International Immunology, Vol. 13, No. 8, 1013-1020,
August 2001
© 2001 Japanese Society for Immunology
CpG DNA induces cyclooxygenase-2 expression and prostaglandin production
1 Departments of Internal Medicine and
2 Department of Pathology, University of Iowa College of Medicine, 200 Hawkins Drive, Iowa City, IA 52242, USA
3 Department of Veterans Affairs Medical Center, Iowa City, IA 52242, USA
4 Department of Inflammatory Disease Research, Pharmacia, St Louis, MO 63198, USA
Correspondence to: D. J. Berg
| Abstract |
|---|
|
|
|---|
Unmethylated CpG motifs found in bacterial DNA are potent activators of the innate and acquired immune systems, and rapidly induce the production of proinflammatory cytokines. We hypothesized that CpG DNA may also elicit the production of prostaglandins (PG), which are central lipid mediators of the immune and inflammatory response. To test our hypothesis, we stimulated murine spleen cells and RAW 264.7 murine macrophage cells with CpG DNA and assessed the effects on the PG synthesis pathway. Compared to control, DNA-containing CpG motifs induced >5-fold increase in PGE 2 production and rapidly up-regulated cyclooxygenase-2 (COX-2) at both the mRNA and protein level. CpG DNA was an extremely strong inducer of COX-2 as concentrations as low as 3 ng/ml induced COX-2 protein expression. The CpG DNA-induced PGE 2 down-regulated the immune response elicited by CpG. Blockade of PGE 2 production with selective COX-2 inhibitors or neutralizing anti-PGE 2 antibody markedly enhanced IFN-
secretion
in vitro
from CpG DNA-stimulated spleen cells. Moreover, selective COX-2 inhibition increased CpG DNA-induced IFN-
secretion
in vivo
. Inhibition of COX-2 also increased CpG DNA-induced lytic activity of NK cells. Taken together, these data indicate that DNA containing CpG motifs is a potent inducer of COX-2 and PGE
2
production. CpG-induced PG may subsequently down-regulate the immune and inflammatory responses elicited by the CpG DNA.
Keywords: CpG DNA, cyclooxygenase, cytokines, inflammatory mediators, prostaglandins
| Introduction |
|---|
|
|
|---|
Recent studies have demonstrated that bacterial DNA (bDNA) is a potent activator of multiple arms of the immune system. bDNA can stimulate B cell activation and Ig secretion ( 1 ), activate NK cells ( 2 ), and induce IFN-
production (
3
,
4
). In contrast, vertebrate DNA is immunologically inert. A key difference between the bacterial and vertebrate genome is the striking difference in the frequency and methylation status of CpG dinucleotides. CpG dinucleotides in bacterial genomes occur at the expected frequency of ~1/16 predicted by random base utilization. In addition, the CpG sequences in bDNA are unmethylated. In contrast, CpG dinucleotides in vertebrate DNA are suppressed to a frequency of only 1/5060, almost all of which are methylated (
5
). The DNA sequence responsible for the stimulatory effect of bDNA has been identified and termed the CpG stimulatory motif. These motifs typically have an unmethylated CpG situated with a certain nucleotide sequence preceded by ApA, GpA or GpT on the 5' site and followed by two pyrimidines on the 3' side (
5
). These CpG motifs mimic the stimulatory effect of bDNA (
6
). CpG DNA can induce the secretion of T
h
1 cytokines such as IL-12 and IFN-
, as well as proinflammatory cytokines including tumor necrosis factor (TNF)-
, IL-6 and type I IFN (
7
). In addition, CpG DNA activates NK cells to secrete IFN-
and enhances their lytic activity (
2
,
8
,
9
). These studies demonstrate that CpG DNA is able to induce multiple protein mediators of the immune and inflammatory response.
Prostaglandins (PG) are lipid mediators that are also key effectors of acute and chronic inflammation (
10
14
). Moreover, PG are important regulators of cell-mediated immune responses. For example, PGE
2
is a potent inhibitor of T
h
1-type T cell responses (
15
), inhibiting both IFN-
production as well as IL-12 and IL12R expression (
15
,
16
). Exogenous PGE
2
is also a potent inhibitor of macrophage-derived inflammatory mediators, including TNF-
production (
17
) and nitric oxide production (
18
).
As PG are potent bioactive mediators, their synthesis is tightly controlled. The key regulatory enzyme of the PG biosynthesis pathway, PG synthase (EC 1.14.99.1) [also known as cyclooxygenase (COX)], is the first enzyme in the biosynthetic pathway leading to PG, thromboxanes and prostacyclins. The COX enzyme exists in two isoforms: COX-1, a constitutive form that is expressed in multiple cell types and is thought to produce PG central to physiologic homeostasis ( 19 ), and COX-2, an inducible form that is rapidly up-regulated in response to lipopolysaccharide (LPS), cytokines and mitogens ( 19 21 ).
Although much is known about the ability of CpG DNA to induce protein mediators of immunity and inflammation, heretofore there has been no information on the role of CpG in the induction of PG, which are central lipid mediators of immune and inflammatory responses. In this present study, we have assessed the ability of CpG DNA to induce enzymes of the PG synthesis pathway and evaluated the role of PG in the regulation of the immune response induced by CpG DNA.
| Methods |
|---|
|
|
|---|
Mice and cell lines
Female C57BL/6 (H-2b), BALB/c and SCID-BALB/c mice at 612 weeks of age were purchased from Jackson Laboratories (Bar Harbor, ME). Mice were maintained in micro-isolator cages under specific pathogen-free conditions at the animal care facility at the University of Iowa. The RAW 264.7 murine macrophage cell line was a kind gift of J. Cowdery (University of Iowa).
Reagents
Nuclease-resistant phosphorothioate-modified oligodeoxynucleotides (ODN) were provided by the Coley Pharmaceutical Group (Wellesley, MA). The immunostimulatory oligonucleotides ODN 1826 (TCCATGACGTTCCTGACGTT) and ODN 1585 (GGGGTCAACGTTGAGGGGGG) and the non-stimulatory control ODN 1982 (TCCAGGACTTCTCTCAGGTT) were used for this study (
2
,
7
).
Escherichia coli
(strain B) DNA and calf thymus DNA were purchased from Sigma (St Louis, MO). All DNA and ODN were purified by extraction with phenol:chloroform:isoamyl alcohol (25:24:1). The endotoxin level in the DNA and ODN was <1.7 ng/mg as assayed with Limulus amebocyte lysate QCL-1000 (Biowhittaker, Walkersville, MD). LPS from
Escherichia coli
(serotype 0111:B4) was obtained from Difco (Detroit, MI) and resuspended in pyrogen-free saline. Rabbit polyclonal anti-murine COX-2 was obtained from Cayman Chemical (Ann Arbor, MI); rabbit polyclonal anti-COX-1 was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). SC-58236, mouse neutralizing anti-PGE
2
(2B5) and isotype control antibody (MOPC21) were kindly provided by J. Portanova, (Pharmacia, St Louis, MO). Piroxicam and NS-398 were obtained from Biomol (Plymouth Meeting, MA). Arachidonic acid and PGE
2
were obtained from Cayman Chemical.
Cell culture conditions
RAW 264.7 cells and murine spleen cells were cultured in RPMI 1640 supplemented with 10% FCS, 2 mM
L
-glutamine, 0.05 mM 2-mercaptoethanol, penicillin (100 U/ml) and streptomycin (100 U/ml) in 12-well tissue culture plates (Costar, Corning, NY). Cells were incubated in media alone or media supplemented with ODN. Supernatants from triplicate cultures were harvested and stored at 70°C before analysis for PG or cytokine concentration. Cells were subsequently harvested for either RNA or protein isolation. In some cultures, ODN-stimulated spleen cells were incubated in the presence of PGE
2
(0.1 µM), piroxicam (16 µM), SC-58236 (0.125 µM), anti-PGE
2
antibody (2B5, 6.7 µg/ml) or isotype control antibody (MOPC21, 6.7 µg/ml). For quantitative analysis of macrophage PG production, RAW 264.6 cells were cultured at 1x10
5
cells/ml in media or media with ODN (3 µg/ml). After 24 h of culture the supernatant was removed and cells were incubated in PBS supplemented with arachidonic acid (10 µM). In some cultures, the COX-2-specific inhibitors NS-398 (10 µM) or SC-58236 (0.125 µM) were added.
PG quantification
Quantification of PGE
2
levels in tissue culture supernatants were determined using the PGE
2
EIA kit from Cayman Chemical, exactly as per the manufacturer's instructions.
RNase protection assay
A murine COX-2 cDNA fragment (nucleotides 205505; GenBank accession no. M88242) was synthesized by RT-PCR using mouse brain RNA as a template and cloned into pGEM-4. Fragments of the RPL32-4A gene were also cloned into pGEM-4 (
22
). L32 served as an internal loading control. RNase protection assay (RPA) for the detection of COX-2 was performed as previously described (
23
). Briefly, for the synthesis of a
32
P-radiolabeled anti-sense RNA probe, equimolar mixtures of the linearized COX-2 and L32 templates were used. Hybridization reactions were performed overnight at 56°C. Following RNase digestion, the RNA duplexes were isolated by electrophoresis in a standard 7.5% acrylamide/12 M urea/0.5% TBE sequencing gel. Dried gels were placed on BMR film and were exposed at 70°C.
Western blotting
Protein was isolated from cultured cells by resuspending in lysis buffer [50 mM Tris (hydroxymethyl) aminomethane, pH 7.5, 150 mM NaCl, 100 µg/ml PMSF, 1 µg/ml aprotinin, 1 µg/ml leupeptin, 1 mM diethyldithiocarbamic acid, 1% NP-40 and 1% sodium deoxycholate]. Cells were lysed by sonication (20 s, 4°C). Debris was eliminated by centrifugation (15 min, 1000
g
). Protein concentration was measured using a commercial reagent based on BCA staining (Pierce, Rockford, IL), using BSA as an internal standard. Equal amounts of cellular protein were loaded onto a 10% polyacrylamide gel and separated by electrophoresis (200 V for 45 min). Proteins were then transferred to nitrocellulose (100 V for 1 h) and the membrane was blocked with 5% non-fat dry milk. The nitrocellulose was then incubated with a rabbit polyclonal primary antibody (anti-COX-2, 1:1000; Cayman; anti-COX-1, 1:1000; Santa Cruz) overnight at 4°C. Antibody labeling was detected using enhanced chemiluminescence (ECL; Amersham) as per the manufacturer's instructions. Specificity of the anti-cyclooxygenase antibody was confirmed with the use of ram seminal vesicle PGHS-1 (Oxford Biomedical Research, Oxford, MI) and sheep placenta PGHS-2 (Cayman).
Films and photographs of RPA or Western blots were scanned in at 600 DPI using an Epson Expression 1600 scanner. Densitometric analysis was performed using Vtrace (developed at the University of Iowa Image Analysis Facility) operating on a SGI O2 Workstation. Average and integrated OD measurements were made on user-selected regions. A Kodak photographic step tablet was used to calibrate optical density.
Cytokine quantification
IFN-
detection was performed using a cytokine ELISA kit from PharMingen (San Diego, CA). Immulon-1B microtiter plates were obtained from Dynatech (Chantilly, VA). After incubation with the peroxidase substrate (tetramethylbenzidine) the plates were read at 650 nm on a microplate reader (Cambridge Technology, Watertown, MA).
Cytotoxicity assay
Spleen cells from C57BL/6 mice were depleted of B cells using paramagnetic beads coated with goat anti-mouse Ig as previously described (
24
,
25
). Murine spleen cells were cultured at 5x10
6
cells/ml, at 37°C in a 5% CO
2
humidified atmosphere in 24 well-plates with medium alone or with ODN (10 µg/ml). Where indicated, cultures were supplemented with piroxicam (0.1 mM), SC-58236 (0.25 µM) or PGE
2
(0.1 µM). Cultures were harvested at 18 h and the cells were used as effectors in a standard 4-h
51
Cr-release assay against YAC-1 target cells labeled with Na
51
CrO
4
(Amersham Life Science, Arlington Heights, IL) as described previously (
24
-
26
). One lytic unit (LU) was defined as the number of the cells needed to exert 30% specific lysis.
In vivo experiments
BALB/c mice were injected i.p. with 0.2 ml of diluent or SC-58236 (20 mg/kg). One hour later, mice were injected with 30 µg of ODN 1826 or PBS. Five hours later, the mice were anaesthetized with Avertin (Aldrich, Milwaukee, WI) and blood was obtained from the retro-orbital plexus. The blood was allowed to clot on ice for 1 h and centrifuged at 10,000 r.p.m. for 10 min. The serum was used for IFN-
determination by ELISA (as described above).
| Results |
|---|
|
|
|---|
Characterization of PG production induced by immunostimulatory DNA
To characterize the effects of ODN on PG production, we assessed the effect of ODN stimulation on PGE 2 production by spleen cells ( Fig. 1A
|
Immunostimulatory ODN induce COX-2 mRNA
As we found that CpG ODN stimulation induced PG production from spleen cells and the macrophage cell line RAW 264.7, we next determined the effect of CpG ODN on mRNA expression for the inducible COX isoform, COX-2. RAW 264.7 macrophages were incubated with media or ODN (3 µg/ml) for varying time periods (0, 2, 4, 6 and 24 h) and RNA isolated for COX-2 expression using RPA. As shown in Fig. 2 (B)
|
Immunostimulatory ODN induces COX-2 protein expression
As immunostimulatory ODN increased COX-2 mRNA, we then assessed the effect of stimulatory ODN on the level of protein expression of COX-1 and COX-2. Spleen cells incubated with stimulatory ODN had increased expression of COX-2 protein, whereas non-stimulatory ODN did not induce COX-2 expression ( Fig. 3A
|
COX-inhibitors enhance CpG DNA induced IFN-
secretionCpG DNA is known to elicit strong T h 1-like immune responses both in vitro and in vivo ( 7 ). In contrast, PGE 2 , which is induced by CpG DNA, can inhibit T h 1 responses ( 15 ). We hypothesized that the synthesis of PGE 2 might be a negative feedback regulator of the T h 1 immune response stimulated by CpG DNA and therefore inhibition of PGE 2 synthesis may amplify the immune response induced by CpG DNA. To investigate this possibility, we stimulated murine spleen cells with CpG DNA in the presence of piroxicam, a non-selective COX inhibitor, or SC-58236, a selective inhibitor of COX-2, and quantified IFN-
production. As shown in
Table
1
secretion from CpG DNA-stimulated spleen cells. Similar results were obtained with the non-selective inhibitor, piroxicam (data not shown). Neither COX inhibitor alone could stimulate IFN-
secretion. The finding that SC-58236, a COX-2 selective inhibitor, enhanced IFN-
secretion indicates that the enhanced IFN-
production is secondary to inhibition of COX-2 derived PG.
|
Inhibition of PGE 2 synthesis plays an important role in enhancing IFN-
secretionThe blockade of the COX enzyme will inhibit synthesis of multiple PG (e.g. PGE 2 , PGD 2 and dPGJ 2 ) all of which potentially can inhibit T h 1 immune responses. To assess the role of PGE 2 in the modulation of IFN-
secretion elicited by CpG ODN, we added a neutralizing antibody (2B5) specific for PGE
2
into CpG DNA-stimulated spleen cell cultures. Compared with control antibody, 2B5 significantly enhanced IFN-
secretion from CpG-stimulated spleen cells (
Table
1
secretion.
COX inhibitors augment the cytotoxic activity of NK cells
It has previously been shown the certain CpG DNA sequences can elicit strong lytic activity in NK cells (
2
), whereas exogenous PGE
2
is known to inhibit the activity of NK cell killing (
27
,
28
). We hypothesized that if CpG DNA-induced PGE
2
production was blocked, the lytic activity of NK cells would be enhanced. To test our hypothesis, we stimulated B cell-depleted murine spleen cells with the stimulatory ODN 1585 in the presence or absence of a COX inhibitor. Incubation of spleen cells with the COX-2 selective inhibitor SC-58236 enhanced the NK activity induced by CpG DNA (
Table
2
). Similar data were obtained using the non-selective COX-inhibitor, piroxicam (data not shown). The addition of exogenous PGE
2
abolished the lytic activity of NK cells (
Table
2
). Taken together, these data suggest that blockade of COX-2-derived PGE
2
production resulted in enhancement of CpG DNA-induced NK lytic activity.
|
COX inhibitors augment IFN-
production in vivoWe have shown that inhibition of PGE 2 synthesis could significantly increase IFN-
secretion from spleen cells
in vitro
. To determine whether COX inhibitors could also enhance the immune stimulatory effects of CpG DNA
in vivo
, we treated mice with COX inhibitors (piroxicam or SC-58236) and subsequently injected the mice with stimulatory ODN 1826. Serum IFN-
levels were quantified 5 h post ODN injection. Inhibition of COX-2 with the COX-2 selective inhibitor SC-58236 and piroxicam (data not shown) resulted in a 4.6-fold increase in IFN-
secretion above that seen in mice injected with ODN 1826 alone (
Fig.
4
production in SCID/BALB/c mice treated with ODN 1826 (data not shown), suggesting that cell(s) other than T or B cells are responsible for the enhancement of CpG-induced IFN-
secretion by the COX-2 inhibitor.
|
| Discussion |
|---|
|
|
|---|
We have characterized the ability of CpG DNA to induce PG synthesis and evaluated the role of CpG-induced PG in the regulation of the immune/inflammatory response to CpG DNA. Our studies clearly demonstrate that CpG DNA is a potent stimulus for PG production. Consistent with this finding, stimulation of immune cells with DNA containing CpG motifs resulted in marked increases in COX-2 mRNA and protein as compared to the non-stimulatory DNA. Moreover, we found that the PG produced in response to CpG DNA inhibited CpG-induced cytokine production and CpG-induced NK activity. Taken together, these results demonstrate that PG synthesis is a major component of the response induced by DNA containing CpG motifs and suggests that CpG DNA-induced PG may regulate the CpG-elicited immune/inflammatory response.
PG are potent bioactive lipid mediators and thus PG production is tightly controlled. The increase in PGE 2 production observed in CpG DNA-stimulated spleen cells or RAW 264.7 macrophages occurs together with markedly increased levels of COX-2 mRNA and protein. This is consistent with previous studies that have demonstrated that PG production in response to LPS, cytokines and/or mitogens is due almost entirely to rapid induction of the COX-2 isoform ( 29 , 30 ). Our finding that NS-398 and SC-58236, which are selective COX-2 inhibitors, blocked the increased PG production from CpG DNA-stimulated cells confirms that the increased PG production induced by CpG DNA is secondary to increased COX-2 expression and/or activity. In contrast, CpG DNA appeared to exert no regulatory effect on COX-1 protein expression, similar to previous reports indicating that COX-1 expression is constitutive rather than inducible ( 31 ). Interestingly, we have found that CpG DNA can increase the generation of free arachidonic acid, suggesting (data not shown) that CpG stimulation coordinately regulates the generation of COX-2 as well as the substrate for this enzyme and thus further enhancing PG formation. Future studies will address whether CpG stimulation results in increased expression of phospholipase enzymes (cPLA2, sPLA2) and/or activation of the phospholipase enzymes.
The CpG motif in bDNA is one of the molecular patterns recognized by the innate immune system. bDNA/CpG DNA signals through the recently described Toll-like receptor 9 (TLR9) (
32
). Similar to TLR2 (which recognizes peptidoglycan and bacterial lipoprotein) (
33
) and TLR4 (which is a receptor for LPS) (
34
,
35
), TLR9 transmits the CpG-induced cellular signals through a MyD88-dependent pathway (
36
) resulting in activation of the p38 mitogen-activated protein kinase and subsequent activation of NF-
B. Activation of NF-
B is central to the induction of COX-2. There are two NF-
B motifs in the COX-2 promoter (
37
), and involvement of NF-
B in COX-2 expression has been documented in both mouse (
38
) and human (
39
) macrophage cell lines. Signaling by CpG DNA has been previously shown to result in rapid activation of NF-
B via rapid induction of intracellular reactive oxygen species (
40
). Furthermore, CpG DNA has also been demonstrated to rapidly activate mitogen-activated protein kinase leading to the phosphorylation and activation of the transcription factor AP-1 (
41
). Activation of the transcription factors AP-1 and NF-
B is required for cytokine induction by CpG DNA (
36
), and both of these nuclear factors are also important for the induction of COX-2 (
42
).
CpG DNA-induced PG production may be an important mediator of CpG-induced inflammation. bDNA (containing unmethylated CpG motifs) was found to induce significant inflammation in the lower respiratory tract and it has been suggested that the presence of bDNA in sputum is a potential cause of inflammation in patients with cystic fibrosis ( 43 ). In another in vivo study, introduction of bDNA containing CpG motifs into the joint space led to the development of severe and sustained arthritis, further implicating CpG DNA as a potential cause of inflammation ( 44 , 45 ). In addition, in gene therapy trials using plasmid DNA alone or complexed with liposome, the prominent untoward effect is inflammation induced by the plasmid. CpG motifs within the plasmid DNA have been identified as being responsible for the induction of the inflammation ( 46 , 47 ). PG have an important role in the mediation of pain and swelling associated with inflammation, and are key mediators of inflammatory diseases ( 12 ). Our data suggests that PG are likely to be a significant mediator in these CpG-induced inflammatory states.
PG may be important regulators of CpG-induced immune activation. CpG ODN, which have previously been demonstrated to be potent inducers of T
h
1-like cytokine activity and NK cell activation, were clearly found in our study to induce the synthesis of PGE
2
. Exogenous PGE
2
was a potent inhibitor of these effects. Moreover, blockade of PG production with either the non-selective COX inhibitor piroxicam or the selective COX-2 inhibitor SC-58236 resulted in a significant increase in CpG-induced IFN-
production, both
in vitro
and
in vivo
. Specific neutralization of PGE
2
in vitro
reproduced these findings, further identifying CpG-induced PGE
2
as the mediator of the PG effect of CpG-induced cytokine production. PGE
2
has important immuno-modulatory activities, including the ability to inhibit T
h
1 responses and the cytotoxic activity of NK cells. In addition to enhancement of cytokine production, inhibition of PG production resulted in enhancement of CpG-induced NK activity. In part, this is likely to be secondary to enhanced IFN-
production.
Our observation demonstrating that the PG production induced by CpG DNA modulates CpG-induced cytokine activity and NK cell activation has several therapeutic implications. Multiple preclinical studies have investigated the ability of CpG DNA to serve as a potent adjuvant for vaccinations and found CpG DNA to be a potent adjuvant for the induction of systemic immune responses against a variety of antigens (
48
51
). In preclinical models of asthma, CpG DNA effectively down-regulated T
h
2 responses (
52
,
53
). Studies have also shown that administration of CpG DNA alone or complexed with lipid conferred protection against transplanted melanoma cells in mice (54 and Z. Ballas, submitted). bDNA and CpG ODN could also confer resistance against lethal challenge with
Listeria monocytogenes
and
Francisella tularensis
in mouse (
5
,
55
). The CpG-induced protection against the bacterial challenge was highly dependent on the stimulation of IFN-
secretion. Based on these preclinical models, human clinical trials on the protective effects of CpG DNA against tumors and intracellular bacteria are underway. Blockade of the PGE
2
production induced by CpG DNA may enhance the potency of the immune stimulation by CpG DNA, potentially improving the clinical efficacy of these immunotherapy applications.
| Acknowledgments |
|---|
Supported by Crohn's and Colitis Foundation of America, First Award (D. J. B.), Merit Review, Department of Veterans Affairs (Z. K. B), and NS-24621 (S. A. M.)
| Abbreviations |
|---|
| COX cyclooxygenase |
| bDNA bacterial DNA |
| LPS lipopolysaccharide |
| ODN oligodeoxynucleotide |
| PG prostaglandin |
| RPA RNase protection assay |
| TLR Toll-like receptor |
| TNF tumor necrosis factor |
| Notes |
|---|
Transmitting editor: J. Allison
Received 5 March 2001, accepted 2 May 2001.
| References |
|---|
|
|
|---|
- Messina, J. P., Gilkeson, G. S. and Pisetsky, D. S. 1991. Stimulation of in vitro murine lymphocyte proliferation by bacterial DNA. J. Immunol. 147:1759.[Abstract]
- Ballas, Z. K., Rasmussen, W. L. and Krieg, A. M. 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157:1840.[Abstract]
- Tokunaga, T., Yamamoto, H., Shimada, S., Abe, H., Fukuda, T., Fujisawa, Y., Furutani, Y., Yano, O., Kataoka, T., Sudo, T., et al. 1984. Antitumor activity of deoxyribonucleic acid fraction from Mycobacterium bovis BCG. I. Isolation, physicochemical characterization, and antitumor activity. J. Natl Cancer Inst. 72:955.
- Shimada, S., Yano, O., Inoue, H., Kuramoto, E., Fukuda, T., Yamamoto, H., Kataoka, T. and Tokunaga, T. 1985. Antitumor activity of the DNA fraction from Mycobacterium bovis BCG. II. Effects on various syngeneic mouse tumors. J. Natl Cancer Inst. 74:681.
-
Krieg, A. M., Love-Homan, L., Yi, A. K. and Harty, J. T. 1998. CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J. Immunol. 161:2428.
[Abstract/Free Full Text] - Yi, A. K., Chace, J. H., Cowdery, J. S. and Krieg, A. M. 1996. IFN-gamma promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligodeoxynucleotides. J. Immunol. 156:558.[Abstract]
-
Klinman, D. M., Yi, A. K., Beaucage, S. L., Conover, J. and Krieg, A. M. 1996. CpG motifs present in bacteria DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon gamma. Proc. Natl Acad. Sci. USA 93:2879.
[Abstract/Free Full Text] - Cowdery, J. S., Chace, J. H., Yi, A. K. and Krieg, A. M. 1996. Bacterial DNA induces NK cells to produce IFN-gamma in vivo and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
- Chace, J. H., Hooker, N. A., Mildenstein, K. L., Krieg, A. M. and Cowdery, J. S. 1997. Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopathol. 84:185.[Web of Science][Medline]
- Needleman, P. and Isakson, P. C. 1997. The discovery and function of COX-2. J. Rheumatol. 24:6.
-
Portanova, J. P., Zhang, Y., Anderson, G. D., Hauser, S. D., Masferrer, J. L., Seibert, K., Gregory, S. A. and Isakson, P. C. 1996. Selective neutralization of prostaglandin E2 blocks inflammation, hyperalgesia, and interleukin 6 production in vivo. J. Exp. Med. 184:883.
[Abstract/Free Full Text] - Anderson, G. D., Hauser, S. D., McGarity, K. L. Bremer, M. E. Isakson, P. C. and Gregory, S. A. 1996. Selective inhibition of cyclooxygenase (COX)-2 reverses inflammation and expression of COX-2 and interleukin 6 in rat adjuvant arthritis. J. Clin. Invest. 97:2672.[Web of Science][Medline]
- Amin, A. R., Attur, M. and Abramson, S. B. 1999. Nitric oxide synthase and cyclooxygenases: distribution, regulation, and intervention in arthritis. Curr. Opin. Rheumatol. 11:202.[Medline]
- MacDermott, R. P. 1994. Alterations in the mucosal immune system in ulcerative colitis and Crohn's disease. Med. Clin. North Am. 78:1207.[Web of Science][Medline]
- Betz, M. and Fox, B. S. 1991. Prostaglandin E2 inhibits production of Th1 lymphokines but not of Th2 lymphokines. J. Immunol. 146:108.[Abstract]
-
Wu, C. Y., Wang, K., McDyer, J. F. and Seder, R. A. 1998. Prostaglandin E2 and dexamethasone inhibit IL-12 receptor expression and IL-12 responsiveness. J. Immunol. 161:2723.
[Abstract/Free Full Text] -
Kunkel, S. L., Spengler, M., May, M. A., Spengler, R., Larrick, J. and Remick, D. 1988. Prostaglandin E2 regulates macrophage-derived tumor necrosis factor gene expression. J. Biol. Chem. 263:5380.
[Abstract/Free Full Text] - Corraliza, I. M., Soler, G., Eichmann, K. and Modolell, M. 1995. Arginase induction by suppressors of nitric oxide synthesis (IL-4, IL-10 and PGE2) in murine bone-marrow-derived macrophages. Biochem. Biophys. Res. Commun. 206:667.[Web of Science][Medline]
-
Smith, W. L., Garavito, R. M. and DeWitt, D. L. 1996. Prostaglandin endoperoxide H synthases (cyclooxygenases)-1 and -2. J. Biol. Chem. 271:33157.
[Free Full Text] - Endo, T., Ogushi, F. and Sone, S. 1996. LPS-dependent cyclooxygenase-2 induction in human monocytes is down-regulated by IL-13, but not by IFN-gamma. J. Immunol. 156:2240.[Abstract]
-
DuBois, R. N., Tsujii, M., Bishop, P., Awad, J. A., Makita, K. and Lanahan, A. 1994. Cloning and characterization of a growth factor-inducible cyclooxygenase gene from rat intestinal epithelial cells. Am. J. Physiol. 266:G822.
[Abstract/Free Full Text] - Dudov, K. P. and Perry, R. P. 1984. The gene family encoding the mouse ribosomal protein L32 contains a uniquely expressed intron-containing gene and an unmutated processed gene. Cell 37:457.[Web of Science][Medline]
- Stadler, A., Pagenstecher, A., Kincaid, C. and Campbell, I. L. 1998. Analysis of gene expression by multi-probe RNase protection assay. In Harry, J. and Tilson, H. A., eds, Neurodegeneration Methods and Protocols, p. 53. Human Press, Totowa, NJ.
- Ballas, Z. K. and Rasmussen, W. 1990. NK1.1+ thymocytes. Adult murine CD4, CD8 thymocytes contain an NK1.1+, CD3+, CD5hi, CD44hi, TCR-V beta 8+ subset. J. Immunol. 145:1039.[Abstract]
- Ballas, Z. K. and Rasmussen, W. 1993. Lymphokine-activated killer cells. VII. IL-4 induces an NK1.1+CD8 alpha+beta TCR-alpha beta B220+ lymphokine-activated killer subset. J. Immunol. 150:17.[Abstract]
- Ballas, Z. K., Turner, J. M., Turner, D. A., Goetzman, E. A. and Kemp, J. D. 1990. A patient with simultaneous absence of `classical' natural killer cells (CD3, CD16+, and NKH1+) and expansion of CD3+, CD4, CD8, NKH1+ subset. J. Allergy Clin. Immunol. 85:453.[Web of Science][Medline]
- Kanar, M. C., Thiele, D. L., Ostensen, M. and Lipsky, P. E. 1988. Regulation of human natural killer (NK) cell function: induction of killing of an NK-resistant renal carcinoma cell line. J. Clin. Immunol. 8:69.[Web of Science][Medline]
- Young, M. R. and Hoover, C. S. 1986. Inhibition of spleen cell cytotoxic capacity toward tumor by elevated prostaglandin E2 levels in mice bearing Lewis lung carcinoma. J. Natl Cancer Inst. 77:425.
- O'Sullivan, M. G., Chilton, F. H., Huggins, E. M., Jr and McCall, C. E. 1992. Lipopolysaccharide priming of alveolar macrophages for enhanced synthesis of prostanoids involves induction of a novel prostaglandin H synthase. J. Biol. Chem. 267:145473.
-
Lee, S. H., Soyoola, E., Chanmugam, P., Hart, S., Sun, W., Zhong, H., Liou, S., Simmons, D. and Hwang, D. 1992. Selective expression of mitogen-inducible cyclooxygenase in macrophages with lipopolysaccharide. J. Biol. Chem. 267:25934.
[Abstract/Free Full Text] - Smith, W. L. and DeWitt, D. L. 1995. Biochemistry of prostaglandin endoperoxide H synthase-1 and synthase-2 and their differential susceptibility to nonsteroidal anti-inflammatory drugs. Semin. Nephrol. 15:179.[Web of Science][Medline]
- Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, M., Hoshino, K., Wagner, H., Takeda, K. and Akira, S. 2000. A Toll-like receptor recognizes bacterial DNA. Nature 408:740.[Medline]
-
Yoshimura, A., Lien, E., Ingalls, R., Tuomanen, E., Dziarski, R. and Golenbock, D. 1999. Recognition of Gram-positive bacterial cell wall components by the innate immune system occurs via Toll-like receptor 2. J. Immunol. 163:1.
[Abstract/Free Full Text] -
Poltorak, A., He, X., Smirnova, I., Liu, M., Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C. et al. 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085.
[Abstract/Free Full Text] -
Qureshi, S. T., Lariviere, L., Leveque, G., Clermont, S., Moore, K., Gros, P. and Malo, D. 1999. Endotoxin-tolerant mice have mutations in Toll-like receptor 4 (Tlr4) J. Exp. Med. 189:615.
[Abstract/Free Full Text] -
Hacker, H., Vabulus, R., Takeuchi, O., Hoshino, K., Akira, S. and Wagner, H. 2000. Immune cell activation by bacterial CpG-DNA through myeloid differentiation marker 99 and tumor necrosis factor receptor-associated factor (TRAF)6. J. Exp. Med. 192: 595.
[Abstract/Free Full Text] - Appleby, S. B., Ristimaki, A., Neilson, K., Narko, K. and Hla, T. 1994. Structure of the human cyclo-oxygenase-2 gene. Biochem. J. 302:723.
- D'Acquisto, F., Sautebin, L., Iuvone, T., Di Rosa, M. and Carnuccio, R. 1998. Prostaglandins prevent inducible nitric oxide synthase protein expression by inhibiting nuclear factor-kappaB activation in J774 macrophages. FEBS Lett. 440:76.[Web of Science][Medline]
-
Newton, R., Kuitert, L. M., Bergmann, M., Adcock, I. M. and Barnes, P. J. 1997. Evidence for involvement of NF-
B in the transcriptional control of COX-2 gene expression by IL-1beta. Biochem. Biophys. Res. Commun. 237:28.[Web of Science][Medline]
-
Yi, A. K., Peckham, D. W., Ashman, R. F. and Krieg, A. M. 1999. CpG DNA rescues B cells from apoptosis by activating NF-
B and preventing mitochondrial membrane potential disruption via a chloroquine-sensitive pathway. Int. Immunol. 11:2015.[Abstract/Free Full Text] -
Yi, A. K. and Krieg, A. M. 1998. Rapid induction of mitogen-activated protein kinases by immune stimulatory CpG DNA. J. Immunol. 161:4493.
[Abstract/Free Full Text] - von Knethen, A. and Brune, B. 2000 Feb 15. Superinduction of cyclooxygenase-2 by NO and agonist challenge involves transcriptional regulation mediated by AP-1 activation. Biochemistry 39:1532.[Medline]
- Schwartz, D. A., Quinn, T. J., Thorne, P. S., Sayeed, S., Yi, A. K. and Krieg, A. M. 1997. CpG motifs in bacterial DNA cause inflammation in the lower respiratory tract. J. Clin. Invest. 100:68.[Web of Science][Medline]
- Deng, G. M. and Tarkowski, A. 2000. The features of arthritis induced by CpG motifs in bacterial DNA. Arthritis and Rheumatism 43:356.[Web of Science][Medline]
- Deng, G. M., Nilsson, I. M., Verdrengh, M., Collins, L. V. and Tarkowski, A. 1999. Intra-articularly localized bacterial DNA containing CpG motifs induces arthritis. Nat. Med. 5:702.[Web of Science][Medline]
- Tan, Y., Li, S. Pitt, B. R. and Huang, L. 1999. The inhibitory role of CpG immunostimulatory motifs in cationic lipid vector-mediated transgene expression in vivo. Hum. Gene Ther. 10:2153.[Web of Science][Medline]
- Yew, N. S., Wang, K. X., Przybylska, M., Bagley, R. G., Stedman, M., Marshall, J., Scheule, R. K. and Cheng, S. H. 1999. Contribution of plasmid DNA to inflammation in the lung after administration of cationic lipid:pDNA complexes. Hum. Gene Ther. 10:223.[Web of Science][Medline]
-
Davis, H. L., Weeratna, R., Waldschmidt, T. J., Tygrett, L., Schorr, J., Krieg, A. M. and Weeratna, R. 1998. CpG DNA is a potent enhancer of specific immunity in mice immunized with recombinant hepatitis B surface antigen. J. Immunol. 160:870.
[Abstract/Free Full Text] -
Chu, R. S., Targoni, O. S., Krieg, A. M., Lehmann, P. V. and Harding, C. V. 1997. CpG oligodeoxynucleotides act as adjuvants that switch on T helper 1 (Th1) immunity. J. Exp. Med. 186:1623.
[Abstract/Free Full Text] - Lipford, G. B., Sparwasser, T., Bauer, M., Zimmermann, S., Koch, E. S., Heeg, K. and Wagner, H. 1997. Immunostimulatory DNA: sequence-dependent production of potentially harmful or useful cytokines. Eur. J. Immunol. 27:3420.[Web of Science][Medline]
-
Weiner, G. J., Liu, H. M., Wooldridge, J. E., Dahle, C. E. and Krieg, A. M. 1997. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization. Proc. Natl Acad. Sci. USA 94:10833.
[Abstract/Free Full Text] -
Kline, J. N., Waldschmidt, T. J., Businga, T. R., Lemish, J. E., Weinstock, J. V., Thorne, P. S. and Krieg, A. M. 1998. Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma. J. Immunol. 160:2555.
[Abstract/Free Full Text] - Kline, J. N. 2000. Effects of CpG DNA on Th1/Th2 balance in asthma. Curr. Opin. Immunol. 247:211.
-
Dow, S. W., Fradkin, L. G., Liggitt, D. H., Willson, A. P., Heath, T. D. and Potter, T. A. 1999. LipidDNA complexes induce potent activation of innate immune responses and antitumor activity when administered intravenously. J. Immunol. 163:1552.
[Abstract/Free Full Text] - Elkins, K. L., Rhinehart-Jones, T. R., Stibitz, S., Conover, J. S. and Klinman, D. M. Bacterial DNA containing CpG motifs stimulates lymphocyte-dependent protection of mice against lethal infection with intracellular bacteria. J. Immunol. 162:2291.
This article has been cited by other articles:
![]() |
K. Hattermann, S. Picard, M. Borgeat, P. Leclerc, M. Pouliot, and P. Borgeat The Toll-like receptor 7/8-ligand resiquimod (R-848) primes human neutrophils for leukotriene B4, prostaglandin E2 and platelet-activating factor biosynthesis FASEB J, May 1, 2007; 21(7): 1575 - 1585. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Woolard, J. E. Wilson, L. L. Hensley, L. A. Jania, T. H. Kawula, J. R. Drake, and J. A. Frelinger Francisella tularensis-Infected Macrophages Release Prostaglandin E2 that Blocks T Cell Proliferation and Promotes a Th2-Like Response J. Immunol., February 15, 2007; 178(4): 2065 - 2074. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Kozak, S. Wrotek, and A. Kozak Pyrogenicity of CpG-DNA in mice: role of interleukin-6, cyclooxygenases, and nuclear factor-{kappa}B Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R871 - R880. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Yeo, J.-G. Yoon, and A.-K. Yi Myeloid Differentiation Factor 88-dependent Post-transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: TUMOR NECROSIS FACTOR-{alpha} RECEPTOR-ASSOCIATED FACTOR 6, A DIVERGING POINT IN THE Toll-LIKE RECEPTOR 9-SIGNALING J. Biol. Chem., October 17, 2003; 278(42): 40590 - 40600. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-J. Yeo, D. Gravis, J.-G. Yoon, and A.-K. Yi Myeloid Differentiation Factor 88-dependent Transcriptional Regulation of Cyclooxygenase-2 Expression by CpG DNA: ROLE OF NF-{kappa}B AND p38 J. Biol. Chem., June 13, 2003; 278(25): 22563 - 22573. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||








