microarray hybridizations were used for each comparison of 6-1 versus 1-12 and of 7-3 versus 1-12A. For each microarray hybridization, differences that were >2-fold with signals that were 50% above background were scored. For each set (e.g. 6-1 versus 1-12), consistent differences were defined as differences that were scored in two of three hybridizations. The same genes that were consistently different in both sets are presented in Table 3Go. The relative expression difference was obtained by dividing the expression values of mutating clones by non-mutating clones for both sets.


View this table:
[in this window]
[in a new window]
 
Table 3. cDNA microarray analysis of mutating versus non-mutating Ramos clones
 

    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The human Epstein–Barr-negative Burkitt's lymphoma cell line Ramos was recently reported to constitutively hypermutate the V regions of its productively rearranged µ heavy chain Ig gene (10). Based on the sequencing of unselected V regions, Sale and Neuberger estimated that the rate of mutation of their Ramos cell line was ~2.5x10-5 mutations/bp/generation (10). To confirm that the Ramos cell line that we were using had retained the ability to undergo V region hypermutation, we selected a random subclone (clone 1), grew it in culture for 2 months and sequenced unselected, cloned PCR products amplified from the V region of the µ heavy chain. Only three of the 27 sequences had unique base changes (clone 1-2, Table 1Go). Although there were not enough base changes to accurately calculate a rate of mutation, this frequency (Table 1Go) suggested that these cells were mutating at a rate that was 10-fold less than reported previously (10). When clone 1 was grown continuously in culture for 12 months and then analyzed, we did not detect any mutated V regions (clone 1-12; Table 1Go). Thus, although the original Ramos clone was mutating, albeit at low levels, this latter finding suggested that cells that had lost the ability to mutate had outgrown the mutating cells during this 12-month period.

To examine the characteristics of this apparent clonal heterogeneity more carefully, we needed an assay that would allow us to determine the mutation rate in many individual subclones after relatively short periods of growth. We have previously reported such an assay in which cells with a nonsense mutation in their V region were analyzed for reversion of that nonsense codon by using the ELISA spot assay to detect for individual IgM-secreting cells (20). This assay requires only a 20-day culture period (i.e. the time it takes for an individual cell to expand to ~1x106 cells required for the assay). At least 10 subclones are assayed for every clone and the rates of mutation are then calculated using fluctuation analysis (21,22). To obtain cells with a nonsense mutation in the V region of their endogenous heavy chain gene, the same Ramos clone described above was grown for 3 months and sorted for IgM- cells. The V regions from µ- clones were then sequenced. A total of 38 µ- {lambda}+ clones were obtained; 25 of these clones (66%) had nonsense mutations in the single copy of their endogenous V region (Table 2Go). The identification of cells with nonsense mutations in their V regions shows that mutation was occurring in clone 1 and confirms the sequencing results (Table 1Go, clone 1-2). By Southern blot analysis, four clones (11%) had deletions within the Sµ–Cµ region, while one clone (clone 5) had deleted the productive Ig heavy chain gene (data not shown). The remaining clones had no identifiable mutations within the coding region of the Ig gene and the basis for their loss of µ production has yet to be determined.


View this table:
[in this window]
[in a new window]
 
Table 2. Neighboring sequences for nonsense mutation and associated base changes in Ramos clones
 
Characterization of mutation rates in Ramos clones with V region nonsense codons
Of the 25 non-producers that have nonsense codons in their V region, at least 11 had undergone independent mutations (Table 2Go, clones 96, 7, 65, 56, 6, 62, 71, 46, 10, 61 and 67). Four other non-producers had associated base changes in addition to the nonsense mutations already described (Table 2Go, clones 82, 80, 8 and 30). Although it is difficult to know whether the nonsense mutation or the associated base change occurred first, the finding of the two mutations in one V region suggests that mutation is ongoing in these subclones. Nonsense mutations were present throughout the entire V region (Table 2Go and Fig. 1Go). Fluctuation analysis of the 11 independent nonsense mutants carried out immediately after their isolation showed reversion rates ranging from 2.1x10-6 to 5.6x10-5 mutations/bp/generation, with an average rate of mutation of 1.6x10-5 mutations/bp/generation. These rates of mutation are higher than the rate calculated for clone 1 by sequencing unselected V regions (Table 1Go, clone 1-2). This suggested that by isolating cells with nonsense mutations, we had isolated more highly mutating subclones of Ramos. In fact, when clone 6 was carried in culture for 2 months and unselected V regions were sequenced, there were 4 times as many base changes in its µ V region as were found in the parental clone 1 after a similar amount of time (Table 1Go, clone 1-2 compared to clone 6-2). The frequency of mutation in clone 6 after only 1 month in culture was even higher (Table 1Go, clone 6-1 V) and mutations were targeted to the V region (Table 1Go, clone 6-1 V compared to 5' V and Cµ2–4). Clone 7 also accumulated many V region mutations (Table 1Go, clone 7-3). Based on this sequence data, we calculated that clone 6 mutated at rates of 1.4–3.0x10-5 mutations/bp/generation and clone 7 at a rate of 1.4x10-5 mutations/bp/generation. These values are similar to the rates of 5.6x10-5 mutations/bp/generation for clone 6 and 1.9x10-5 mutations/bp/generation for clone 7 derived by fluctuation analyses (Fig. 2Go), and to the rate of 2.5x10-5 mutations/bp/generation reported previously (10).



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Mutation rates of Ramos clones with nonsense codons located throughout the V region. The mutation rates determined by fluctuation analyses are shown relative to the position of the nonsense codon for each clone. The revertant frequencies for subclones of clones 6, 7, 30, 71 and the negative control clone 5 are shown in Fig. 2Go (i.e. 6-0, 7-0, 30-0, 71-0 and 5). *P = 0.009 and **P = 0.07 for comparison of rates between clones 6 and 62, and between clones 10 and 8 respectively.

 


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 2. Fluctuation analyses reveals clonal instability of hypermutation in Ramos clones. Clones 6, 7, 30 and 71 were subcloned after carrying cultures for 0 months (–0), 1 month (–1), 2 months (–2) and 3 months (–3), and revertant frequencies plotted after ~20 days. Rates are shown on the bottom of each column for each clone. Clone 5 that had deleted the Ig gene (see text) was the negative control. Filled-in circles indicate that no ELISA spots were observed and thus those figures represent the detection limit of that assay. The three filled-in circles for subclones of 6-2 contained deletions of 10 bp, 17 bp and a large undefined deletion of the Ig gene. As these clones were not expected to produce ELISA spots, they were omitted from the rate calculations. *P = 0.013, **P = 0.007 and ***P = 0.005 for comparison of rates between clones 6-0 and 6-1, between clones 6-0 and 6-2, and between clones 71-0 and 71-3 respectively.

 
In vivo, RGYW and the complementary WRCY sequences are preferentially mutated over other sequences in the V regions of Ig genes (24,25). While it is difficult to determine the exact difference in the rate of mutation of hotspots and non-hotspots by sequencing, two sets of the clones with nonsense mutations confirmed the preferential targeting of hotspot motifs over other sequences and allowed quantification of this process. At codon 47, independent mutations result in an AG TAG nonsense hotspot motif in clone 6 and an AG TGA nonsense non-hotspot motif in clone 62 (Table 2Go). Clone 6 mutated at a rate that was nearly 8-fold higher than clone 62 (Fig. 1Go). At codon 77, both clones 10 and 8 have TAG nonsense codons; however, an associated base change next to the nonsense codon converts the TAG CT nonsense hotspot motif in clone 10 into a TAG AT nonsense non-hotspot motif in clone 8. Clone 10 had a 4-fold higher rate of mutation than clone 8. This difference did not achieve statistical significance but likely also reflects increased targeting of mutation to hotspot motifs (Fig. 1Go). The reliability of fluctuation analyses is illustrated by the fact that clones with the same nonsense codon that have associated base changes that are distant from the nonsense codon mutate at similar rates (i.e. clones 7 and 82, 71 and 80, 67 and 30; Fig. 1Go). Thus, at a particular codon, RGYW/WRCY hotspot motifs are preferentially mutated over non-hotspot motifs in Ramos cells, suggesting that the process of mutation in these cells is similar to V region mutation in vivo.

To verify that the ELISA spots generated during the fluctuation analysis were due to cells that mutated the nonsense codon, eight individual subclones of clone 6 were cultured for 2 months, enriched for µ+ cells and the V regions sequenced. Of the 17 revertant sequences identified, 11 were independent because they were obtained from different subclones of clone 6. Despite the fact that the first two bases of the TAG stop codon in clone 6 are part of an AG TAG hotspot motif, all but one mutation occurred in the G at the third base which is not part of the hotspot. Seven G -> C and three G -> T mutations were identified at the third base, while an A -> G mutation arose at the second base. This is not surprising, considering that the overwhelming majority of mutations in Ramos target G/C bases (10) (Table 1Go). Theoretically, this G at the third base can mutate to an A, T or C. However, since we enriched for µ+ cells, a G -> A mutation would not be detected amongst revertants because it would produce a TAA nonsense codon.

Clonal instability of V region hypermutation
The finding that our original Ramos clone progressively lost the ability to mutate its V region when maintained in culture (Table 1Go) suggested that V region hypermutation is unstable in Ramos cells. This notion was supported by the observed drop in mutation rates between 1 and 2 month cultures of clone 6 (Table 1Go). The shorter assay period used to determine mutation rates by fluctuation analysis allows the periodic quantification of the mutation rate as clones are propagated. Using this assay, it is therefore possible to determine whether mutation rates of the V region were stable or unstable in Ramos clones. Clones 6, 7, 30 and 71 were carried in culture and at various times subclones were removed and rates of mutation determined by fluctuation analyses. As a control for non-specific ELISA spotting, the µ- clone 5 that had deleted the Ig gene was examined and no IgM-secreting cells were detected (filled-in circles in Fig. 2Go means that no ELISA spots were detected), indicating that there is little or no background in the ELISA spot assay. Clone 7 mutated at the same rate even after 3 months of culture (Fig. 2Go, 7-0 versus 7-3). However, the rate of mutation of clone 6 decreased 10-fold after 1 month in culture and decreased a further 2-fold after 2 months in culture (Fig. 2Go, 6-0 versus 6-1 and 6-2). The three subclones derived from the 2-month culture of clone 6 that did not produce ELISA spots (filled in spots in Fig. 2Go) contained deletions that led to frame shifts within their V regions (data not shown) and were therefore not expected to revert at a detectable rate. The mutation rate of clone 71 dropped 35-fold after 3 months in culture, while that of clone 30 remained essentially unchanged after 3 months in culture (Fig. 2Go). However, in clone 30 there appear to be two populations, one that retained the high mutation rate and the other that mutated at a lower rate, suggesting that clone 30 may be in the process of generating lower mutating clones as well. Different Ramos subclones can therefore exhibit relatively stable (at least within the assay period used) or unstable mutating phenotypes.

AID levels correlate with mutation rate
To investigate the basis for the clonal instability of hypermutation in Ramos clones, we examined the expression profiles of genes in mutating and non-mutating Ramos clones as a means to identify trans-acting factors that might account for this effect. We undertook this comparison using an RT-PCR analysis of candidate genes involved in hypermutation. These include the error-prone DNA polymerases {eta} (26), {iota} (27), {kappa} (28), µ (29) and {zeta} (30), which are believed to be involved in translesional repair of damaged DNA, the putative cytidine deaminase AID (9) and the mismatch repair enzyme MSH2 (reviewed in 31). To determine whether expression differences of these genes exist between mutating and non-mutating clones, semi-quantitative RT-PCR was performed on clones 6-1 and 7-3, and the non-mutating clone 1-12. Simultaneous PCR reactions specific for GAPDH were first performed using 5-fold sequential dilutions of template cDNA to demonstrate linearity and normality between each sample (Fig. 3Go). The expression levels of MSH2 and of the DNA polymerases {iota}, {kappa}, and {zeta} were similar in all samples (Fig. 3AGo). On the other hand, the levels of DNA polymerase µ were at least 25-fold lower in clone 7-3 than in clones 1-12 and 6-1, while the levels of DNA polymerase {eta} were a little higher in clone 1-12 than in clones 7-3 and 6-1 (Fig. 3AGo). Interestingly, AID cDNA levels were at least 5-fold lower in the non-mutating clone 1-12 than in clones 6-1 and 7-3 (Fig. 3AGo). AID cDNA levels were also low in subclones derived from 1-12 (Fig. 3BGo) and, as expected, were not detectable in the T-cell line HUT-78 (Fig. 3BGo). In addition, the levels of AID cDNA decreased along with the progressively decreasing rates of mutation in clones 6 and 71 (Fig. 3CGo). These data suggest that expression levels of AID account for the differences in the rate of mutation in Ramos clones.

cDNA microarray analysis revealed few differences in gene expression between mutating and non-mutating Ramos clones
While the RT-PCR analyses suggests AID expression is responsible for the difference in mutation rates between different clones, other genes whose expression was not analyzed might also contribute partially or fully to this effect. To examine this, and to determine how different the mutating and the non-mutating clones were in their general pattern of gene expression, we performed a more extensive survey of gene expression differences using cDNA microarrays. For this analysis, two sets of comparisons were made between mutating and non-mutating clones: 6-1 (mutating) versus 1-12 (non-mutating) and 7-3 (mutating) versus 1-12A (sublone of 1-12; see Fig. 3BGo). Approximately 9000 unique human genes are imprinted on the cDNA microarrays used. With the exception of DNA polymerase {zeta} and GAPDH, none of the genes assayed in the RT-PCR experiment shown above are present on our cDNA microarray. Of the ~9000 genes, 42 and 27 differences existed for 6-1 versus 1-12 and 7-3 versus 1-12A respectively (data not shown). Differences that were shared between both sets are presented in Table 3Go. Only eight genes showed consistent differences in expression between both sets of mutating and non-mutating clones. Four genes were over-expressed while four genes were under-expressed in the mutating clones (Table 3Go). RT-PCR analysis confirmed a low level of SKAP55 expression in the mutating clones 6-1 and 7-3, thus supporting the differences observed by the cDNA microarray analysis (data not shown). The significance of these eight differences to the mutational process is presently not known.


    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The results presented here confirm the finding that Ramos mutates its µ heavy chain V region constitutively (10). Although we showed that the mutation rates for two subclones (i.e. clones 7 and 30; Fig. 2Go) remained high even after 3 months in culture, the rate of mutation of other subclones (i.e. clones 6 and 71; Fig. 2Go) decreased progressively over time. In addition, the parental Ramos clone 1 that was used to derive these clones was not mutating after a 12-month culture period. An explanation for this instability is provided by the recent findings that bcl-6 (32) and the translocated c-myc (33) are also targets of the mutational process in cultured cells. Mutations within these genes, and possibly within other yet to be identified genes, might affect the expression and/or the activity of the respective protein that would in turn reduce the fitness of that cell in culture. Thus long culture periods would favor outgrowth of more stable non-mutating or weakly mutating clones.

The clonal variation and instability of Ramos clones was documented using two different techniques, each of which has limitations, but together they proved to be informative. The benefit of sequencing unselected V regions is that it samples codons throughout the whole V region and reveals biochemical characteristics of the mutational process. However, if this approach were used for the analysis of many clones, a very large number of sequences would have to be determined to achieve statistical significance. Furthermore, the long culture period required for V regions to accumulate enough mutations to allow for a quantification of mutation rate by sequencing could be associated with the outgrowth of non-mutating clones leading to an underestimation of mutation rate. Thus, mutation rates calculated in this manner are at best averages for the culture period, leaving open the possibility that some clones may have had much higher mutation rates sometime during this period. Reversion and fluctuation analyses allow a more rapid evaluation of many subclones and provide results that can be tested for statistical significance. However, the important observation is that both forms of analysis reveal rates of mutation that are similar and together provide strong support for clonal variation and for the different characteristics of each subclone.

By obtaining IgM- Ramos clones for the purpose of fluctuation analyses, we found that all such clones were highly mutating (Table 1Go and Fig. 1Go), which was surprising since the culture that these cells were derived from was mutating at low levels (Table 1Go, clone 1-2). This suggested to us that this procedure allows one to purify mutating clones from a largely non-mutating population. We speculate that cells which have introduced a nonsense codon into the V region had to be undergoing V region mutation at a relatively high rate and thus by sorting for IgM- cells, we essentially separated mutating from mostly non-mutating cells. It is thus possible that mutating clones of uninduced CL-01 and BL-2, which normally require surface IgM cross-linking and T cell help to mutate (18,19), can be obtained by the same methods used in this study.

The mutational process in Ramos resembles that which occurs in vivo in that mutations are more frequently introduced into RGYW and the complementary WRCY sequences (10). This is an important characteristic of the mutational process since it probably reflects a general property of the mutational machinery which might provide clues of the enzymes involved. To ascertain the relative influence that the core RGYW/WRCY sequence confers to mutation rate, it is important to compare this motif to a non-hotspot at the same codon and, therefore, in the context of the same flanking sequences. This is because sequences that neighbor hotspot motifs may have an influence on mutation rates (34,35), which is supported by the fact that not all RGYW/WRCY sequences in the V region behave as mutational hotspots (3638). Fluctuation analysis is perfectly suited for such an analysis because it would not require sequencing hundreds of VDJ sequences that would make a comparison between a hotspot and a non-hotspot at the same codon valid. In this study, fluctuation analyses using two sets of clones (i.e. clones 6 and 62, and clones 10 and 8; Fig. 1Go) showed that some RGYW/WRCY hotspot motifs are indeed preferentially targeted for mutation by >4-fold over non-hotspot motifs at the same codon.

A comparison of the genes expressed in the high and low mutating clones could shed new light on the mechanism of V region mutation as well as explain the basis for the clonal variation in stable and unstable subclones. We have taken two approaches to identify genes that are differentially expressed in the high and low mutating clones. cDNA microarrays containing ~9000 genes were used to compare gene expression between the mutating clones 7-3 and 6-1 to the non-mutating clones 1-12 and 1-12A. Each of these comparisons revealed 30–40 differences, indicating that clones that had been grown separately for 1 year were quite similar to each other in these gene expression patterns. When these two data sets were combined, only eight reproducible differences of gene expression were observed (Table 3Go). SKAP55, an adaptor protein involved in antigen receptor signaling in lymphocytes (39), was expressed at lowest levels in the mutating clones by this analysis. In contrast, an expressed sequence tags (EST) was over-expressed at highest levels in mutating clones. Whether the changes in expression of each of these genes are a response to the mutational process rather than the cause of mutation is not known. However, what is most striking from this analysis is how similar these clones are to each other with respect to gene expression differences.

As an alternative approach, the expression of genes thought to play a role in somatic hypermutation was examined by RT-PCR. This analysis revealed that the expression levels of AID correlated with mutation rates. AID cDNA levels were >5-fold lower in the non-mutating clone 1-12 than in the mutating clones 6-1 and 7-3 (Fig. 3AGo). In addition, when clones 6 and 71 were propagated in culture, the mutation rates and the levels of AID were observed to decrease in parallel (Fig. 3CGo). The levels of AID are similar between clones 6-0 and 71-0 (Fig. 3CGo), while 6-0 has a 3-fold higher rate of mutation than 71-0. While this could suggest that AID levels do not necessarily correlate with mutation rates, mutation rates for 6-0 and 71-0 were calculated by reversion analysis of different nonsense codons. Rates measured in this way are expected to be affected by the sequence context of the nonsense codon (see Fig. 1Go and above), producing apparent differences in rate between these two clones. Thus, it is important to compare how the levels of AID correlate with mutations rates within the same clone. This was not necessary in Fig. 3(AGo), since mutation rates for all three different clones were measured by sequencing V regions.

AID shows sequence identity to the RNA-editing deaminase family and has been observed to possess cytidine deaminase activity in vitro (40). Knockout studies show that loss of AID expression produces mice that mutate their V regions at least 10-fold lower than controls, implicating this enzyme in the hypermutation process (9). The data presented here, although only associative, supports the role of AID as an important player in this process in human cells. Whether the reduced expression of AID is the cause of the observed decreased in mutation rate is not clear. However, if this is true, it would be surprising that a 5-fold reduction in AID results in a >100-fold decrease in V region mutation. This might argue against AID having a direct effect on mutation, and would suggest that it is involved in an upstream process such as the editing of mRNA for proteins required for mutation. Thus, small changes in protein level could produce amplified effects. On the other hand, AID could be directly involved in mutation, such as by deaminating cytosine residues in the V region. In this case, small differences in AID expression might also produce large effects if it were to function as a dimer (or multimer) or was part of a large complex of proteins possibly involving error-prone polymerases and mismatch-repair proteins.

Error-prone DNA polymerases have long been implicated in hypermutation (41). With the recent cloning and characterization of these mammalian enzymes (27,29,30,42,43), much of the work is presently focused on assessing whether they are indeed involved (13,4446). We found that the cDNA levels of the error-prone DNA polymerase µ and {eta} varied in different clones (Fig. 3Go), while that of the other error-prone DNA polymerases {iota}, {kappa} and {zeta} were relatively uniformly expressed. The lack of correlation of polymerase µ expression with mutation suggests that it is not required for somatic hypermutation in Ramos. On the other hand, DNA polymerase {eta} was found to be expressed at a slightly lower level in mutating Ramos clones, which supports a finding that the expression of this polymerase decreases when CL-01 cells are induced to mutate (46). It is tempting to speculate that the lower expression of DNA polymerase {eta} in mutating Ramos clones is the reason for the targeting bias of G/C residues in mutation (Table 1Go) in light of the fact that this polymerase has been implicated as being the A/T mutator (44).


    Acknowledgments
 
We would like to thank Drs B. Diamond and M. J. Shulman for critical review of the manuscript, to Drs S. Sack and S. Murray for help with the microarray, and to Manxia Fan for technical support. This work was supported by the National Institutes of Health to V. P. and P. B. (5T32CA09173), to C. W. (T326M07491), and to M. D. S. (CA73649), who is also supported by the Harry Eagle chair provided by the National Women's Division of the Albert Einstein College of Medicine. A. M. is a recipient of Cancer Research Institute and Harry Eagle Fellowships.


    Abbreviations
 
AID activation-induced cytidine deaminase
EST expressed sequence tags

    Notes
 
Transmitting editor: J. V. Ravetch

Received 7 May 2001, accepted 13 June 2001.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Weigert, M. G., Cesari, I. M., Yonkovich, S. J. and Cohn, M. 1970. Variability in the lambda light chain sequences of mouse antibody. Nature 228:1045.[Medline]
  2. Harris, R. S., Kong, Q. and Maizels, N. 1999. Somatic hypermutation and the three Rs: repair, replication and recombination. Mutat. Res. 436:157.[Web of Science][Medline]
  3. Kim, N. and Storb, U. 1998. The role of DNA repair in somatic hypermutation of immunoglobulin genes. J. Exp. Med. 187:1729.[Free Full Text]
  4. Kim, N., Bozek, G., Lo, J. C. and Storb, U. 1999. Different mismatch repair deficiencies all have the same effects on somatic hypermutation: intact primary mechanism accompanied by secondary modifications. J. Exp. Med. 190:21.[Abstract/Free Full Text]
  5. Rada, C., Ehrenstein, M. R., Neuberger, M. S. and Milstein, C. 1998. Hot spot focusing of somatic hypermutation in MSH2-deficient mice suggests two stages of mutational targeting. Immunity 9:135.[Web of Science][Medline]
  6. Phung, Q. H., Winter, D. B., Cranston, A., Tarone, R. E., Bohr, V. A., Fishel, R. and Gearhart, P. J. 1998. Increased hypermutation at G and C nucleotides in immunoglobulin variable genes from mice deficient in the MSH2 mismatch repair protein. J. Exp. Med. 187:1745.[Abstract/Free Full Text]
  7. Wiesendanger, M., Kneitz, B., Edelmann, W. and Scharff, M. D. 2000. Somatic hypermutation in MutS homologue (MSH)3-, MSH6-, and MSH3/MSH6-deficient mice reveals a role for the MSH2-MSH6 heterodimer in modulating the base substitution pattern. J. Exp. Med. 191:579.[Abstract/Free Full Text]
  8. Cascalho, M., Wong, J., Steinberg, C. and Wabl, M. 1998. Mismatch repair co-opted by hypermutation. Science 279:1207.[Abstract/Free Full Text]
  9. Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y. and Honjo, T. 2000. Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102:553.[Web of Science][Medline]
  10. Sale, J. E. and Neuberger, M. S. 1998. TdT-accessible breaks are scattered over the immunoglobulin V domain in a constitutively hypermutating B cell line. Immunity 9:859.[Web of Science][Medline]
  11. Bross, L., Fukita, Y., McBlane, F., Demolliere, C., Rajewsky, K. and Jacobs, H. 2000. DNA double-strand breaks in immunoglobulin genes undergoing somatic hypermutation. Immunity 13:589.[Web of Science][Medline]
  12. Papavasiliou, F. N. and Schatz, D. G. 2000. Cell-cycle-regulated DNA double-stranded breaks in somatic hypermutation of immunoglobulin genes. Nature 408:216.[Medline]
  13. Poltoratsky, V., Goodman, M. F. and Scharff, M. D. 2000. Error-prone candidates vie for somatic mutation. J. Exp. Med. 192:F27.[Free Full Text]
  14. Goodman, M. F. and Tippin, B. 2000. Sloppier copier DNA polymerases involved in genome repair. Curr. Opin. Genet. Dev. 10:162.[Web of Science][Medline]
  15. Green, N. S., Lin, M. M. and Scharff, M. D. 1998. Immunoglobulin hypermutation in cultured cells. Immunol. Rev. 162:77.[Web of Science][Medline]
  16. Kobrin, B. J., Casadevall, A., Pirofski, L.-A., Schiff, C. and Scharff, M. D. 1990. The somatic instability of immunoglobulin genes in cultured cells. In Steele, E. J., ed., Somatic Hypermutation in V Regions, p. 11. CRC Press, Boca Raton, FL.
  17. Wabl, M., Burrows, P. D., von Gabain, A. and Steinberg, C. 1985. Hypermutation at the immunoglobulin heavy chain locus in a pre-B-cell line. Proc. Natl Acad. Sci. USA 82:479.[Abstract/Free Full Text]
  18. Denepoux, S., Razanajaona, D., Blanchard, D., Meffre, G., Capra, J. D., Banchereau, J. and Lebecque, S. 1997. Induction of somatic mutation in a human B cell line in vitro. Immunity 6:35.[Web of Science][Medline]
  19. Zan, H., Cerutti, A., Dramitinos, P., Schaffer, A., Li, Z. and Casali, P. 1999. Induction of Ig somatic hypermutation and class switching in a human monoclonal IgM+ IgD+ B cell line in vitro: definition of the requirements and modalities of hypermutation. J. Immunol. 162:3437.[Abstract/Free Full Text]
  20. Green, N. S., Rabinowitz, J. L., Zhu, M., Kobrin, B. J. and Scharff, M. D. 1995. Immunoglobulin variable region hypermutation in hybrids derived from a pre-B- and a myeloma cell line. Proc. Natl Acad. Sci. USA 92:6304.[Abstract/Free Full Text]
  21. Luria, S. E. and Delbruck, M. 1943. Mutation of bacteria from virus sensitivity to virus resistance. Genetics 28:491.[Free Full Text]
  22. Lin, M., Chang, C. J. and Green, N.S. 1996. A new method for estimating high mutation rates in cultured cells. Mutat. Res. 351:105.[Web of Science][Medline]
  23. Mariadason, J. M., Corner, G. A. and Augenlicht, L. H. 2000. Genetic reprogramming in pathways of colonic cell maturation induced by short chain fatty acids: comparison with trichostatin A, sulindac, and curcumin and implications for chemoprevention of colon cancer. Cancer Res. 60:4561.[Abstract/Free Full Text]
  24. Milstein, C., Neuberger, M. S. and Staden, R. 1998. Both DNA strands of antibody genes are hypermutation targets. Proc. Natl Acad. Sci. USA 95:8791.[Abstract/Free Full Text]
  25. Dorner, T., Foster, S. J., Farner, N. L. and Lipsky, P. E. 1998. Somatic hypermutation of human immunoglobulin heavy chain genes: targeting of RGYW motifs on both DNA strands. Eur. J. Immunol. 28:3384.[Web of Science][Medline]
  26. Matsuda, T., Bebenek, K., Masutani, C., Hanaoka, F. and Kunkel, T. A. 2000. Low fidelity DNA synthesis by human DNA polymerase-eta. Nature 404:1011.[Medline]
  27. Tissier, A., McDonald, J. P., Frank, E. G. and Woodgate, R. 2000. poliota, a remarkably error-prone human DNA polymerase. Genes Dev. 14:1642.[Abstract/Free Full Text]
  28. Zhang, Y., Yuan, F., Wu, X., Wang, M., Rechkoblit, O., Taylor, J. S., Geacintov, N. E. and Wang, Z. 2000. Error-free and error-prone lesion bypass by human DNA polymerase kappa in vitro [In process citation]. Nucleic Acids Res.. 28:4138.[Abstract/Free Full Text]
  29. Dominguez, O., Ruiz, J. F., Lain de Lera, T., Garcia-Diaz, M., Gonzalez, M. A., Kirchhoff, T., Martinez, A. C., Bernad, A. and Blanco, L. 2000. DNA polymerase mu (Pol mu), homologous to TdT, could act as a DNA mutator in eukaryotic cells. EMBO J. 19:1731.[Web of Science][Medline]
  30. Kawamura, K., J, O. W., Bahar, R., Koshikawa, N., Shishikura, T., Nakagawara, A., Sakiyama, S., Kajiwara, K., Kimura, M. and Tagawa, M. 2001. The error-prone DNA polymerase zeta catalytic subunit (Rev3) gene is ubiquitously expressed in normal and malignant human tissues. Int. J. Oncol. 18:97.[Web of Science][Medline]
  31. Wiesendanger, M., Scharff, M. D. and Edelmann, W. 1998. Somatic hypermutation, transcription, and DNA mismatch repair. Cell 94:415.[Web of Science][Medline]
  32. Zan, H., Li, Z., Yamaji, K., Dramitinos, P., Cerutti, A. and Casali, P. 2000. B cell receptor engagement and T cell contact induce Bcl-6 somatic hypermutation in human B cells: identity with Ig hypermutation. J. Immunol. 165:830.[Abstract/Free Full Text]
  33. Bemark, M. and Neuberger, M. S. 2000. The c-MYC allele that is translocated into the IgH locus undergoes constitutive hypermutation in a Burkitt's lymphoma line. Oncogene 19:3404.[Web of Science][Medline]
  34. Bachl, J., Steinberg, C. and Wabl, M. 1997. Critical test of hot spot motifs for immunoglobulin hypermutation. Eur. J. Immunol. 27:3398.[Web of Science][Medline]
  35. Lin, M. M., Zhu, M. and Scharff, M. D. 1997. Sequence dependent hypermutation of the immunoglobulin heavy chain in cultured B cells. Proc. Natl Acad. Sci. USA 94:5284.[Abstract/Free Full Text]
  36. Goyenechea, B. and Milstein, C. 1996. Modifying the sequence of an immunoglobulin V-gene alters the resulting pattern of hypermutation. Proc. Natl Acad. Sci. USA 93:13979.[Abstract/Free Full Text]
  37. Dorner, T., Foster, S. J., Brezinschek, H. P. and Lipsky, P. E. 1998. Analysis of the targeting of the hypermutational machinery and the impact of subsequent selection on the distribution of nucleotide changes in human VHDJH rearrangements. Immunol. Rev. 162:161.[Web of Science][Medline]
  38. Wagner, S. D., Milstein, C. and Neuberger, M. S. 1995. Codon bias targets mutation. Nature 376:732.[Medline]
  39. Marie-Cardine, A., Bruyns, E., Eckerskorn, C., Kirchgessner, H., Meuer, S. C. and Schraven, B. 1997. Molecular cloning of SKAP55, a novel protein that associates with the protein tyrosine kinase p59fyn in human T-lymphocytes. J. Biol. Chem. 272:16077.[Abstract/Free Full Text]
  40. Muramatsu, M., Sankaranand, V. S., Anant, S., Sugai, M., Kinoshita, K., Davidson, N. O. and Honjo, T. 1999. Specific expression of activation-induced cytidine deaminase (AID), a novel member of the RNA-editing deaminase family in germinal center B cells. J. Biol. Chem. 274:18470.[Abstract/Free Full Text]
  41. Brenner, S. and Milstein, C. 1966. Origin of antibody variation. Nature 211:242.[Medline]
  42. Zhang, Y., Yuan, F., Wu, X., Rechkoblit, O., Taylor, J. S., Geacintov, N. E. and Wang, Z. 2000. Error-prone lesion bypass by human DNA polymerase eta. Nucleic Acids Res. 28:4717.[Abstract/Free Full Text]
  43. Zhang, Y., Yuan, F., Xin, H., Wu, X., Rajpal, D. K., Yang, D. and Wang, Z. 2000. Human DNA polymerase kappa synthesizes DNA with extraordinarily low fidelity [In process citation]. Nucleic Acids Res. 28:4147.[Abstract/Free Full Text]
  44. Zeng, X., Winter, D. B., Kasmer, C., Kraemer, K. H., Lehmann, A. R. and Gearhart, P. J. 2001. DNA polymerase eta is an A–T mutator in somatic hypermutation of immunoglobulin variable genes. Nat. Immunol. 2:537.[Web of Science][Medline]
  45. Rogozin, I. B., Pavlov, Y. I., Bebenek, K., Matsuda, T. and Kunkel, T. A. 2001. Somatic mutation hotspots correlate with DNA polymerase eta error spectrum. Nat. Immunol. 2:530.[Web of Science][Medline]
  46. Zan, H., Komori, A., Li, Z., Cerutti, A., Schaffer, A., Flajnik, M. F., Diaz, M. and Casali, P. 2001. The translesion DNA polymerase zeta plays a major role in Ig and bcl-6 somatic hypermutation. Immunity 14:643.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
A. Ukai, K. Ishimaru, R. Ouchida, H. Mori, C. Kano, T. Moritan, and J.-Y. Wang
Induction of A:T Mutations Is Dependent on Cellular Environment but Independent of Mutation Frequency and Target Gene Location
J. Immunol., December 1, 2008; 181(11): 7835 - 7842.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Mierau, G. A. Drexler, A. Kutzera, K. Braunschmidt, J. Ellwart, F. Eckardt-Schupp, E. Fritz, J. Bachl, and B. Jungnickel
Non-conservative homologous recombination in human B lymphocytes is promoted by activation-induced cytidine deaminase and transcription
Nucleic Acids Res., October 1, 2008; 36(17): 5591 - 5601.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
N. Abboud and A. Casadevall
Immunogenicity of Bacillus anthracis Protective Antigen Domains and Efficacy of Elicited Antibody Responses Depend on Host Genetic Background
Clin. Vaccine Immunol., July 1, 2008; 15(7): 1115 - 1123.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
D. Ronai, M. D. Iglesias-Ussel, M. Fan, Z. Li, A. Martin, and M. D. Scharff
Detection of chromatin-associated single-stranded DNA in regions targeted for somatic hypermutation
J. Exp. Med., January 22, 2007; 204(1): 181 - 190.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Larijani, A. P. Petrov, O. Kolenchenko, M. Berru, S. N. Krylov, and A. Martin
AID Associates with Single-Stranded DNA with High Affinity and a Long Complex Half-Life in a Sequence-Independent Manner
Mol. Cell. Biol., January 1, 2007; 27(1): 20 - 30.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
E. S. Tang and A. Martin
NHEJ-deficient DT40 cells have increased levels of immunoglobulin gene conversion: evidence for a double strand break intermediate
Nucleic Acids Res., December 4, 2006; 34(21): 6345 - 6351.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Tobollik, L. Meyer, M. Buettner, S. Klemmer, B. Kempkes, E. Kremmer, G. Niedobitek, and B. Jungnickel
Epstein-Barr virus nuclear antigen 2 inhibits AID expression during EBV-driven B-cell growth
Blood, December 1, 2006; 108(12): 3859 - 3864.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Q. Pan-Hammarstrom, A. Lahdesmaki, Y. Zhao, L. Du, Z. Zhao, S. Wen, V. L. Ruiz-Perez, D. K. Dunn-Walters, J. A. Goodship, and L. Hammarstrom
Disparate roles of ATR and ATM in immunoglobulin class switch recombination and somatic hypermutation
J. Exp. Med., January 23, 2006; 203(1): 99 - 110.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Ronai, M. D. Iglesias-Ussel, M. Fan, M. J. Shulman, and M. D. Scharff
Complex regulation of somatic hypermutation by cis-acting sequences in the endogenous IgH gene in hybridoma cells
PNAS, August 16, 2005; 102(33): 11829 - 11834.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
P. Vanlandschoot, F. Van Houtte, B. Serruys, and G. Leroux-Roels
The arginine-rich carboxy-terminal domain of the hepatitis B virus core protein mediates attachment of nucleocapsids to cell-surface-expressed heparan sulfate
J. Gen. Virol., January 1, 2005; 86(1): 75 - 84.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Pasqualucci, R. Guglielmino, J. Houldsworth, J. Mohr, S. Aoufouchi, R. Polakiewicz, R. S. K. Chaganti, and R. Dalla-Favera
Expression of the AID protein in normal and neoplastic B cells
Blood, November 15, 2004; 104(10): 3318 - 3325.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
T. Kodera, D. Radu, T. McGaha, P. Zwolo, C. Stoica, H. Cheroute, R. R Pollock, and C. Bona
Cellular and molecular studies of B cells exhibiting reverse somatic mutation throughout life
Genes Cells, November 1, 2004; 9(11): 1005 - 1016.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Machida, K. T.-N. Cheng, V. M.-H. Sung, S. Shimodaira, K. L. Lindsay, A. M. Levine, M.-Y. Lai, and M. M. C. Lai
Hepatitis C virus induces a mutator phenotype: Enhanced mutations of immunoglobulin and protooncogenes
PNAS, March 23, 2004; 101(12): 4262 - 4267.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Albesiano, B. T. Messmer, R. N. Damle, S. L. Allen, K. R. Rai, and N. Chiorazzi
Activation-induced cytidine deaminase in chronic lymphocytic leukemia B cells: expression as multiple forms in a dynamic, variably sized fraction of the clone
Blood, November 1, 2003; 102(9): 3333 - 3339.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Martin and M. D. Scharff
Somatic hypermutation of the AID transgene in B and non-B cells
PNAS, September 17, 2002; 99(19): 12304 - 12308.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. Gurrieri, P. McGuire, H. Zan, X.-J. Yan, A. Cerutti, E. Albesiano, S. L. Allen, V. Vinciguerra, K. R. Rai, M. Ferrarini, et al.
Chronic Lymphocytic Leukemia B Cells Can Undergo Somatic Hypermutation and Intraclonal Immunoglobulin VHDJH Gene Diversification
J. Exp. Med., September 2, 2002; 196(5): 629 - 639.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. Rada, J. M. Jarvis, and C. Milstein
AID-GFP chimeric protein increases hypermutation of Ig genes with no evidence of nuclear localization
PNAS, May 14, 2002; 99(10): 7003 - 7008.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (35)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Zhang, W.
Right arrow Articles by Martin, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, W.
Right arrow Articles by Martin, A.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?