Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wun, H.-L.
Right arrow Articles by Lim, P.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wun, H.-L.
Right arrow Articles by Lim, P.-L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

International Immunology, Vol. 13, No. 9, 1099-1107, September 2001
© 2001 Japanese Society for Immunology

Molecular mimicry: anti-DNA antibodies may arise inadvertently as a response to antibodies generated to microorganisms

Hau-Ling Wun, Danny Tze-Ming Leung, Kong-Chiu Wong1, Yiu-Loon Chui and Pak-Leong Lim

Clinical Immunology Unit and
1 Department of Medicine, The Chinese University of Hong Kong, Prince of Wales Hospital, Shatin, Hong Kong

Correspondence to: P.-L. Lim


    Abstract
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The origin of anti-DNA antibodies remains speculative. We argue that some of these antibodies may arise inadvertently in nature during the course of a normal immune response due to their induction by antibodies which bear structures (mimotopes) that mimic DNA. These antibodies are not necessarily DNA specific but, like the T15 idiotype (id)-positive antibodies which bind to phosphorylcholine, are produced normally to some environmental or microbial antigen. Such a mimotope was found in a T15+ antibody at the highly specific region encoded principally by the D gene, DFL16.1. This mimotope was also found in human antibodies that are encoded by DXP'1, the human counterpart of DFL16.1 and which is used commonly in anti-DNA antibodies. The mimotope is closely related to the epitope responsible for the T15 id and appears to be cryptic or normally hidden in the native protein. The existence of such a common, conserved sequence raises questions about how easily anti-DNA antibodies can be generated in nature and what purpose these proteins may serve. Molecular mimicry with regard to autoimmunity must thus be viewed as existing not necessarily between the infectious agent and self-antigens, but also between the antibodies induced by the organism and the self-antigens.

Keywords: idiotype, epitope, peptide, autoimmunity, mimicry


    Introduction
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The etiology of systemic lupus erythematosus (SLE) is not known, but a distinct abnormality is the presence of a wide array of autoantibodies in the SLE patient or in animal models of the disease (1). Many of these antibodies are directed to various nuclear antigens in the cell and have no obvious pathogenicity, but anti-DNA antibodies are increasingly implicated in the pathogenesis of SLE (reviewed in 2).

A clue to understanding the pathogenesis of SLE may come from unraveling the mechanisms involved in the generation of anti-DNA and other autoantibodies. There has been intense investigation in this area but, so far, there are no clear answers. It is not certain, for example, what the real immunogen is that initiates an anti-DNA response. A possible candidate is bacterial DNAs (3), which, with their high unmethylated CpG content, can stimulate the immune system like any foreign antigen. Mammalian DNAs, on the one hand, have more conserved sequences and are consequently less immunogenic, but which, on the other hand, are more appropriately targeted by the autoimmune response (4). It is possible, however, that these and other nuclear antigens can become more immunogenic in the lupus environment through abnormal presentation to the immune apparatus (5). Substances which mimic DNA provide an attractive alternative, but no naturally occurring surrogate has been identified; a synthetic peptide surrogate, however, was recently described (6). For other autoantigens, such as Sm (7) and smooth muscle (8), viral homologues are known which can induce production of the respective autoantibody following infection by the virus. Autoantibodies may also be generated by epitope spreading (9) in which, for example, immunization with a Sm peptide induces antibodies not only to Sm, but also to other antigens that are normally associated with Sm. Finally, a mechanism based on the idiotype (id)–anti-id network theory of Jerne (10) has been advanced to explain how anti-DNA antibodies may be generated. This assumes that the original stimulus is still DNA, but during the course of the immune response and following the induction of the primary anti-DNA antibodies (Ab1), successive generations of antibodies are produced which are directed at the specificity determinants or id of the antibody molecule and one of these anti-id antibodies (Ab3) is specific for DNA, i.e. an id is present in Ab2 which is a DNA mimotope. Thus, immunization of normal or lupus-prone mice with some types of anti-DNA antibodies, or with anti-id antibodies to these proteins, were found to result in the production of anti-DNA antibodies (reviewed in 11). Both human and mouse antibodies, and more recently peptides of these antibodies including those based on the VHCDR3 segment (third complementarity-determining region in heavy chain), were found to be effective (12,13). The nature of the DNA mimotope in these cases has not been identified.

Little is known, however, about the prevalence or clinical importance of anti-id antibodies, particularly those that may be induced by the anti-DNA antibodies. These appear to have both positive and negative immunoregulatory roles, as well as beneficial and deleterious effector functions (1416). We had previously argued that because half of our SLE patients developed anti-id antibodies to anti-DNA antibodies which bear the T14 id, these anti-id antibodies (which are directed to the DXP'1-encoded VHCDR3 segment) may be pathogenic by forming inflammatory immune complexes with the primary antibody (14,17). The prototypic T14 antibody was described by van Es et al. (18). We attempt to extend these observations to animals in the present study using mice which produce a transgene-encoded anti-phosphorylcholine (PC) antibody (19). This murine antibody, which bears the T15 id, does not bind to DNA and is not related to T14 except that it has a VHCDR3 segment encoded largely by the DFL16.1 gene, the mouse equivalent of DXP'1. The conserved motif shared by these D genes is YYGS(G)S (see Table 1Go). We investigate whether anti-id antibodies to the transgene-encoded protein could be induced by immunizing the animals with a peptide based on the VHCDR3 of the transgene, so that the effect of having both sets of id+ and anti-id antibodies present continually in the animal could be studied. We find that anti-id antibodies could indeed be elicited as easily as in animals without the transgene, but importantly, anti-DNA antibodies were also induced. This raises the intriguing possibility that anti-DNA antibodies may arise easily in nature as a result of the inadvertent induction by antibodies that are not necessarily DNA specific, but which are teleologically important or which are specifically induced in the course of an infection. T15+ antibodies are a notable example of these (20). We show, further, that this potential extends to human DXP'1-encoded antibodies. The present report focuses on the nature of the various anti-peptide antibodies generated and not their biologic functions.


View this table:
[in this window]
[in a new window]
 
Table 1. Peptides used in study
 

    Methods
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
Antigens and human sera
The peptides described in Table 1Go and Fig. 3Go were custom-made with >70% purity and conjugated via the C-terminal end to human serum albumin (HSA) or tetanus toxoid at 94–104 nmol/mg carrier (Chiron Technologies, Clayton, Australia). Unconjugated P9 and the subpeptides were synthesized by Research Genetics (Huntsville, AL). Purified TEPC15 (IgA,{kappa}) protein, HSA and ovalbumin, were obtained from Sigma (St Louis, MO). TEPC15 is the prototypic T15+ Ig; it was isolated as a myeloma protein and found to be specific for PC (21). Salmonella typhi lipopolysaccharide (LPS) was obtained from Difco (Detroit, MI).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3. Characterization of three peptide-specific hybridomas (2H4, 6F4 and 11G2) obtained from P9-immunized CBA/N mice. Shown are the VH and VL genes used by the antipeptide antibodies and the specificities of these antibodies. The antigens used in the ELISAs are peptides P1–P9, dsDNA, ssDNA and TEPC15 (anti-id assay). Amino acid sequence of P1, SVSSSISSLRAATSGATAAASAA; P2, REDTNPQQPTTEGHHRGKKI; P3, AGAGGGAGGAGAGGGAGGAGC; P4, EGRHHLLVSGAG; P5, SSTHVPTNLTAPAS; P8, ALVQTLAEWMGPILG; P10, KGGDRGPGSMTD.

 
Human sera were obtained from our routine laboratory. Sera from clinically-confirmed SLE patients (14) were selected on the presence of both antinuclear and anti-double-stranded (ds) DNA antibodies. Control sera lacking these antibodies came from non-SLE patients.

Animals and immunization
Six-month-old CBA/N xid/xid mice which harbored the T15+ transgene were obtained as described previously (19). Transgene-negative littermates of these mice were used as controls.

The animals were injected with alum-precipitated peptide–HSA or HSA (50 µg) in complete Freund's adjuvant i.p. A booster dose (10 µg) was given i.p. 2 weeks later in incomplete Freund's adjuvant, and blood was obtained from the retro-orbital plexus on days 0, 7, 14 and 21 following the primary dose. All procedures were approved by the Ethics Committee of the University.

Comparison of data between groups of animals was performed using the Mann–Whitney non-parametric test (Prism 3.0; GraphPad Software, San Diego, CA).

B cell hybridomas
Mice immunized with two i.p. doses of P9–HSA were given another dose of the peptide (10 µg, in saline) i.v. before spleen cells were obtained and fused with Sp2/0 myeloma cells according to conventional procedures (14), using polyethylene glycol (mol. wt 1450; Sigma). Clones were screened for reactivity against P9–toxoid and selected hybridomas were grown as ascites. The IgM antibodies were purified from the ascites fluid by precipitation with 50% cold saturated ammonium sulfate followed by cryoprecipitation.

Antipeptide and anti-DNA ELISA
Antipeptide antibodies were detected essentially as described (14). Briefly, P9–toxoid (2 µg/ml) was coated in bicarbonate buffer, pH 9.6, on Immulon-2 microtiter plates (Dynex, Chantilly, VA) at 4°C overnight. The plates were blocked with 2.5% (w/v) BSA (Sigma) in PBS (pH 7.6) for 30 min and then incubated with the test serum (diluted at 1:500 in blocking buffer, in duplicates) at 37°C for 2 h. Following washing, the assay was developed with goat anti-mouse IgG (whole molecule) conjugated with horseradish peroxidase (Sigma; 1:1000 dilution) for 2 h at 37°C. Substrate (o-phenylenediamine; Sigma) was then added and incubated for 30 min at 37°C and the results were read in an ELISA reader (Dynex). [Preliminary studies had indicated that the results were similar whether the serum was titrated or assayed at a single dilution (at non-saturating antibody concentrations).]

A similar protocol was used to detect anti-DNA antibodies from mouse sera (1:100 dilution) using goat anti-mouse Ig (whole molecule) antibody (Sigma). The antigens used were purified salmon sperm dsDNA obtained from Pharmacia Biotech (Uppsala, Sweden) (20 µg/ml) or single-stranded (ss) DNA, prepared by boiling the dsDNA for 10 min and quickly chilling it on ice for 10 min.

Anti-id ELISA
Purified TEPC15 (IgA,{kappa}) was used as the detecting antigen instead of the virtually identical S107 protein for convenience. This was coated overnight at 0.5 µg/ml on microtiter plates. The test mouse serum (diluted 1:100 in 2.5% BSA/PBS) was incubated for 2 h at 37°C. Following washing, biotinylated goat anti-mouse IgG or mouse IgM (both Fc specific) (Sigma; 1:4000 dilution) was added and incubated for 2 h. ExtrAvidin peroxidase (Sigma; 1:2500 dilution) was then added and incubated for 45 min, and the assay developed as described above. Responsiveness was determined using, as cut-off, the mean response of the HSA-immunized mice + 3 SE.

Isotype and inhibition ELISA
Isotypic analysis was performed as described, but using biotinylated rabbit anti-mouse Ig subclass-specific antibodies (IgM, IgG1, IgG2a, IgG2b, IgG3) (PharMingen, San Diego, CA; 1:2000 dilution) and ExtrAvidin peroxidase (Sigma; 1:2000 dilution).

In the inhibition ELISA, the basic ELISA protocol described above was followed except that the test serum was pre-incubated with the free peptide used as inhibitor (60 µl; starting, 80 µg/ml) for 2 h at 37°C; 100 µl of the mixture was then used in the assay.

Anti-DNA immunofluorescence assay
Fixed smears of Crithidia lucilliae obtained from our routine laboratory were pre-blocked with 2% normal goat serum for 30 min and then incubated with the selected human serum for 2 h at 37°C. The smear was washed twice with PBS and incubated with fluorescein-labeled goat anti-human Ig (whole molecule) (Sanofi Diagnostics Pasteur, Chaska, MN). After 1 h, the smear was washed and examined by fluorescence microscopy. In the inhibition assay, the selected human serum was pre-incubated with the unconjugated test peptide for 2 h at 37°C before use.

mRNA sequencing
Total RNA was isolated from hybridoma cells using the RNeasy kit (Qiagen, Valencia, CA) and amplified by RT-PCR using Superscript II (Gibco/BRL, Bethesda, MD) and oligo-d(T)16 (Perkin-Elmer, Foster City, CA). Specific VH and VL fragments were obtained using the following PCR conditions: 35 cycles of 1 min each at 95, 55 and 72°C, and final elongation at 72°C for 10 min. The primers used were:

5' VH primers:

5'-TGC GGC CCA GCC GGC CCR SGT CAA RCT GCA-3' (clone 2H4)

(SfiI)

5'-AGG TCA ADC TGC AGC AGT CAG G-3' (clone 11G2)

5'-CAG GTC AAG CTG CAG CAG TCT GG-3' (clone 6F4)

3' Cµ primers:

5'-ACC TGC GGC CGC GAA GGA CTG ACT CTC-3' (clone 2H4)

(Not1)

5'-GCA GGA GAC GAG GGG GA-3' (clone 6F4)

5'-GGC CAC CAG ATT CTT ATC A-3' (clone 11G2)

5' V{kappa} primer:

5'-CCA GAT GTG AGC TCG TGA TGA CCC AGA CTC CA-3'

3' C{kappa} primer:

5'-AAG ACC TTA GAA GGG AAG ATA GG-3'

The PCR products were purified using QIAquick gel extraction kit (Qiagen) and sequenced directly using ABI Prism dRhodamine terminator cycle sequencing kit (Perkin-Elmer) in an ABI Prism 310 genetic analyzer (Perkin-Elmer). The sequences were analyzed according to GenBank (National Center for Biotechnology Information, Bethesda, MD).


    Results
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
The T15+ peptide is highly immunogenic, but only a fraction of the antibodies induced are truly anti-idiotypic
All mice immunized with the T15+ peptide (P9, Table 1Go) produced a robust secondary antibody response to the peptide, the latter dominated by IgG1 antibodies (Fig. 1Go). The antibody response to the carrier (HSA) was similarly high, while specificity of the response was shown by the absence of reactivity to unrelated antigens such as ovalbumin and S. typhi LPS (data not shown). Control mice immunized with HSA alone produced anti-HSA but no antipeptide antibodies.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1. Following the primary (day 0) and secondary (day 14) injections with the P9 peptide–HSA or the control (HSA) antigen, the antibody responses of the mice were measured by ELISA against the peptide (using P9–toxoid) or TEPC15 (anti-id, IgG class only). Shown are the results for transgenic (15 P9-immunized, eight HSA-immunized) and non-transgenic (nine P9-immunized, eight HSA-immunized) mice.

 
The results were similar whether transgenic CBA/N mice or non-transgenic littermates of these were used (Fig. 1Go), indicating that the transgene did not affect the antipeptide response. This implies that (i) allelic exclusion due to the transgene is incomplete, as observed by us (19) and for a similar (IgG2a) transgene previously (22), and (ii) tolerance to the transgene product can be abrogated by immunization. This is interesting because the transgenic animals constitutively produce both membrane and secreted forms of the IgG2b,{kappa} antibody.

To determine whether the antipeptide antibodies recognize native Id determinants in T15+ antibodies, an assay was established which exploits the isotypic difference between the detecting antigen (intact IgA protein of TEPC15) and the anti-id antibodies (IgG or IgM). High levels of IgG, but very little IgM, anti-id antibodies were found in the majority (90.4%) of the animals (Fig. 1Go), suggesting a thymus-dependent response. Again, the results were similar whether transgenic or non-transgenic mice were used (Fig. 1Go). Hence, for simplicity, subsequent analyses utilize pooled data from both groups of animals.

The fine specificities of the antipeptide and anti-id antibodies are different from each other. Thus, using smaller (6mer) segments of the P9 peptide (Table 1Go) as probes in inhibition assays, it was found that in all mice examined, the whole peptide, as well as the P9b subpeptide which covers the C-terminal half of P9, were inhibitory in the anti-whole peptide assay; the other subpeptides were not (Fig. 2AGo). This implies that the antibodies are directed largely to the FDV region in P9. In contrast, in the anti-id assay, while the whole peptide was inhibitory, the P9b subpeptide was not (Fig. 2BGo). In addition, in some of these animals, the N-terminal (P9a) and central (P9c) subpeptides were also inhibitory, albeit weakly, suggesting that the (Y)GSS residues are important for antigenicity. Other anti-id antibodies presumably recognize a less defined or a conformational epitope. The fact that in all cases the P9a and P9c subpeptides were not inhibitory in the anti-whole peptide assay suggests that the anti-id antibodies form only a very small fraction of the antipeptide antibodies.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2. Representative results of a day 21 serum assayed for total antipeptide (A) or IgG anti-id (B) antibodies showing specificity of the assay and differences in the pattern of inhibition by the P9 subpeptides. Results are calculated from buffer controls. The presence of a P9-associated (T15+) id in P6 and P7 is shown by immunizing mice with these peptides (HSA conjugates) and assaying the sera (1:500 dilution) for anti-id activity (C). Results are expressed as mean ± SE of three mice. P2 and P3 are irrelevant peptides (see Fig. 3Go legend).

 
Human DXP'1-derived peptides have T15+ activity
We have previously shown, using SLE sera, that the human peptides, P6 and P7 (Table 1Go), cross-react with P9 (14). These peptides are based on the VHCDR3 segment of the human anti-DNA antibodies, T14 and 18/2 respectively, and both are encoded by the DXP'1 gene. In the present study, P6 and P7 were used to immunize normal BALB/c mice and the sera obtained were assayed for anti-id (T15+) activity, using TEPC15 as the detecting antigen. As shown in Fig. 2(C)Go, both types of sera contained high levels of anti-id antibodies, suggesting P6, P7 and P9 are antigenically related (see Discussion).

Both the murine and human T15+ peptides induce anti-DNA antibodies
The antibodies produced in the P9-immunized mice were examined further by constructing hybridomas from the animals. Three IgM clones (2H4, 6F4 and 11G2) were obtained which showed reactivity to the P9 peptide (Fig. 3Go). Clone 2H4 was found to produce the transgene-encoded antibody as well, demonstrated by the dual presence of IgM antipeptide and IgG2b anti-PC activities in antigen-specific ELISAs (data not shown). In all clones, the antibody also bound very well to the human peptides, P6 and P7 (Fig. 3Go). Whereas 2H4 and 11G2 showed no reactivity to irrelevant non-Ig peptides (including those derived from Epstein–Barr virus), 6F4 was polyreactive.

Sequence analysis of the transcripts from the clones revealed that different VH and VL (variable region of heavy and light chain respectively) genes were used in the antibodies (Fig. 3Go). Interestingly, in the double-producer clone, 2H4, only one VL transcript was detected which belonged to the transgene. Interestingly, too, the VH segment of the 2H4 antipeptide antibody, encoded by the VHJ558, DSP2 and JH4 genes, is used commonly by various DNA-binding antibodies (GenBank, NCBI, Bethesda, MD). The CDR3 region, YSNYGAIDY, in fact, is very similar to that (QAYSNYGAMDY) of a Z-DNA-binding antibody (23). The possibility that 2H4 could be DNA specific was consequently examined. The antibody was indeed found to bind very well to both dsDNA and ssDNA. The 6F4 antibody, but not 11G2, was also reactive with the DNA substrates. It is not clear why 6F4 is polyreactive, although the VH (VH11) and VL (V{kappa}8) genes used have been described in polyreactive antibodies (24). The VHCDR3 of 6F4 is unusually `bulky' as it comprises the residues H (N region), NW (DQ52) and AWFAY (JH3). Whether this contributes to the polyreactivity of the antibody remains an interesting possibility particularly since this region of the molecule has been implicated in such a role previously (24,25), but not always (26). For comparison, the VHCDR3 of 11G2 is quite different, YYSNYVRVLLTGAKGL.

Based on the above finding, the P9-immunized mice were examined to see if anti-DNA antibodies had been induced by the peptide in these animals. Indeed, 21% of the animals showed elevated levels of antibodies to dsDNA, while a higher number (67%) produced anti-ssDNA antibodies that was highly significant (Fig. 4AGo). The number of responders to dsDNA may be underestimated due to the high background of the assay.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4. (A) Day 21 sera of the P9 peptide-immunized CBA/N mice assayed against dsDNA or ssDNA. Shown are the results of individual mice, the mean response of each group (horizontal bar), and the P values obtained by comparing the responses of the peptide-immunized and control animals. Numerical values indicate percent of responders estimated from using, as cut-off, mean response of HSA-immunized mice + 10 SE. (B) Anti-dsDNA antibody response of BALB/c mice immunized with P6–HSA or HSA. Shown are two separate experiments done at different times.

 
It appears that the anti-DNA and anti-id antibodies are very similar to each other in many ways. Thus, the anti-DNA response of the P9-immunized mice shows a close relationship with the anti-id response of these animals, which is very different from the total antipeptide response (Fig. 5Go). However, only 32% (dsDNA) to 74% (ssDNA) of the anti-id-producing mice made anti-DNA antibodies. A possible distinction between the anti-DNA and anti-id antibodies is that, as exemplified by the 2H4 and 6F4 mAb, anti-DNA antibodies may not bind to TEPC15 in the anti-id assay (Fig. 3Go).



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5. Regression analysis of the anti-dsDNA or anti-ssDNA response with the anti-id or antipeptide response in the 10 mice that were responders for all these antigens.

 
In a later study, the ability of the human peptide, P6, to induce anti-DNA antibodies was examined. As shown in Fig. 4(B)Go, 16–40% of the immunized mice produced significant levels of anti-dsDNA antibodies. (Response to ssDNA not measured.)

SLE patients produce peptide-specific anti-DNA antibodies
Direct demonstration proving that P9 and P6 (P7, not done) are DNA surrogates is shown in Fig. 6Go. Anti-dsDNA antibodies present in SLE sera normally stain the kinetoplast and nucleus of C. lucilliae, as revealed by fluorescence microscopy. Addition of the P9 or P6 peptide to the serum specifically abolished this reactivity in four out of 10 patients examined. It is not clear, at this stage, why only some sera are inhibitable by the peptides. In all cases, the P9 subpeptides and the control peptide (P10) were not inhibitory.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 6. Binding of anti-DNA antibodies from a SLE patient to the kinetoplasts (arrowed) of C. lucilliae (left), which is specifically inhibited by P9 (middle). Negative staining by control (normal) serum is shown (right). Fluorescence microscopyx400.

 

    Discussion
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 
A conserved sequence in Ig was identified which mimics DNA both as an immunogen and an antigen. The precise nature of the epitope is not known but the mimotope is found in peptides derived from the VHCDR3 segment of the murine anti-PC T15+ antibody, S107, and the human anti-DNA antibodies, T14 and 18/2. Since these segments are encoded principally by the DFL16.1 gene in the mouse, and by the human counterpart, DXP'1, the mimotope is likely to be determined to an important extent by the YYGS(G)S motif (see Table 1Go). This same motif, however, is also responsible for the cross-reactive id identified in the present study (Fig. 2b and cGo). Indeed, the mimotope and the id are very similar to each other, including the fact that the antibody responses to these are highly correlated with each other (Fig. 5Go). On the other hand, there are differences between the two. One is the fact that whereas the id is present and readily identifiable in the intact Ig molecule, the mimotope appears to be cryptic or hidden and becomes exposed only following reduction of the protein (Fig. 3Go). Another is the fine structure of these epitopes which is discussed further below.

Based on the specificity tests described in Fig. 2(B and C)Go, it appears that the single most critical amino acid residue defining the cross-reactive T15+ id is glycine. This is supported by an examination of the crystal structure of the VHCDR3 segment of a T15-related Ig (McPC603). As apparent (Fig. 7Go), glycine is located at the apex of the CDR3 loop and is prominently exposed to the outside. It should be noted the T15+ id has been variously defined by previous investigators depending on the reagent antibody used, all based on the prototypic T15+ Ig, TEPC15. Of particular note is the mAb, NL16, used by Nishinarita et al. (27), which recognized both the D segment and the V{kappa}22 light chain. This antibody failed to detect an Ig (140.7C6) which was very similar to TEPC15 except for a mutated D segment (YYDGS), supporting the importance of the germline-encoded glycine residue in idiotypy. The serine residue adjacent to glycine in the germline sequence does not appear to be important since a TEPC15-like Ig (H8) which has asparagine in this position was also recognized by NL16 (27). This also appears to be the case in our system since alanine found in this position in the 18/2 sequence (P6) as a result of somatic mutation had no effect on the cross-reactivity of this peptide with P9 or P7. The importance of glycine in the YYGSS motif in idiotypy was also described for an antibody which was specific for the 4-hydroxy-3-nitro-5-iodophenylacetyl hapten, but which also utilized DFL16.1 (28). The id of this Ig, as determined by several mAb, was lost in a mutant which had a glycine to arginine substitution, although antigen binding was retained.



View larger version (127K):
[in this window]
[in a new window]
 
Fig. 7. Computer-generated {alpha}-tracing of the VHCDR3 loop of the PC-binding Ig, McPC603 based on the Quanta software (Molecular Simulations, San Diego, CA) used in a Silicon Graphics workstation. The VHCDR3 structure in S107 or TEPC15 (represented by P9) is similar, except that threonine is replaced by serine/tyrosine in the latter. Shown are the YGS epitope recognized by some anti-id antibodies (marked `1'), the FDV epitope recognized by the majority of antipeptide antibodies (`2') and the less discernible epitope(s) recognized by other anti-id and anti-DNA antibodies (`3'). Also shown are the hydrogen bonds and a salt bridge.

 
The DNA mimotope is less well defined in terms of the presence of immunodominant residues (Figs 6 and 7GoGo). It is not clear how it mimics the native antigen. Anti-DNA antibodies are presumed to bind to the native antigen at the DNA backbone, spanning an almost complete turn of the double helix (29). An important interaction involves the formation of hydrogen and ionic bonds between the arginine or asparagine residue of the antibody and the phosphate oxygens of the backbone. It is possible that the tyrosines in our DNA mimotope serve the same acceptor function as the phosphate groups. Tyrosine is also found in the DNA mimotopes described by other investigators, including the VHCDR2/framework region 3 peptide (KGRFTISRDNAKSTLYL) belonging to the V-88 anti-DNA mAb (30), and the randomly generated peptides described by Putterman and Diamond (6) (DWEYSVWLSN) and, more recently, by Sun et al. (31) (RLTSSLRYNP). Whether tyrosine, or serine (which is also present in all the peptides), is indeed critical to the structure of a DNA mimotope remains to be investigated. Since there is no obvious homology between our peptides and these other peptides, it is possible that anti-DNA antibodies are heterogeneous with respect to the different peptides and this may explain why not all of our SLE patients have anti-DNA antibodies which can react with P6 or P9.

It is tempting to speculate that the DNA mimotope exists in all Ig which utilize the DFL16.1 or DXP'1 gene. The mimotope is thus potentially widespread, because DXP'1, for example, is very commonly utilized in anti-DNA antibodies (32). Identification of such a mimotope is important because this provides a chemical basis for the numerous observations made previously that immunization of mice with anti-DNA (or anti-id) antibodies can result in the production of anti-DNA antibodies (11). The id–anti-id network theory has often been used to explain this phenomenon and anti-id (Ab2) antibodies are presumed to bear the DNA mimotopes. We have not only identified such a mimotope, but have also shown that this is not necessarily confined to Ab2 but can exist in the primary antibody (Ab1), i.e. DFL16.1- or DXP'1-encoded anti-DNA antibodies can directly induce other anti-DNA antibodies to be produced. More importantly, the present finding shows that anti-DNA antibodies can be induced by antibodies of any specificity, not necessarily those that are DNA-specific, so long as these are encoded by DXP'1 or DFL16.1, i.e. they can be produced as bystander proteins in a normal anti-idiotypic response. A possible scenario is that, during an infection by a PC-containing microorganism such as Trichinella spiralis, T15+ anti-PC antibodies are generated. Anti-id antibodies are consequently produced and some of these can be DNA specific. Although there is no actual documentation of this, Shefner et al. (33) noted a transient increase in the level of anti-DNA antibodies in BALB/c mice when these animals were immunized with a PC–protein conjugate. Similar views have been expressed previously that autoimmunity may follow a common infection (11) or result from a normal functioning immune system (34). Viruses thus play a role in autoimmunity (35) not only because they have shared antigens with the host (8), but also, as we contend, because of the type of antibodies they elicit.

It remains presumptuous, however, that anti-DNA antibodies are normally induced by T15+ antibodies in a healthy person or animal. This is slightly different from the experimental situation described herein because the immunogen used was a synthetic peptide conjugated to a foreign carrier (HSA) and this was artificially administered in Freund's adjuvant. Evidently, in this case, HSA provided the T cell epitope(s) necessary for the memory response and, in the transgenic animals, the abrogation of peripheral tolerance (36) to the transgene-encoded `self' protein (data not shown). This means that B cells specific for the T15 id or for DNA are present normally in both the transgenic and non-transgenic animals. In the natural state, T cell epitopes are presumed to be continually generated in the Ig molecule through somatic hypermutation or creation at the V–D–J junctions. Such epitopes are known to exist in VH segments (12,3739). Thus, Ig fragments bearing linked B and T cell epitopes when presented to appropriate B cells can stimulate the cell, become endocytosed and processed in the same way as normal antigens for MHC class II presentation to T cells. In this way, `natural' antibodies (40) specific for DNA can be formed in a normal person or animal. T cells may be primed in the first place by dendritic cells and macrophages in the spleen and other organs following normal Ig catabolism. Ig fragments thus generated can also be presented to B cells directly by these cells in apoptotic blebs (5) or indirectly by follicular dendritic cells. Obviously, responsiveness will depend on whether adequate quantities of the relevant fragment—all bearing the same linked B and T cell epitopes and, hence, monoclonally derived—are available. What distinguishes the normal state from the autoimmune condition is perhaps the up-regulation of antibody production in the latter due to genetic factors (41) or the more appropriate presentation of the antigen (5), or alternatively that regulatory mechanisms exist normally to control the production. It is not clear, for example, why only a proportion of the peptide-immunized animals in our study were able to produce antibodies to dsDNA when virtually all of them could produce anti-id or anti-peptide antibodies.

From a teleological standpoint, T15+ antibodies are both important and interesting. The present study adds more intrigue to these. They are known to play a very important role in natural immunity (42,43) and, more recently, were found to be associated with murine atherosclerosis as well as the normal physiology of apoptotic cell clearance (44). More unusually, these proteins, including the human counterpart, can bind to their own selves (20). The id responsible for this unusual property is located in the CDR2/framework region 3 location of the murine T15 antibody and, hence, is different from that which induces the anti-DNA or anti-id antibodies described herein. However, there is a common feature among these various ids in that they all involve conserved structures present in both mouse and human. Similar interspecies, cross-reactive ids have been found in other Ig (45), indicating that, in general, such ids may serve an evolutionary function (20).

Another important revelation of the study is that the bulk of antibodies generated to a peptide may be biologically irrelevant, because they do not bind to the native antigen. In our case, these antibodies are directed to the FDV residues of the peptide, a region which is buried inside the native molecule (Fig. 7Go). Thus, studies which rely on measuring antibodies to short peptides as an alternative to determining the antibody response to a native antigen can be quite misleading.


    Acknowledgments
 
We thank Ms Peggy Fung for excellent secretarial help in preparing the manuscript and Dr H. W. Leung of the Baptist University for help in computer modeling. The study was supported in part by the Research Grants Council of Hong Kong.


    Abbreviations
 
CDR complementarity-determining region in Ig
ds double stranded
HSA human serum albumin
id idiotype (idiotope)
LPS lipopolysaccharide
PC phosphorylcholine
SLE systemic lupus erythematosus
ss single stranded
T15+ Ig of the T15 idiotype

    Notes
 
Transmitting editor: A. Kelso

Received 8 January 2001, accepted 23 May 2001.


    References
 Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 References
 

  1. Kotzin, B. L. 1996. Systemic lupus erythematosus. Cell 85:303.[Web of Science][Medline]
  2. Hahn, B. H. 1998. Antibodies to DNA. N. Engl. J. Med. 338:1359.[Free Full Text]
  3. Pisetsky, D. S. 1996. Immune activation by bacterial DNA: a new genetic code. Immunity 5:303.[Web of Science][Medline]
  4. Eilat, D. and Naparstek, Y. 1999. Anti-DNA autoantibodies: a puzzle of autoimmune phenomena. Immunol. Today 20:339.[Web of Science][Medline]
  5. Casciola-Rosen, L. A., Anhalt, G. and Rosen, A. 1994. Autoantigens targeted in systemic lupus erythematosus are clustered in two populations of surface structures on apoptotic keratinocytes. J. Exp. Med. 179:1317.[Abstract/Free Full Text]
  6. Putterman, C. and Diamond, B. 1998. Immunization with a peptide surrogate for double-stranded DNA (dsDNA) induces autoantibody production and renal immunoglobulin deposition. J. Exp. Med. 188:29.[Abstract/Free Full Text]
  7. Sabbatini, A., Bombardieri, S. and Migliorini, P. 1993. Autoantibodies from patients with systemic lupus erythematosus bind a shared sequence of SmD and Epstein–Barr virus-encoded nuclear antigen EBNA-1. Eur. J. Immunol. 23:1146.[Web of Science][Medline]
  8. Gregorio, G. V., Choudhuri, K., Ma, Y., Vegnente, A., Mieli-Vergani, G. and Vergani, D. 1999. Mimicry between the hepatitis B virus DNA polymerase and the antigenic targets of nuclear and smooth muscle antibodies in chronic hepatitis B virus infection. J. Immunol. 162:1802.[Abstract/Free Full Text]
  9. James, J. A. and Harley, J. B. 1998. B-cell epitope spreading in autoimmunity. Immunol. Rev. 164:185.[Web of Science][Medline]
  10. Jerne, N. K. 1974. Towards a network theory of the immune system. Ann. Immunol. (Paris) 125C:373.
  11. Shoenfeld, Y. 1994. Idiotypic induction of autoimmunity: a new aspect of the idiotypic network. FASEB J. 8:1296.[Abstract]
  12. Waisman, A., Ruiz, P. J., Israeli, E., Eilat, E., Könen-Waisman, S., Zinger, H., Dayan, M. and Mozes, E. 1997. Modulation of murine systemic lupus erythematosus with peptides based on complementarity determining regions of a pathogenic anti-DNA monoclonal antibody. Proc. Natl Acad. Sci. USA 94:4620.[Abstract/Free Full Text]
  13. Jouanne, C., Avrameas, S. and Payelle-Brogard, B. 1999. A peptide derived from a polyreactive monoclonal anti-DNA natural antibody can modulate lupus development in (NZBxNZW)F1 mice. Immunology 96:333.[Web of Science][Medline]
  14. Lim, P. L., Ng, L. W. K., Leung, D. T. M., Wong, K. C., Song, S. Y., Chui, Y. L., Leung, J. C. K., Lai, K. N. and Lui, S. F. 1996. Common occurrence of an anti-idiotypic antibody that recognizes T14+ anti-DNA antibodies in patients with systemic lupus erythematosus. Arthritis Rheum. 39:1980.[Web of Science][Medline]
  15. Williams, R. C. J., Malone, C. C., Huffman, G. R., Silvestris, F., Croker, B. P., Ayoub, E. M. and Massengill, S. 1995. Active systemic lupus erythematosus is associated with depletion of the natural generic anti-idiotype (anti-F(ab')2) system. J. Rheumatol. 22:1075.[Web of Science][Medline]
  16. Silvestris, F., D'Amore, O., Cafforio, P., Savino, L. and Dammacco, F. 1996. Intravenous immune globulin therapy of lupus nephritis: use of pathogenic anti-DNA-reactive IgG. Clin. Exp. Immunol. 104 (Suppl. 1):91.
  17. Leung, D. T. M., Yam, N. W. C., Chui, Y. L., Wong, K. C. and Lim, P. L. 2000. A human and a mouse anti-idiotypic antibody specific for human T14+ anti-DNA antibodies reconstructed by phage display. Gene 255:373.[Web of Science][Medline]
  18. van Es, J. H., Gmelig Meyling, F. H. J., van de Akker, W. R. M., Aanstoot, H., Derksen, R. H. W. M. and Logtenberg, T. 1991. Somatic mutations in the variable regions of a human IgG anti-double-stranded DNA autoantibody suggest a role for antigen in the induction of systemic lupus erythematosus. J. Exp. Med. 173:461.[Abstract/Free Full Text]
  19. Lim, P. L., Chan, S. T. H., Leung, D. T. M., Ng, S. S. M. and Loh, T. T. 1994. Production of anti-phosphorylcholine antibodies of the T15 idiotype in CBA/N xid mice: Investigation of the defect using a T15 immunoglobulin transgene. Mol. Immunol. 31:351.[Web of Science][Medline]
  20. Halpern, R., Kaveri, S. V. and Köhler, H. 1991. Human anti-phosphorylcholine antibodies share idiotopes and are self-binding. J. Clin. Invest. 88:476.
  21. Potter, M. 1977. Antigen-binding myeloma proteins of mice. Adv. Immunol. 25:141.[Web of Science][Medline]
  22. Tsao, B. P., Ohnishi, K., Cheroutre, H., Mitchell, B., Teitell, M., Mixter, P., Kronenberg, M. and Hahn, B. H. 1992. Failed self-tolerance and autoimmunity in IgG anti-DNA transgenic mice. J. Immunol. 149:350.[Abstract]
  23. Chen, Y. and Stollar, B. D. 1999. DNA binding by the VH domain of anti-Z-DNA antibody and its modulation by association of the VL domain. J. Immunol. 162:4663.[Abstract/Free Full Text]
  24. Chen, C., Stenzel-Poore, M. P. and Rittenberg, M. B. 1991. Natural auto- and polyreactive antibodies differing from antigen-induced antibodies in the H chain CDR3. J. Immunol. 147:2359.[Abstract]
  25. Weller, S., Conde, C., Knapp, A. M., Levallois, H., Gilfillan, S., Pasquali, J. L. and Martin, T. 1997. Autoantibodies in mice lacking terminal deoxynucleotidyl transferase: evidence for a role of N region addition in the polyreactivity and in the affinities of anti-DNA antibodies. J. Immunol. 159:3890.[Abstract]
  26. Diaw, L., Magnac, C., Pritsch, O., Buckle, M., Alzari, P. M. and Dighiero, G. 1997. Structural and affinity studies of IgM polyreactive natural autoantibodies. J. Immunol. 158:968.[Abstract]
  27. Nishinarita, S., Claflin, J. L. and Lieberman, R. 1985. T15 D region germ line amino acid sequences distinguished by monoclonal antibody. J. Immunol. 134:436.[Abstract]
  28. Radbruch, A., Zaiss, S., Kappen, C., Bruggemann, M., Beyreuther, K. and Rajewsky, K. 1985. Drastic change in idiotypic but not antigen-binding specificity of an antibody by a single amino-acid substitution. Nature 315:506.[Medline]
  29. Marion, T. N., Tillman, D. M., Jou, N. T. and Hill, R. J. 1992. Selection of immunoglobulin variable regions in autoimmunity to DNA. Immunol. Rev. 128:123.[Web of Science][Medline]
  30. Eivazova, E. R., McDonnell, J. M., Sutton, B. J. and Staines, N. A. 2000. Cross-reactivity of anti-idiotypic antibodies with DNA in systemic lupus erythematosus. Arthritis Rheum. 43:429.[Web of Science][Medline]
  31. Sun, Y., Fong, K. Y., Chung, M. C. M. and Yao, Z. J. 2001. Peptide mimicking antigenic and immunogenic epitope of double-stranded DNA in systemic lupus erythematosus. Int. Immunol. 13:223.[Abstract/Free Full Text]
  32. Stewart, A. K., Huang, C., Long, A. A., Stollar, B. D. and Schwartz, R. S. 1992. VH-gene representation in autoantibodies reflects the normal human B-cell repertoire. Immunol. Rev. 128:101.[Web of Science][Medline]
  33. Shefner, R., Kleiner, G., Turken, A., Papazian, L. and Diamond, B. 1991. A novel class of anti-DNA antibodies identified in BALB/c mice. J. Exp. Med. 173:287.[Abstract/Free Full Text]
  34. Mamula, M. J. 1995. Lupus autoimmunity: from peptides to particles. Immunol. Rev. 144:301.[Web of Science][Medline]
  35. Vaughan, J. H. 1997. The Epstein–Barr virus and systemic lupus erythematosus. J. Clin. Invest. 100:2939.[Web of Science][Medline]
  36. Santulli-Marotto, S., Retter, M. W., Gee, R., Mamula, M. J. and Clarke, S. H. 1998. Autoreactive B cell regulation: peripheral induction of developmental arrest by lupus-associated autoantigens. Immunity 8:209.[Web of Science][Medline]
  37. Ebling, F. M., Tsao, B. P., Singh, R. R., Sercarz, E. and Hahn, B. H. 1993. A peptide derived from an autoantibody can stimulate T cells in the (NZBxNZW)F1 mouse model of systemic lupus erythematosus. Arthritis Rheum. 36:355.[Web of Science][Medline]
  38. Ward, F. J., Khan, N., Wolger, L. J., Howe, C. A., Eivazova, E. R., Harper, N., Muller, S. and Staines, N. A. 1998. Immunogenic properties of an anti-DNA antibody-derived peptide, 88H.64-80: location of a dominant idiotope defined by T and B cells. J. Autoimmun. 11:439.[Web of Science][Medline]
  39. Brosh, N., Eilat, E., Zinger, H. and Mozes, E. 2000. Characterization and role in experimental systemic lupus erythematosus of T-cell lines specific to peptides based on complementarity-determining region-1 and complementarity-determining region-3 of a pathogenic anti-DNA monoclonal antibody. Immunology 99:257.[Web of Science][Medline]
  40. Cairns, E., Kwong, P. C., Misener, V., Ip, P., Bell, D. A. and Siminovitch, K. A. 1989. Analysis of variable region genes encoding a human anti-DNA antibody of normal origin: implications for the molecular basis of human autoimmune responses. J. Immunol. 143:685.[Abstract]
  41. Ash-Lerner, A., Ginsberg-Strauss, M., Pewzner-Jung, Y., Desai, D. D., Marion, T. N. and Eilat, D. 1997. Expression of an anti-DNA-associated VH gene in immunized and autoimmune mice. J. Immunol. 159:1508.[Abstract]
  42. Briles, D. E., Forman, C., Hudak, S. and Claflin, J. L. 1982. Anti-phosphorylcholine antibodies of the T15 idiotype are optimally protective against Streptococcus pneumoniae. J. Exp. Med. 156:1177.[Abstract/Free Full Text]
  43. Lim, P. L., Choy, W. F., Chan, S. T. H., Leung, D. T. M. and Ng, S. S. M. 1994. Transgene-encoded anti-phosphorycholine (T15+) antibodies protect CBA/N (xid) mice against infection with Streptococcus pneumoniae but not Trichinella spiralis. Infect. Immun. 62:1658.[Abstract/Free Full Text]
  44. Shaw, P. X., Horkko, S., Chang, M.-K., Curtiss, L. K., Palinski, W., Silverman, G. J. and Witztum, J. L. 2000. Natural antibodies with the T15 idiotype may act in atherosclerosis, apoptotic clearance, and protective immunity. J. Clin. Invest. 105:1731.[Web of Science][Medline]
  45. Meek, K., Takei, M., Dang, H., Sanz, I., Dauphinée, M. J., Capra, J. D. and Talal, N. 1990. Anti-peptide antibodies detect a lupus-related interspecies idiotype that maps to H chain CDR2. J. Immunol. 144:1375.[Abstract]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J Med MicrobiolHome page
F. C. H. Tam, D. T. M. Leung, C. H. Ma, and P.-L. Lim
Modification of the TUBEX typhoid test to detect antibodies directly from haemolytic serum and whole blood
J. Med. Microbiol., November 1, 2008; 57(11): 1349 - 1353.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Niu, D. T. M. Leung, C. H. Ma, E. C. Y. Law, F. C. H. Tam, and P.-L. Lim
Cells That Produce Deleterious Autoreactive Antibodies Are Vulnerable to Suicide
J. Immunol., August 1, 2008; 181(3): 2246 - 2257.
[Abstract] [Full Text] [PDF]


Home page
J Med MicrobiolHome page
F. C. H. Tam, T. K. W. Ling, K. T. Wong, D. T. M. Leung, R. C. Y. Chan, and P. L. Lim
The TUBEX test detects not only typhoid-specific antibodies but also soluble antigens and whole bacteria
J. Med. Microbiol., March 1, 2008; 57(3): 316 - 323.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. T. M. Leung, W. W. C. van Maren, F. K. L. Chan, W. S. Chan, A. W. I. Lo, C. H. Ma, F. C. H. Tam, K. F. To, P. K. S. Chan, J. J. Y. Sung, et al.
Extremely Low Exposure of a Community to Severe Acute Respiratory Syndrome Coronavirus: False Seropositivity due to Use of Bacterially Derived Antigens.
J. Virol., September 1, 2006; 80(18): 8920 - 8928.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (9)
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Wun, H.-L.
Right arrow Articles by Lim, P.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wun, H.-L.
Right arrow Articles by Lim, P.-L.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?